<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/archiving/1.2/JATS-archivearticle1.dtd">
<article article-type="brief-report" xmlns:xlink="http://www.w3.org/1999/xlink">
  <front>
    <journal-meta>
      <journal-title-group>
        <journal-title>microPublication Biology</journal-title>
      </journal-title-group>
      <issn pub-type="epub">2578-9430</issn>
      <publisher>
        <publisher-name>Caltech Library</publisher-name>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="doi">10.17912/micropub.biology.002221</article-id>
      <article-categories>
        <subj-group subj-group-type="heading">
          <subject>new finding</subject>
        </subj-group>
        <subj-group subj-group-type="subject">
          <subject>other</subject>
        </subj-group>
        <subj-group subj-group-type="species">
          <subject>arabidopsis</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>
          <italic>Arabidopsis</italic>
           F-BOX STRESS INDUCED (FBS) proteins have distinct subcellular interaction patterns with 14-3-3 proteins
        </article-title>
      </title-group>
      <contrib-group>
        <contrib contrib-type="author">
          <name>
            <surname>Bradley</surname>
            <given-names>Mael</given-names>
          </name>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Conceptualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/onceptualization">Conceptualization</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation">Investigation</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Formal analysis" vocab-term-identifier="https://credit.niso.org/contributor-roles/formal-analysis">Formal analysis</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Methodology" vocab-term-identifier="https://credit.niso.org/contributor-roles/methodology">Methodology</role>
          <xref ref-type="aff" rid="aff1">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Bacher</surname>
            <given-names>Meghan</given-names>
          </name>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Conceptualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/onceptualization">Conceptualization</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Formal analysis" vocab-term-identifier="https://credit.niso.org/contributor-roles/formal-analysis">Formal analysis</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation">Investigation</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Methodology" vocab-term-identifier="https://credit.niso.org/contributor-roles/methodology">Methodology</role>
          <xref ref-type="aff" rid="aff2">2</xref>
          <xref ref-type="aff" rid="aff1">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Riggan</surname>
            <given-names>Kaitlin</given-names>
          </name>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Formal analysis" vocab-term-identifier="https://credit.niso.org/contributor-roles/formal-analysis">Formal analysis</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation">Investigation</role>
          <xref ref-type="aff" rid="aff3">3</xref>
          <xref ref-type="aff" rid="aff1">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Torresan</surname>
            <given-names>Nicolo</given-names>
          </name>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Formal analysis" vocab-term-identifier="https://credit.niso.org/contributor-roles/formal-analysis">Formal analysis</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation">Investigation</role>
          <xref ref-type="aff" rid="aff1">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Tegman</surname>
            <given-names>Megan</given-names>
          </name>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Formal analysis" vocab-term-identifier="https://credit.niso.org/contributor-roles/formal-analysis">Formal analysis</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation">Investigation</role>
          <xref ref-type="aff" rid="aff1">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Angier</surname>
            <given-names>Sabine</given-names>
          </name>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Formal analysis" vocab-term-identifier="https://credit.niso.org/contributor-roles/formal-analysis">Formal analysis</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation">Investigation</role>
          <xref ref-type="aff" rid="aff4">4</xref>
          <xref ref-type="aff" rid="aff1">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Replogle</surname>
            <given-names>Amy</given-names>
          </name>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation">Investigation</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Methodology" vocab-term-identifier="https://credit.niso.org/contributor-roles/methodology">Methodology</role>
          <xref ref-type="aff" rid="aff1">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Thines</surname>
            <given-names>Bryan</given-names>
          </name>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Funding acquisition" vocab-term-identifier="https://credit.niso.org/contributor-roles/funding-acquisition">Funding acquisition</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Conceptualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/onceptualization">Conceptualization</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation">Data curation</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing - original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft">Writing - original draft</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing - review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing-review-editing">Writing - review &amp; editing</role>
          <xref ref-type="aff" rid="aff1">1</xref>
          <xref ref-type="corresp" rid="cor1">§</xref>
        </contrib>
        <aff id="aff1">
          <label>1</label>
          University of Puget Sound, Tacoma, WA
        </aff>
        <aff id="aff2">
          <label>2</label>
          University of California, Berkeley, CA
        </aff>
        <aff id="aff3">
          <label>3</label>
          Washington State University, Pullman, WA
        </aff>
        <aff id="aff4">
          <label>4</label>
          University of Rhode Island, Kingston, RI
        </aff>
      </contrib-group>
      <contrib-group>
        <contrib contrib-type="reviewer">
          <anonymous/>
        </contrib>
      </contrib-group>
      <author-notes>
        <corresp id="cor1">
          <label>§</label>
          Correspondence to: Bryan Thines (
          <email>bthines@pugetsound.edu</email>
          )
        </corresp>
        <fn fn-type="coi-statement">
          <p>The authors declare that there are no conflicts of interest present.</p>
        </fn>
      </author-notes>
      <pub-date date-type="pub" publication-format="electronic">
        <day>31</day>
        <month>8</month>
        <year>2026</year>
      </pub-date>
      <pub-date date-type="collection" publication-format="electronic">
        <year>2026</year>
      </pub-date>
      <volume>2026</volume>
      <elocation-id>10.17912/micropub.biology.002221</elocation-id>
      <history>
        <date date-type="received">
          <day>25</day>
          <month>5</month>
          <year>2026</year>
        </date>
        <date date-type="rev-recd">
          <day>12</day>
          <month>8</month>
          <year>2026</year>
        </date>
        <date date-type="accepted">
          <day>25</day>
          <month>8</month>
          <year>2026</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>Copyright: © 2026 by the authors</copyright-statement>
        <copyright-year>2026</copyright-year>
        <license license-type="open-access" xlink:href="https://creativecommons.org/licenses/by/4.0/">
          <license-p>This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.</license-p>
        </license>
      </permissions>
      <abstract>
        <p>
          F-BOX STRESS INDUCED (FBS) proteins are substrate adaptors in SCF-type E3 ubiquitin ligases that regulate plant development and stress responses. 
          <italic>Arabidopsis thaliana </italic>
          FBS1 (AT1G61340) interacts with multiple 14-3-3 proteins, but it is unknown whether other FBS family members share these interactions. Bimolecular fluorescence complementation (BiFC) assays in 
          <italic>Nicotiana benthamiana</italic>
           showed that all four FBS proteins interact with multiple 14-3-3 proteins in vivo. However, FBS1 interactions were restricted to the nucleus, whereas FBS2 – FBS4 (AT4G21510, AT4G05010, AT4G35930) interactions were detected in both the nucleus and cytosol. These findings indicate conserved 14-3-3 interactions within the FBS family, but suggest functional divergence in subcellular interaction profiles.
        </p>
      </abstract>
      <funding-group>
        <award-group>
          <funding-source>
            <institution-wrap>
              <institution>National Science Foundation (United States)</institution>
              <institution-id>https://ror.org/021nxhr62</institution-id>
            </institution-wrap>
          </funding-source>
          <award-id>grant #2035582 </award-id>
          <principal-award-recipient>Bryan Thines</principal-award-recipient>
        </award-group>
      </funding-group>
    </article-meta>
  </front>
  <body>
    <fig position="anchor" id="f1">
      <label>Figure 1. Arabidopsis FBS interactions with 14-3-3 proteins in bimolecular fluorescence complementation (BiFC) assays</label>
      <caption>
        <p>
          <bold>(A – D) </bold>
          nYFP-FBS1 through nYFP-FBS4 were co-expressed with cYFP-14-3-3 ω and H2B-RFP in four-week-old 
          <italic>N. benthamiana</italic>
           leaves. Cell walls were stained with 50 μM propidium iodide (PI), and images were taken three days after agroinfiltration. BiFC (green; first column) indicates protein interaction, while H2B-RFP and PI staining (red; second column) show nuclei and cell walls, respectively. Merged images (third column) show co-localization of BiFC signal with nuclei. 
          <bold>(E) </bold>
          nYFP-PP2-A12 was co-expressed with cYFP-14-3-3 ω and H2B-RFP as a negative control. 
          <bold>(F – J)</bold>
           The same nYFP fusion constructs and H2B-RFP were co-expressed with cYFP-14-3-3 ψ under identical conditions. 
          <bold>(K – N)</bold>
           nYFP-FBS constructs were co-expressed with cYFP-SPA1; the BiFC channel is shown (all channels are shown in Extended Data). Scale bar = 100 μm. 
          <bold>(O)</bold>
           Average number of nuclei exhibiting BiFC signal per field of view (FOV) for nYFP-FBS family members co-expressed with cYFP-14-3-3 ω, and 
          <bold>(P)</bold>
           co-expressed with cYFP-14-3-3 ψ. Error bars represent SE (n = 3 independent experimental replicates). Statistical significance was assessed using one-way ANOVA followed by Tukey’s HSD post-hoc tests. Means with different letters are significantly different from each other at 
          <italic>P</italic>
           &lt; 0.05.
        </p>
      </caption>
    </fig>
    <graphic xlink:href="25789430-2026-micropub.biology.002221"/>
    <sec>
      <title>Description</title>
      <p>
        Numerous cellular pathways in eukaryotes are regulated through selective protein degradation by the ubiquitin 26S proteasome system (UPS). SKP1-CUL1-F-box (SCF) complexes are a prevalent type of E3 ubiquitin ligase in the UPS that use F-box (FBX) proteins as substrate adaptors to specifically recruit ubiquitination targets (Lee et al., 2018; Sheard et al., 2010; Varshney et al., 2026). Four 
        <italic>Arabidopsis thaliana</italic>
         F-BOX STRESS INDUCED proteins (FBS1 – FBS4) compose a subfamily of plant-specific FBX proteins (Maldonado-Calderon et al., 2012). FBS1 and FBS4 target anaphase-promoting complex/cyclosome (APC/C)-associated regulatory proteins to control cell division events and related processes, including maintenance of the root quiescent center (QC) and cell fate determination during stomatal development (Geem et al., 2022; Li et al., 2022; Zhang et al., 2025). FBS proteins also likely target two other nuclear-localized WD40 repeat-like family proteins of unknown function (Sepulveda-Garcia et al., 2021).
      </p>
      <p>In addition to its targeting interactions, FBS1 interacts with at least six of thirteen proteins belonging to the Arabidopsis 14-3-3 family in yeast two-hybrid and in vitro pull-down assays (Sepulveda-Garcia &amp; Rocha-Sosa, 2012). 14-3-3 proteins are eukaryotic regulators that specifically interact with their client proteins to alter their activity (Wilson et al., 2016). While some 14-3-3 proteins are SCF targets in plants (Hong et al., 2017), FBS1 does not seem to target 14-3-3 proteins for degradation, as increased FBS1 abundance does not lead to a decrease in the level of FBS interactor 14-3-3 λ (AT5G10450) (Sepulveda-Garcia et al., 2021; Sepulveda-Garcia &amp; Rocha-Sosa, 2012). Furthermore, 14-3-3 proteins interact with FBS1 via the F-box domain (Sepulveda-Garcia &amp; Rocha-Sosa, 2012), which is required for FBX protein interaction with Skp and the core SCF complex. The regulatory purpose and biological consequence of FBS1 interaction with 14-3-3 proteins are currently unknown.</p>
      <p>Members of FBX protein subfamilies often have some functional redundancy while still maintaining distinct biological roles (Lee et al., 2018). FBS1 – FBS4 likely have distinct biological functions relative to each other based on their expression profiles and mutant phenotypes (Geem et al., 2022; Li et al., 2022; Maldonado-Calderon et al., 2012). However, it is unknown whether FBS2 – FBS4 also interact with 14-3-3 proteins and whether they might experience similar regulatory mechanisms to FBS1. Moreover, while FBS proteins interact with at least some of their targets in the nucleus (Li et al., 2022; Sepulveda-Garcia et al., 2021), the subcellular locations of FBS interactions with 14-3-3 proteins are unknown. Having this interaction information could offer clues as to how 14-3-3 proteins work with FBS proteins within the regulatory network associated with the APC/C to influence plant growth and development. We therefore tested all four Arabidopsis FBS proteins for interaction with multiple Arabidopsis 14-3-3 proteins in living plants using bimolecular fluorescence complementation (BiFC) assays. </p>
      <p>
        Among the four members of the FBS protein family, distinct interaction profiles with 14-3-3 proteins were observed. FBS1 interactions with 14-3-3 ω (AT1G78300) and 14-3-3 ψ (AT5G38480) were restricted to the nucleus under the conditions tested, as shown by colocalization of the BiFC signal with nuclear-localized fusion protein H2B-RFP (
        <xref ref-type="fig" rid="f1">Figure 1 </xref>
        A and F). In contrast, FBS2 – FBS4 had fewer interactions with these 14-3-3 proteins in the nucleus, but they interacted in the cytosol (
        <xref ref-type="fig" rid="f1">Figure 1 </xref>
        B – D and G – I). The frequencies of nuclear interactions between FBS2 – FBS4 and 14-3-3 proteins ω or ψ were less than 25% of those found for FBS1 interactions in a field of view (
        <xref ref-type="fig" rid="f1">Figure 1 </xref>
        O and P). Because the F-box domain is required for FBS1 interaction with 14-3-3 proteins (Sepulveda-Garcia &amp; Rocha-Sosa, 2012), we tested the phylogenetically related FBX protein PP2-A12 (AT1G12710), one of the two closest non-FBS FBX family members based on F-box domain sequence analysis (Gagne et al., 2002). In contrast to the FBS proteins, no BiFC signal was detected when PP2-A12 was co-expressed with either of the 14-3-3 proteins under the conditions tested (
        <xref ref-type="fig" rid="f1">Figure 1 </xref>
        E and J). As an additional negative control for nonspecific interactions, FBS proteins were tested with the unrelated nuclear-localized protein SPA1 (AT2G46340) (Zhu et al., 2008), and no detectable BiFC signal was observed for any of the four FBS proteins (
        <xref ref-type="fig" rid="f1">Figure 1 </xref>
        K – N, see also Extended Data). Collectively, these findings show distinct subcellular patterns of FBS/14-3-3 interactions in vivo, while the negative control results are consistent with specificity of the observed BiFC interactions.
      </p>
      <p>FBS proteins have numerous protein interactors, some of which are ubiquitylation targets, while others may regulate FBX protein function and the ubiquitylation process. This work found that all four FBS proteins interacted with 14-3-3 proteins in living plant cells, indicating that 14-3-3 interaction is conserved within the FBS family. However, FBS1 showed the highest frequency of nuclear interactions with the 14-3-3 proteins under the conditions tested here, suggesting potential functional divergence or distinct contributions among family members. Although the negative controls are consistent with specificity of the observed FBS/14-3-3 interactions, PP2-A12 and SPA1 protein accumulation was not independently verified and alternative orientations of the YFP fragments were not tested. Thus, differences in protein abundance or steric constraints could contribute to the absence of BiFC signal with PP2-A12 or SPA1, and these results should not be interpreted as definitive evidence for lack of interaction. Moreover, BiFC can stabilize transient protein interactions (Kudla &amp; Bock, 2016), and therefore these findings may not fully reflect endogenous interaction dynamics. Nevertheless, the absence of detectable BiFC signal between FBS proteins and SPA1 or between 14-3-3 proteins and PP2-A12, together with the distinct subcellular interaction patterns observed among FBS family members and previous yeast two-hybrid and in vitro pull-down evidence for FBS1/14-3-3 interactions (Sepúlveda-García &amp; Rocha-Sosa, 2012), provides support for the specificity of the observed FBS/14-3-3 interactions.</p>
      <p>The N-terminal region and F-box domain of FBS1 have previously been implicated in 14-3-3 binding (Sepulveda-Garcia &amp; Rocha-Sosa, 2012), but whether these regions similarly mediate 14-3-3 interactions with FBS2 – FBS4 remains unknown. Canonical Mode I or Mode II 14-3-3 recognition motifs often mediate 14-3-3 protein interaction with the client protein (Camoni et al., 2018). None of the four FBS proteins contains either of these motifs. The absence of canonical recognition motifs suggests that FBS interactions with 14-3-3 proteins may involve noncanonical phosphorylation-dependent binding sites or an alternative mode of interaction. Sequence analysis using 14-3-3-Pred, software that predicts 14-3-3-binding phosphopeptides (Madeira et al., 2015), identified several Ser/Thr residues in FBS1, FBS2, and FBS4 with scores above the consensus prediction threshold, despite their occurrence outside canonical recognition motifs. These residues therefore represent candidate phosphorylation sites for future studies testing the effects of amino acid substitutions on 14-3-3 binding.</p>
      <p>
        The purpose of FBS interaction with 14-3-3 proteins is currently unknown. One possibility is that these interactions regulate FBS distribution within the cell, as some 14-3-3 protein interactions control the subcellular localization of client proteins (Gampala et al., 2007; Huang et al., 2018). A more in-depth investigation of FBS localization, whether bound to 14-3-3 proteins or not, may clarify whether cellular distribution plays a role in restricting FBS activities. The roles of 14-3-3 proteins in regulating FBS localization could then be tested through genetic reduction of 14-3-3 activity in Arabidopsis mutants or through chemical inhibition using AICAR (Toroser et al., 1998). Alternatively, interactions between FBS and 14-3-3 proteins may have important implications for SCF complex assembly and substrate specificity. SCF complex dimerization can enhance substrate recognition capabilities and/or diversify target range (Tang et al., 2007; Welcker et al., 2013), and facilitating FBX dimerization is a role of some 14-3-3 proteins (Barbash et al., 2011). Considering FBX protein homo- and hetero-dimerization (Kominami et al., 1998), having four Arabidopsis FBS family members raises the possibility that combinatorial dimerization could expand target range as the number of verified SCF
        <sup>FBS</sup>
         targets continues to grow. The differential localization observed here raises the possibility that 14-3-3-mediated, compartment-specific FBS dimerization could contribute to distinct functions among FBS family members. Future work could therefore assess the effects of 14-3-3 proteins on SCF
        <sup>FBS</sup>
         target selection and ubiquitylation activity in both in vitro and in vivo systems.
      </p>
      <p>
        Determining whether 14-3-3 proteins regulate FBS localization or enable SCF
        <sup>FBS</sup>
         substrate recognition may lead to a deeper mechanistic understanding of how plant stress responses are controlled. Several 14-3-3 proteins that interact with FBS proteins regulate abiotic stress signaling (Catala et al., 2014; Tan et al., 2016; van Kleeff et al., 2014). Likewise, both FBS1 and the rice homolog FBX257 are functionally connected to plant abiotic stress responses, either through transcriptional effects or mutant phenotypes (Geem et al., 2022; Gonzalez et al., 2017; Maldonado-Calderon et al., 2012; Sharma et al., 2023). Future work investigating how FBS and 14-3-3 proteins function together should therefore include conditions that specifically address environmental stress. Collectively, this work expands understanding of FBS/14-3-3 family-wide interactions and suggests future studies examining their mechanistic roles in environmental stress signaling.
      </p>
    </sec>
    <sec>
      <title>Methods</title>
      <p>
        <bold>Plasmid construction</bold>
      </p>
      <p>
        Standard molecular biology cloning protocols were used to generate Gateway-compatible constructs (Thermo Fisher Scientific). 
        <italic>FBS</italic>
         and 
        <italic>14-3-3</italic>
         coding sequences were amplified from cDNA by PCR with gene-specific primers (Table 1) using Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific). Amplicons were cloned into the pENTR entry vector with the pENTR/D-TOPO directional cloning kit (Thermo Fisher Scientific). Genes were then transferred into either pCL112 (creates N-terminal fusion to nYFP) or pCL113 (creates N-terminal fusion to cYFP) with LR Clonase II enzyme mix (Thermo Fisher Scientific). Sequences were verified by Sanger sequencing (Eurofins Genomics).
      </p>
      <p>
        <bold>
          Agroinfiltration of 
          <italic>Nicotiana benthamiana</italic>
           leaves
        </bold>
      </p>
      <p>
        <italic>Agrobacterium tumefaciens</italic>
         strain GV3101 pMP90 was transformed by electroporation and selected by appropriate antibiotics. Seed cultures were grown in liquid LB for 2 days with shaking at 28 
        <sup>o</sup>
        C. Full cultures were inoculated with seed culture at a 1:100 dilution and grown for 24 hours under the same conditions. Cells were pelleted and resuspended in infiltration medium (10 mM MES, 10 mM MgCl
        <sub>2</sub>
        , 100 μM acetosyringone) and incubated for 5 hours with rocking at room temperature. Cells were pelleted a second time and resuspended in infiltration medium. Appropriate nYFP/cYFP pairs, H2B-RFP, and p19 suppressor strains were mixed at a final OD
        <sub>600</sub>
         of 1.0 for each strain. The abaxial side of 
        <italic>Nicotiana benthamiana</italic>
         leaves from 4-week-old plants grown under greenhouse conditions was infiltrated by syringe with the 
        <italic>A. tumefaciens</italic>
         mixes using standard protocols (Leuzinger et al., 2013).  
      </p>
      <p>
        <bold>
          <italic/>
        </bold>
      </p>
      <p>
        <bold>Imaging</bold>
      </p>
      <p>
        Three days after infiltration, 
        <italic>N. benthamiana</italic>
         leaves to be imaged were infiltrated with 50 μM propidium iodide in 0.1% Tween-20 and allowed to sit for 10 minutes. Approximately 1 cm
        <sup>2</sup>
         from infiltrated leaves was then cut and mounted on a glass slide with 0.1% Tween-20. The underside of whole leaf mounts was visualized by laser-scanning confocal microscopy using a Nikon D-Eclipse C1 Confocal laser scanning microscope (Nikon Instruments) with either: 1) excitation at 488 nm with an emission band-pass filter of 515/30, or 2) excitation at 561 nm with an emission band pass filter of 650 LP. Images were processed with Fiji software (http://imagej.net/software/fiji/). Representative images from at least three independent experimental replicates are shown.
      </p>
      <p>
        <bold>Data analysis</bold>
      </p>
      <p>Nuclei containing a BiFC fluorescence signal were counted under a 20x objective lens in two separate areas of each leaf, which were then averaged, from three independent experimental trials. The field of view (FOV) diameter was 1100 µm. Statistical analyses were performed in RStudio version 4.0.4 using a one-way ANOVA and Tukey’s HSD post-hoc test.</p>
    </sec>
    <sec>
      <title>Reagents</title>
      <table-wrap>
        <table>
          <tbody>
            <tr>
              <td>
              </td>
              <td>
              </td>
              <td colspan="2">
                <p>
                  <bold>Primer sequences 5' to 3'</bold>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>
                  <bold>Gene</bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>AGI number</bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>Forward</bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>Reverse</bold>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>
                  <italic>FBS1</italic>
                </p>
              </td>
              <td>
                <p>At1g61340</p>
              </td>
              <td>
                <p>CACCATGGCATTGGGGAAGAAAAGAATCG</p>
              </td>
              <td>
                <p>TCAGTGGAATAGAGCCACTGAGAC</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>
                  <italic>FBS2</italic>
                </p>
              </td>
              <td>
                <p>At4g21510</p>
              </td>
              <td>
                <p>CACCATGATCCATTATCTCCATTTCA</p>
              </td>
              <td>
                <p>TCATGTAAACAAAGCCGCAG</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>
                  <italic>FBS3</italic>
                </p>
              </td>
              <td>
                <p>At4g05010</p>
              </td>
              <td>
                <p>CACCATGGCGTATTTGAGTGATG</p>
              </td>
              <td>
                <p>TCATTTAAACAATACCATAGAGATCTTCGACAAATC</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>
                  <italic>FBS4</italic>
                </p>
              </td>
              <td>
                <p>At4g35930</p>
              </td>
              <td>
                <p>CACCATGGGGAAGGTATCTCCAAAG</p>
              </td>
              <td>
                <p>TCAGGTGAGGTTGTTTTGAGC</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>
                  <italic>PP2-A12</italic>
                </p>
              </td>
              <td>
                <p>At1g12710</p>
              </td>
              <td>
                <p>CACCATGGGTGTGGCTCACTCTGAT</p>
              </td>
              <td>
                <p>TTAAAACCGCTTCAACTGGTC</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>
                  <italic>14-3-3 omega</italic>
                </p>
              </td>
              <td>
                <p>At1g78300</p>
              </td>
              <td>
                <p>CACCATGGCGTCTGGGCGTGAAG</p>
              </td>
              <td>
                <p>TCACTGCTGTTCCTCGGTCG</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>
                  <italic>14-3-3 psi</italic>
                </p>
              </td>
              <td>
                <p>At5g38480</p>
              </td>
              <td>
                <p>CACCATGTCGACAAGGGAAGAGAATGT</p>
              </td>
              <td>
                <p>TTACTCGGCACCATCGGG</p>
              </td>
            </tr>
          </tbody>
        </table>
      </table-wrap>
    </sec>
  </body>
  <back>
    <sec sec-type="data-availability">
      <title>Extended Data</title>
      <p>
        Description: Arabidopsis FBS proteins co-expressed with SPA1 in bimolecular fluorescence complementation (BiFC) assays. Resource Type: Image. DOI: 
        <ext-link ext-link-type="doi" xlink:href="10.22002/mpexm-85m05">https://doi.org/10.22002/mpexm-85m05</ext-link>
      </p>
    </sec>
    <ack>
      <sec>
        <p>
          We thank Michal Morrison-Kerr for storeroom support, David Somers for providing H2B-RFP, and Xing Wang Deng for providing pCL112 and pCL113 vectors, as well as the 
          <italic>SPA1</italic>
           constructs.
        </p>
      </sec>
    </ack>
    <ref-list>
      <ref id="R1">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Barbash</surname>
              <given-names>O</given-names>
            </name>
            <name>
              <surname>Lee</surname>
              <given-names>E K</given-names>
            </name>
            <name>
              <surname>Diehl</surname>
              <given-names>J A</given-names>
            </name>
          </person-group>
          <year>2011</year>
          <month>1</month>
          <day>17</day>
          <article-title>Phosphorylation-dependent regulation of SCFFbx4 dimerization and activity involves a novel component, 14-3-3ɛ</article-title>
          <source>Oncogene</source>
          <volume>30</volume>
          <issue>17</issue>
          <issn>0950-9232</issn>
          <fpage>1995</fpage>
          <lpage>2002</lpage>
          <pub-id pub-id-type="doi">10.1038/onc.2010.584</pub-id>
        </element-citation>
      </ref>
      <ref id="R2">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Camoni</surname>
              <given-names>Lorenzo</given-names>
            </name>
            <name>
              <surname>Visconti</surname>
              <given-names>Sabina</given-names>
            </name>
            <name>
              <surname>Aducci</surname>
              <given-names>Patrizia</given-names>
            </name>
            <name>
              <surname>Marra</surname>
              <given-names>Mauro</given-names>
            </name>
          </person-group>
          <year>2018</year>
          <month>3</month>
          <day>13</day>
          <article-title>14-3-3 Proteins in Plant Hormone Signaling: Doing Several Things at Once</article-title>
          <source>Frontiers in Plant Science</source>
          <volume>9</volume>
          <issn>1664-462X</issn>
          <pub-id pub-id-type="doi">10.3389/fpls.2018.00297</pub-id>
        </element-citation>
      </ref>
      <ref id="R3">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Catalá</surname>
              <given-names>Rafael</given-names>
            </name>
            <name>
              <surname>López-Cobollo</surname>
              <given-names>Rosa</given-names>
            </name>
            <name>
              <surname>Mar Castellano</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Angosto</surname>
              <given-names>Trinidad</given-names>
            </name>
            <name>
              <surname>Alonso</surname>
              <given-names>José M.</given-names>
            </name>
            <name>
              <surname>Ecker</surname>
              <given-names>Joseph R.</given-names>
            </name>
            <name>
              <surname>Salinas</surname>
              <given-names>Julio</given-names>
            </name>
          </person-group>
          <year>2014</year>
          <month>8</month>
          <day>1</day>
          <article-title>
            The
            <italic>Arabidopsis</italic>
            14-3-3 Protein RARE COLD INDUCIBLE 1A Links Low-Temperature Response and Ethylene Biosynthesis to Regulate Freezing Tolerance and Cold Acclimation &amp;nbsp;
          </article-title>
          <source>The Plant Cell</source>
          <volume>26</volume>
          <issue>8</issue>
          <issn>1532-298X</issn>
          <fpage>3326</fpage>
          <lpage>3342</lpage>
          <pub-id pub-id-type="doi">10.1105/tpc.114.127605</pub-id>
        </element-citation>
      </ref>
      <ref id="R4">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Gagne</surname>
              <given-names>Jennifer M.</given-names>
            </name>
            <name>
              <surname>Downes</surname>
              <given-names>Brian P.</given-names>
            </name>
            <name>
              <surname>Shiu</surname>
              <given-names>Shin-Han</given-names>
            </name>
            <name>
              <surname>Durski</surname>
              <given-names>Adam M.</given-names>
            </name>
            <name>
              <surname>Vierstra</surname>
              <given-names>Richard D.</given-names>
            </name>
          </person-group>
          <year>2002</year>
          <month>8</month>
          <day>8</day>
          <article-title>
            The F-box subunit of the SCF E3 complex is encoded by a diverse superfamily of genes in
                    
            <italic>Arabidopsis</italic>
          </article-title>
          <source>Proceedings of the National Academy of Sciences</source>
          <volume>99</volume>
          <issue>17</issue>
          <issn>0027-8424</issn>
          <fpage>11519</fpage>
          <lpage>11524</lpage>
          <pub-id pub-id-type="doi">10.1073/pnas.162339999</pub-id>
        </element-citation>
      </ref>
      <ref id="R5">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Gampala</surname>
              <given-names>Srinivas S.</given-names>
            </name>
            <name>
              <surname>Kim</surname>
              <given-names>Tae-Wuk</given-names>
            </name>
            <name>
              <surname>He</surname>
              <given-names>Jun-Xian</given-names>
            </name>
            <name>
              <surname>Tang</surname>
              <given-names>Wenqiang</given-names>
            </name>
            <name>
              <surname>Deng</surname>
              <given-names>Zhiping</given-names>
            </name>
            <name>
              <surname>Bai</surname>
              <given-names>Mingyi-Yi</given-names>
            </name>
            <name>
              <surname>Guan</surname>
              <given-names>Shenheng</given-names>
            </name>
            <name>
              <surname>Lalonde</surname>
              <given-names>Sylvie</given-names>
            </name>
            <name>
              <surname>Sun</surname>
              <given-names>Ying</given-names>
            </name>
            <name>
              <surname>Gendron</surname>
              <given-names>Joshua M.</given-names>
            </name>
            <name>
              <surname>Chen</surname>
              <given-names>Huanjing</given-names>
            </name>
            <name>
              <surname>Shibagaki</surname>
              <given-names>Nakako</given-names>
            </name>
            <name>
              <surname>Ferl</surname>
              <given-names>Robert J.</given-names>
            </name>
            <name>
              <surname>Ehrhardt</surname>
              <given-names>David</given-names>
            </name>
            <name>
              <surname>Chong</surname>
              <given-names>Kang</given-names>
            </name>
            <name>
              <surname>Burlingame</surname>
              <given-names>Alma L.</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>Zhi-Yong</given-names>
            </name>
          </person-group>
          <year>2007</year>
          <month>8</month>
          <day>1</day>
          <article-title>An Essential Role for 14-3-3 Proteins in Brassinosteroid Signal Transduction in Arabidopsis</article-title>
          <source>Developmental Cell</source>
          <volume>13</volume>
          <issue>2</issue>
          <issn>1534-5807</issn>
          <fpage>177</fpage>
          <lpage>189</lpage>
          <pub-id pub-id-type="doi">10.1016/j.devcel.2007.06.009</pub-id>
        </element-citation>
      </ref>
      <ref id="R6">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Geem</surname>
              <given-names>Kyoung Rok</given-names>
            </name>
            <name>
              <surname>Kim</surname>
              <given-names>Hyemin</given-names>
            </name>
            <name>
              <surname>Ryu</surname>
              <given-names>Hojin</given-names>
            </name>
          </person-group>
          <year>2022</year>
          <month>10</month>
          <day>1</day>
          <article-title>SCFFBS1 Regulates Root Quiescent Center Cell Division via Protein Degradation of APC/CCCS52A2</article-title>
          <source>Molecules and Cells</source>
          <volume>45</volume>
          <issue>10</issue>
          <issn>1016-8478</issn>
          <fpage>695</fpage>
          <lpage>701</lpage>
          <pub-id pub-id-type="doi">10.14348/molcells.2022.0074</pub-id>
        </element-citation>
      </ref>
      <ref id="R7">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Gonzalez</surname>
              <given-names>Lauren E.</given-names>
            </name>
            <name>
              <surname>Keller</surname>
              <given-names>Kristen</given-names>
            </name>
            <name>
              <surname>Chan</surname>
              <given-names>Karen X.</given-names>
            </name>
            <name>
              <surname>Gessel</surname>
              <given-names>Megan M.</given-names>
            </name>
            <name>
              <surname>Thines</surname>
              <given-names>Bryan C.</given-names>
            </name>
          </person-group>
          <year>2017</year>
          <month>7</month>
          <day>17</day>
          <article-title>Transcriptome analysis uncovers Arabidopsis F-BOX STRESS INDUCED 1 as a regulator of jasmonic acid and abscisic acid stress gene expression</article-title>
          <source>BMC Genomics</source>
          <volume>18</volume>
          <issue>1</issue>
          <issn>1471-2164</issn>
          <pub-id pub-id-type="doi">10.1186/s12864-017-3864-6</pub-id>
        </element-citation>
      </ref>
      <ref id="R8">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Hong</surname>
              <given-names>Jong-Pil</given-names>
            </name>
            <name>
              <surname>Adams</surname>
              <given-names>Eri</given-names>
            </name>
            <name>
              <surname>Yanagawa</surname>
              <given-names>Yuki</given-names>
            </name>
            <name>
              <surname>Matsui</surname>
              <given-names>Minami</given-names>
            </name>
            <name>
              <surname>Shin</surname>
              <given-names>Ryoung</given-names>
            </name>
          </person-group>
          <year>2017</year>
          <month>3</month>
          <day>1</day>
          <article-title>AtSKIP18 and AtSKIP31, F-box subunits of the SCF E3 ubiquitin ligase complex, mediate the degradation of 14-3-3 proteins in Arabidopsis</article-title>
          <source>Biochemical and Biophysical Research Communications</source>
          <volume>485</volume>
          <issue>1</issue>
          <issn>0006-291X</issn>
          <fpage>174</fpage>
          <lpage>180</lpage>
          <pub-id pub-id-type="doi">10.1016/j.bbrc.2017.02.046</pub-id>
        </element-citation>
      </ref>
      <ref id="R9">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Huang</surname>
              <given-names>Xu</given-names>
            </name>
            <name>
              <surname>Zhang</surname>
              <given-names>Qian</given-names>
            </name>
            <name>
              <surname>Jiang</surname>
              <given-names>Yupei</given-names>
            </name>
            <name>
              <surname>Yang</surname>
              <given-names>Chuanwei</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>Qianyue</given-names>
            </name>
            <name>
              <surname>Li</surname>
              <given-names>Lin</given-names>
            </name>
          </person-group>
          <year>2018</year>
          <month>6</month>
          <day>21</day>
          <article-title>Shade-induced nuclear localization of PIF7 is regulated by phosphorylation and 14-3-3 proteins in Arabidopsis</article-title>
          <source>eLife</source>
          <volume>7</volume>
          <issn>2050-084X</issn>
          <pub-id pub-id-type="doi">10.7554/elife.31636</pub-id>
        </element-citation>
      </ref>
      <ref id="R10">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kominami</surname>
              <given-names>Kin‐ichiro</given-names>
            </name>
            <name>
              <surname>Ochotorena</surname>
              <given-names>Itziar</given-names>
            </name>
            <name>
              <surname>Toda</surname>
              <given-names>Takashi</given-names>
            </name>
          </person-group>
          <year>1998</year>
          <month>11</month>
          <day>1</day>
          <article-title>Two F‐box/WD‐repeat proteins Pop1 and Pop2 form hetero‐ and homo‐complexes together with cullin‐1 in the fission yeast SCF (Skp1‐Cullin‐1‐F‐box) ubiquitin ligase</article-title>
          <source>Genes to Cells</source>
          <volume>3</volume>
          <issue>11</issue>
          <issn>1356-9597</issn>
          <fpage>721</fpage>
          <lpage>735</lpage>
          <pub-id pub-id-type="doi">10.1046/j.1365-2443.1998.00225.x</pub-id>
        </element-citation>
      </ref>
      <ref id="R11">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kudla</surname>
              <given-names>Jörg</given-names>
            </name>
            <name>
              <surname>Bock</surname>
              <given-names>Ralph</given-names>
            </name>
          </person-group>
          <year>2016</year>
          <month>4</month>
          <day>20</day>
          <article-title>Lighting the Way to Protein-Protein Interactions: Recommendations on Best Practices for Bimolecular Fluorescence Complementation Analyses</article-title>
          <source>The Plant Cell</source>
          <volume>28</volume>
          <issue>5</issue>
          <issn>1040-4651</issn>
          <fpage>1002</fpage>
          <lpage>1008</lpage>
          <pub-id pub-id-type="doi">10.1105/tpc.16.00043</pub-id>
        </element-citation>
      </ref>
      <ref id="R12">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Lee</surname>
              <given-names>Chin-Mei</given-names>
            </name>
            <name>
              <surname>Feke</surname>
              <given-names>Ann</given-names>
            </name>
            <name>
              <surname>Li</surname>
              <given-names>Man-Wah</given-names>
            </name>
            <name>
              <surname>Adamchek</surname>
              <given-names>Christopher</given-names>
            </name>
            <name>
              <surname>Webb</surname>
              <given-names>Kristofor</given-names>
            </name>
            <name>
              <surname>Pruneda-Paz</surname>
              <given-names>José</given-names>
            </name>
            <name>
              <surname>Bennett</surname>
              <given-names>Eric J.</given-names>
            </name>
            <name>
              <surname>Kay</surname>
              <given-names>Steve A.</given-names>
            </name>
            <name>
              <surname>Gendron</surname>
              <given-names>Joshua M.</given-names>
            </name>
          </person-group>
          <year>2018</year>
          <month>5</month>
          <day>23</day>
          <article-title>Decoys Untangle Complicated Redundancy and Reveal Targets of Circadian Clock F-Box Proteins</article-title>
          <source>Plant Physiology</source>
          <volume>177</volume>
          <issue>3</issue>
          <issn>0032-0889</issn>
          <fpage>1170</fpage>
          <lpage>1186</lpage>
          <pub-id pub-id-type="doi">10.1104/pp.18.00331</pub-id>
        </element-citation>
      </ref>
      <ref id="R13">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Leuzinger</surname>
              <given-names>Kahlin</given-names>
            </name>
            <name>
              <surname>Dent</surname>
              <given-names>Matthew</given-names>
            </name>
            <name>
              <surname>Hurtado</surname>
              <given-names>Jonathan</given-names>
            </name>
            <name>
              <surname>Stahnke</surname>
              <given-names>Jake</given-names>
            </name>
            <name>
              <surname>Lai</surname>
              <given-names>Huafang</given-names>
            </name>
            <name>
              <surname>Zhou</surname>
              <given-names>Xiaohong</given-names>
            </name>
            <name>
              <surname>Chen</surname>
              <given-names>Qiang</given-names>
            </name>
          </person-group>
          <year>2013</year>
          <month>7</month>
          <day>23</day>
          <article-title>Efficient Agroinfiltration of Plants for High-level Transient Expression of Recombinant Proteins</article-title>
          <source>Journal of Visualized Experiments</source>
          <issue>77</issue>
          <issn>1940-087X</issn>
          <pub-id pub-id-type="doi">10.3791/50521</pub-id>
        </element-citation>
      </ref>
      <ref id="R14">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Li</surname>
              <given-names>Yi</given-names>
            </name>
            <name>
              <surname>Xue</surname>
              <given-names>Shan</given-names>
            </name>
            <name>
              <surname>He</surname>
              <given-names>Qixiumei</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>Junxue</given-names>
            </name>
            <name>
              <surname>Zhu</surname>
              <given-names>Lingling</given-names>
            </name>
            <name>
              <surname>Zou</surname>
              <given-names>Junjie</given-names>
            </name>
            <name>
              <surname>Zhang</surname>
              <given-names>Jie</given-names>
            </name>
            <name>
              <surname>Zuo</surname>
              <given-names>Chaoran</given-names>
            </name>
            <name>
              <surname>Fan</surname>
              <given-names>Zhibin</given-names>
            </name>
            <name>
              <surname>Yue</surname>
              <given-names>Junling</given-names>
            </name>
            <name>
              <surname>Zhang</surname>
              <given-names>Chunxia</given-names>
            </name>
            <name>
              <surname>Yang</surname>
              <given-names>Kezhen</given-names>
            </name>
            <name>
              <surname>Le</surname>
              <given-names>Jie</given-names>
            </name>
          </person-group>
          <year>2022</year>
          <month>1</month>
          <day>1</day>
          <article-title>
            <italic>Arabidopsis F‐BOX STRESS INDUCED 4</italic>
             is required to repress excessive divisions in stomatal development
          </article-title>
          <source>Journal of Integrative Plant Biology</source>
          <volume>64</volume>
          <issue>1</issue>
          <issn>1672-9072</issn>
          <fpage>56</fpage>
          <lpage>72</lpage>
          <pub-id pub-id-type="doi">10.1111/jipb.13193</pub-id>
        </element-citation>
      </ref>
      <ref id="R15">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Madeira</surname>
              <given-names>Fábio</given-names>
            </name>
            <name>
              <surname>Tinti</surname>
              <given-names>Michele</given-names>
            </name>
            <name>
              <surname>Murugesan</surname>
              <given-names>Gavuthami</given-names>
            </name>
            <name>
              <surname>Berrett</surname>
              <given-names>Emily</given-names>
            </name>
            <name>
              <surname>Stafford</surname>
              <given-names>Margaret</given-names>
            </name>
            <name>
              <surname>Toth</surname>
              <given-names>Rachel</given-names>
            </name>
            <name>
              <surname>Cole</surname>
              <given-names>Christian</given-names>
            </name>
            <name>
              <surname>MacKintosh</surname>
              <given-names>Carol</given-names>
            </name>
            <name>
              <surname>Barton</surname>
              <given-names>Geoffrey J.</given-names>
            </name>
          </person-group>
          <year>2015</year>
          <month>3</month>
          <day>3</day>
          <article-title>14-3-3-Pred: improved methods to predict 14-3-3-binding phosphopeptides</article-title>
          <source>Bioinformatics</source>
          <volume>31</volume>
          <issue>14</issue>
          <issn>1367-4811</issn>
          <fpage>2276</fpage>
          <lpage>2283</lpage>
          <pub-id pub-id-type="doi">10.1093/bioinformatics/btv133</pub-id>
        </element-citation>
      </ref>
      <ref id="R16">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Maldonado-Calderón</surname>
              <given-names>María Teresa</given-names>
            </name>
            <name>
              <surname>Sepúlveda-García</surname>
              <given-names>Edgar</given-names>
            </name>
            <name>
              <surname>Rocha-Sosa</surname>
              <given-names>Mario</given-names>
            </name>
          </person-group>
          <year>2012</year>
          <month>4</month>
          <day>1</day>
          <article-title>Characterization of novel F-box proteins in plants induced by biotic and abiotic stress</article-title>
          <source>Plant Science</source>
          <volume>185-186</volume>
          <issn>0168-9452</issn>
          <fpage>208</fpage>
          <lpage>217</lpage>
          <pub-id pub-id-type="doi">10.1016/j.plantsci.2011.10.013</pub-id>
        </element-citation>
      </ref>
      <ref id="R17">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Sepulveda-Garcia</surname>
              <given-names>Edgar</given-names>
            </name>
            <name>
              <surname>Fulton</surname>
              <given-names>Elena C.</given-names>
            </name>
            <name>
              <surname>Parlan</surname>
              <given-names>Emily V.</given-names>
            </name>
            <name>
              <surname>O’Connor</surname>
              <given-names>Lily E.</given-names>
            </name>
            <name>
              <surname>Fleming</surname>
              <given-names>Anneke A.</given-names>
            </name>
            <name>
              <surname>Replogle</surname>
              <given-names>Amy J.</given-names>
            </name>
            <name>
              <surname>Rocha-Sosa</surname>
              <given-names>Mario</given-names>
            </name>
            <name>
              <surname>Gendron</surname>
              <given-names>Joshua M.</given-names>
            </name>
            <name>
              <surname>Thines</surname>
              <given-names>Bryan</given-names>
            </name>
          </person-group>
          <year>2021</year>
          <month>10</month>
          <day>19</day>
          <article-title>Unique N-Terminal Interactions Connect F-BOX STRESS INDUCED (FBS) Proteins to a WD40 Repeat-like Protein Pathway in Arabidopsis</article-title>
          <source>Plants</source>
          <volume>10</volume>
          <issue>10</issue>
          <issn>2223-7747</issn>
          <fpage>2228</fpage>
          <lpage>2228</lpage>
          <pub-id pub-id-type="doi">10.3390/plants10102228</pub-id>
        </element-citation>
      </ref>
      <ref id="R18">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Sepúlveda-García</surname>
              <given-names>Edgar</given-names>
            </name>
            <name>
              <surname>Rocha-Sosa</surname>
              <given-names>Mario</given-names>
            </name>
          </person-group>
          <year>2012</year>
          <month>10</month>
          <day>1</day>
          <article-title>The Arabidopsis F-box protein AtFBS1 interacts with 14-3-3 proteins</article-title>
          <source>Plant Science</source>
          <volume>195</volume>
          <issn>0168-9452</issn>
          <fpage>36</fpage>
          <lpage>47</lpage>
          <pub-id pub-id-type="doi">10.1016/j.plantsci.2012.06.009</pub-id>
        </element-citation>
      </ref>
      <ref id="R19">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Sharma</surname>
              <given-names>Eshan</given-names>
            </name>
            <name>
              <surname>Bhatnagar</surname>
              <given-names>Akanksha</given-names>
            </name>
            <name>
              <surname>Bhaskar</surname>
              <given-names>Avantika</given-names>
            </name>
            <name>
              <surname>Majee</surname>
              <given-names>Susmita M.</given-names>
            </name>
            <name>
              <surname>Kieffer</surname>
              <given-names>Martin</given-names>
            </name>
            <name>
              <surname>Kepinski</surname>
              <given-names>Stefan</given-names>
            </name>
            <name>
              <surname>Khurana</surname>
              <given-names>Paramjit</given-names>
            </name>
            <name>
              <surname>Khurana</surname>
              <given-names>Jitendra P.</given-names>
            </name>
          </person-group>
          <year>2022</year>
          <month>12</month>
          <day>12</day>
          <article-title>
            Stress‐induced F‐Box protein‐coding gene
                    
            <italic>OsFBX257</italic>
            
                    modulates drought stress adaptations and ABA responses in rice
          </article-title>
          <source>Plant, Cell &amp; Environment</source>
          <volume>46</volume>
          <issue>4</issue>
          <issn>0140-7791</issn>
          <fpage>1207</fpage>
          <lpage>1231</lpage>
          <pub-id pub-id-type="doi">10.1111/pce.14496</pub-id>
        </element-citation>
      </ref>
      <ref id="R20">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Sheard</surname>
              <given-names>Laura B.</given-names>
            </name>
            <name>
              <surname>Tan</surname>
              <given-names>Xu</given-names>
            </name>
            <name>
              <surname>Mao</surname>
              <given-names>Haibin</given-names>
            </name>
            <name>
              <surname>Withers</surname>
              <given-names>John</given-names>
            </name>
            <name>
              <surname>Ben-Nissan</surname>
              <given-names>Gili</given-names>
            </name>
            <name>
              <surname>Hinds</surname>
              <given-names>Thomas R.</given-names>
            </name>
            <name>
              <surname>Kobayashi</surname>
              <given-names>Yuichi</given-names>
            </name>
            <name>
              <surname>Hsu</surname>
              <given-names>Fong-Fu</given-names>
            </name>
            <name>
              <surname>Sharon</surname>
              <given-names>Michal</given-names>
            </name>
            <name>
              <surname>Browse</surname>
              <given-names>John</given-names>
            </name>
            <name>
              <surname>He</surname>
              <given-names>Sheng Yang</given-names>
            </name>
            <name>
              <surname>Rizo</surname>
              <given-names>Josep</given-names>
            </name>
            <name>
              <surname>Howe</surname>
              <given-names>Gregg A.</given-names>
            </name>
            <name>
              <surname>Zheng</surname>
              <given-names>Ning</given-names>
            </name>
          </person-group>
          <year>2010</year>
          <month>10</month>
          <day>6</day>
          <article-title>Jasmonate perception by inositol-phosphate-potentiated COI1–JAZ co-receptor</article-title>
          <source>Nature</source>
          <volume>468</volume>
          <issue>7322</issue>
          <issn>0028-0836</issn>
          <fpage>400</fpage>
          <lpage>405</lpage>
          <pub-id pub-id-type="doi">10.1038/nature09430</pub-id>
        </element-citation>
      </ref>
      <ref id="R21">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Tan</surname>
              <given-names>Tinghong</given-names>
            </name>
            <name>
              <surname>Cai</surname>
              <given-names>Jingqing</given-names>
            </name>
            <name>
              <surname>Zhan</surname>
              <given-names>Erbao</given-names>
            </name>
            <name>
              <surname>Yang</surname>
              <given-names>Yongqing</given-names>
            </name>
            <name>
              <surname>Zhao</surname>
              <given-names>Jinfeng</given-names>
            </name>
            <name>
              <surname>Guo</surname>
              <given-names>Yan</given-names>
            </name>
            <name>
              <surname>Zhou</surname>
              <given-names>Huapeng</given-names>
            </name>
          </person-group>
          <year>2016</year>
          <month>8</month>
          <day>8</day>
          <article-title>Stability and localization of 14-3-3 proteins are involved in salt tolerance in Arabidopsis</article-title>
          <source>Plant Molecular Biology</source>
          <volume>92</volume>
          <issue>3</issue>
          <issn>0167-4412</issn>
          <fpage>391</fpage>
          <lpage>400</lpage>
          <pub-id pub-id-type="doi">10.1007/s11103-016-0520-5</pub-id>
        </element-citation>
      </ref>
      <ref id="R22">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Tang</surname>
              <given-names>Xiaojing</given-names>
            </name>
            <name>
              <surname>Orlicky</surname>
              <given-names>Stephen</given-names>
            </name>
            <name>
              <surname>Lin</surname>
              <given-names>Zhenyuan</given-names>
            </name>
            <name>
              <surname>Willems</surname>
              <given-names>Andrew</given-names>
            </name>
            <name>
              <surname>Neculai</surname>
              <given-names>Dante</given-names>
            </name>
            <name>
              <surname>Ceccarelli</surname>
              <given-names>Derek</given-names>
            </name>
            <name>
              <surname>Mercurio</surname>
              <given-names>Frank</given-names>
            </name>
            <name>
              <surname>Shilton</surname>
              <given-names>Brian H.</given-names>
            </name>
            <name>
              <surname>Sicheri</surname>
              <given-names>Frank</given-names>
            </name>
            <name>
              <surname>Tyers</surname>
              <given-names>Mike</given-names>
            </name>
          </person-group>
          <year>2007</year>
          <month>6</month>
          <day>1</day>
          <article-title>Suprafacial Orientation of the SCFCdc4 Dimer Accommodates Multiple Geometries for Substrate Ubiquitination</article-title>
          <source>Cell</source>
          <volume>129</volume>
          <issue>6</issue>
          <issn>0092-8674</issn>
          <fpage>1165</fpage>
          <lpage>1176</lpage>
          <pub-id pub-id-type="doi">10.1016/j.cell.2007.04.042</pub-id>
        </element-citation>
      </ref>
      <ref id="R23">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Toroser</surname>
              <given-names>D</given-names>
            </name>
            <name>
              <surname>Athwal</surname>
              <given-names>GS</given-names>
            </name>
            <name>
              <surname>Huber</surname>
              <given-names>SC</given-names>
            </name>
            <collab>New Collective Author</collab>
          </person-group>
          <year>1998</year>
          <month>9</month>
          <day>11</day>
          <article-title>Site-specific regulatory interaction between spinach leaf sucrose-phosphate synthase and 14-3-3 proteins.</article-title>
          <source>FEBS Lett</source>
          <volume>435</volume>
          <issue>1</issue>
          <issn>0014-5793</issn>
          <fpage>110</fpage>
          <lpage>114</lpage>
          <pub-id pub-id-type="doi">10.1016/s0014-5793(98)01048-5</pub-id>
          <pub-id pub-id-type="pmid">9755869</pub-id>
        </element-citation>
      </ref>
      <ref id="R24">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>van Kleeff</surname>
              <given-names>PJ</given-names>
            </name>
            <name>
              <surname>Jaspert</surname>
              <given-names>N</given-names>
            </name>
            <name>
              <surname>Li</surname>
              <given-names>KW</given-names>
            </name>
            <name>
              <surname>Rauch</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Oecking</surname>
              <given-names>C</given-names>
            </name>
            <name>
              <surname>de Boer</surname>
              <given-names>AH</given-names>
            </name>
          </person-group>
          <year>2014</year>
          <month>9</month>
          <day>4</day>
          <article-title>Higher order Arabidopsis 14-3-3 mutants show 14-3-3 involvement in primary root growth both under control and abiotic stress conditions.</article-title>
          <source>J Exp Bot</source>
          <volume>65</volume>
          <issue>20</issue>
          <issn>0022-0957</issn>
          <fpage>5877</fpage>
          <lpage>5888</lpage>
          <pub-id pub-id-type="doi">10.1093/jxb/eru338</pub-id>
          <pub-id pub-id-type="pmid">25189593</pub-id>
        </element-citation>
      </ref>
      <ref id="R25">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Varshney</surname>
              <given-names>V</given-names>
            </name>
            <name>
              <surname>Potuschak</surname>
              <given-names>T</given-names>
            </name>
            <name>
              <surname>Yan</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Noir</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Genschik</surname>
              <given-names>P</given-names>
            </name>
          </person-group>
          <year>2026</year>
          <month>2</month>
          <day>12</day>
          <article-title>Hundreds of plant F-box proteins in search of function.</article-title>
          <source>J Exp Bot</source>
          <issn>0022-0957</issn>
          <pub-id pub-id-type="doi">10.1093/jxb/erag074</pub-id>
          <pub-id pub-id-type="pmid">41678363</pub-id>
        </element-citation>
      </ref>
      <ref id="R26">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Welcker</surname>
              <given-names>Markus</given-names>
            </name>
            <name>
              <surname>Larimore</surname>
              <given-names>Elizabeth A.</given-names>
            </name>
            <name>
              <surname>Swanger</surname>
              <given-names>Jherek</given-names>
            </name>
            <name>
              <surname>Bengoechea-Alonso</surname>
              <given-names>Maria T.</given-names>
            </name>
            <name>
              <surname>Grim</surname>
              <given-names>Jonathan E.</given-names>
            </name>
            <name>
              <surname>Ericsson</surname>
              <given-names>Johan</given-names>
            </name>
            <name>
              <surname>Zheng</surname>
              <given-names>Ning</given-names>
            </name>
            <name>
              <surname>Clurman</surname>
              <given-names>Bruce E.</given-names>
            </name>
          </person-group>
          <year>2013</year>
          <month>12</month>
          <day>1</day>
          <article-title>Fbw7 dimerization determines the specificity and robustness of substrate degradation</article-title>
          <source>Genes &amp; Development</source>
          <volume>27</volume>
          <issue>23</issue>
          <issn>0890-9369</issn>
          <fpage>2531</fpage>
          <lpage>2536</lpage>
          <pub-id pub-id-type="doi">10.1101/gad.229195.113</pub-id>
        </element-citation>
      </ref>
      <ref id="R27">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Wilson</surname>
              <given-names>Rashaun S.</given-names>
            </name>
            <name>
              <surname>Swatek</surname>
              <given-names>Kirby N.</given-names>
            </name>
            <name>
              <surname>Thelen</surname>
              <given-names>Jay J.</given-names>
            </name>
          </person-group>
          <year>2016</year>
          <month>5</month>
          <day>9</day>
          <article-title>Regulation of the Regulators: Post-Translational Modifications, Subcellular, and Spatiotemporal Distribution of Plant 14-3-3 Proteins</article-title>
          <source>Frontiers in Plant Science</source>
          <volume>7</volume>
          <issn>1664-462X</issn>
          <pub-id pub-id-type="doi">10.3389/fpls.2016.00611</pub-id>
        </element-citation>
      </ref>
      <ref id="R28">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Zhang</surname>
              <given-names>Chunxia</given-names>
            </name>
            <name>
              <surname>Yue</surname>
              <given-names>Junling</given-names>
            </name>
            <name>
              <surname>Li</surname>
              <given-names>Shi</given-names>
            </name>
            <name>
              <surname>Zuo</surname>
              <given-names>Chaoran</given-names>
            </name>
            <name>
              <surname>Li</surname>
              <given-names>Yi</given-names>
            </name>
            <name>
              <surname>He</surname>
              <given-names>Qixiumei</given-names>
            </name>
            <name>
              <surname>Le</surname>
              <given-names>Jie</given-names>
            </name>
          </person-group>
          <year>2025</year>
          <month>3</month>
          <day>20</day>
          <article-title>The Arabidopsis F-box protein FBS associated with the helix-loop-helix transcription factor FAMA involved in stomatal immunity</article-title>
          <source>Plant Molecular Biology</source>
          <volume>115</volume>
          <issue>2</issue>
          <issn>0167-4412</issn>
          <pub-id pub-id-type="doi">10.1007/s11103-025-01577-7</pub-id>
        </element-citation>
      </ref>
      <ref id="R29">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Zhu</surname>
              <given-names>Danmeng</given-names>
            </name>
            <name>
              <surname>Maier</surname>
              <given-names>Alexander</given-names>
            </name>
            <name>
              <surname>Lee</surname>
              <given-names>Jae-Hoon</given-names>
            </name>
            <name>
              <surname>Laubinger</surname>
              <given-names>Sascha</given-names>
            </name>
            <name>
              <surname>Saijo</surname>
              <given-names>Yusuke</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>Haiyang</given-names>
            </name>
            <name>
              <surname>Qu</surname>
              <given-names>Li-Jia</given-names>
            </name>
            <name>
              <surname>Hoecker</surname>
              <given-names>Ute</given-names>
            </name>
            <name>
              <surname>Deng</surname>
              <given-names>Xing Wang</given-names>
            </name>
          </person-group>
          <year>2008</year>
          <month>9</month>
          <day>1</day>
          <article-title>
            Biochemical Characterization of
            <italic>Arabidopsis</italic>
            Complexes Containing CONSTITUTIVELY PHOTOMORPHOGENIC1 and SUPPRESSOR OF PHYA Proteins in Light Control of Plant Development
          </article-title>
          <source>The Plant Cell</source>
          <volume>20</volume>
          <issue>9</issue>
          <issn>1532-298X</issn>
          <fpage>2307</fpage>
          <lpage>2323</lpage>
          <pub-id pub-id-type="doi">10.1105/tpc.107.056580</pub-id>
        </element-citation>
      </ref>
    </ref-list>
  </back>
</article>
