<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/archiving/1.2/JATS-archivearticle1.dtd">
<article article-type="brief-report" xmlns:xlink="http://www.w3.org/1999/xlink">
  <front>
    <journal-meta>
      <journal-title-group>
        <journal-title>microPublication Biology</journal-title>
      </journal-title-group>
      <issn pub-type="epub">2578-9430</issn>
      <publisher>
        <publisher-name>Caltech Library</publisher-name>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="doi">10.17912/micropub.biology.002181</article-id>
      <article-categories>
        <subj-group subj-group-type="heading">
          <subject>new finding</subject>
        </subj-group>
        <subj-group subj-group-type="subject">
          <subject>ecology and evolution</subject>
        </subj-group>
        <subj-group subj-group-type="species">
          <subject>other</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>
          <italic>Phytophthora agathidicida</italic>
           was undetected in a pilot survey of soils outside the host's (
          <italic>Agathis australis</italic>
          ) natural range
        </article-title>
      </title-group>
      <contrib-group>
        <contrib contrib-type="author">
          <name>
            <surname>Hadlow</surname>
            <given-names>Isabella CR</given-names>
          </name>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation">Investigation</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing - original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft">Writing - original draft</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing - review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing-review-editing">Writing - review &amp; editing</role>
          <xref ref-type="aff" rid="aff1">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Palmer</surname>
            <given-names>Jade TT</given-names>
          </name>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Conceptualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/onceptualization">Conceptualization</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation">Investigation</role>
          <xref ref-type="aff" rid="aff1">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Gerth</surname>
            <given-names>Monica L</given-names>
          </name>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Conceptualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/onceptualization">Conceptualization</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Funding acquisition" vocab-term-identifier="https://credit.niso.org/contributor-roles/funding-acquisition">Funding acquisition</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Project administration" vocab-term-identifier="https://credit.niso.org/contributor-roles/project-administration">Project administration</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Resources" vocab-term-identifier="https://credit.niso.org/contributor-roles/resources">Resources</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Supervision" vocab-term-identifier="https://credit.niso.org/contributor-roles/supervision">Supervision</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing - review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing-review-editing">Writing - review &amp; editing</role>
          <xref ref-type="aff" rid="aff1">1</xref>
          <xref ref-type="corresp" rid="cor1">§</xref>
        </contrib>
        <aff id="aff1">
          <label>1</label>
          School of Biological Sciences, Victoria University of Wellington, New Zealand
        </aff>
      </contrib-group>
      <contrib-group>
        <contrib contrib-type="reviewer">
          <anonymous/>
        </contrib>
      </contrib-group>
      <author-notes>
        <corresp id="cor1">
          <label>§</label>
          Correspondence to: Monica L Gerth (
          <email>monica.gerth@vuw.ac.nz</email>
          )
        </corresp>
        <fn fn-type="coi-statement">
          <p>The authors declare that there are no conflicts of interest present.</p>
        </fn>
      </author-notes>
      <pub-date date-type="pub" publication-format="electronic">
        <day>2</day>
        <month>7</month>
        <year>2026</year>
      </pub-date>
      <pub-date date-type="collection" publication-format="electronic">
        <year>2026</year>
      </pub-date>
      <volume>2026</volume>
      <elocation-id>10.17912/micropub.biology.002181</elocation-id>
      <history>
        <date date-type="received">
          <day>3</day>
          <month>5</month>
          <year>2026</year>
        </date>
        <date date-type="rev-recd">
          <day>10</day>
          <month>6</month>
          <year>2026</year>
        </date>
        <date date-type="accepted">
          <day>26</day>
          <month>6</month>
          <year>2026</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>Copyright: © 2026 by the authors</copyright-statement>
        <copyright-year>2026</copyright-year>
        <license license-type="open-access" xlink:href="https://creativecommons.org/licenses/by/4.0/">
          <license-p>This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.</license-p>
        </license>
      </permissions>
      <abstract>
        <p>
          Surveillance of 
          <italic>Phytophthora agathidicida</italic>
          , the causal agent of kauri dieback, has largely been restricted to kauri (
          <italic>Agathis australis</italic>
          ) forests. To assess the pathogen’s wider environmental distribution in New Zealand, we applied a highly sensitive, species-specific endpoint PCR assay to soil from non-forested locations south of the host’s natural geographic range. 
          <italic>P. agathidicida</italic>
           was not detected in any samples. Successful positive, negative, extraction, and inhibition controls supported these results. These pilot findings demonstrate the absence of detectable 
          <italic>P. agathidicida</italic>
           at the tested sites, providing additional data regarding the pathogen’s geographic range in New Zealand.
        </p>
      </abstract>
      <funding-group>
        <funding-statement>We gratefully acknowledge support for this research from a Small Faculty Research Grant provided by Victoria University of Wellington and funding  from Tiakina Kauri, part of Biosecurity New Zealand, Ministry for Primary Industries. Jade Palmer acknowledges PhD scholarship support from Victoria University of Wellington, Tiakina Kauri, the New Zealand Plant Protection Society, and Te Roroa Iwi. </funding-statement>
      </funding-group>
    </article-meta>
  </front>
  <body>
    <fig position="anchor" id="f1">
      <label>
        Figure 1. Geographic distribution of sampling sites and PCR-based screening for 
        <italic>P. agathidicida</italic>
      </label>
      <caption>
        <p>
          <bold>(A)</bold>
          <bold>Map showing the 13 soil collection sites</bold>
          . All sites were located south of latitude 38° S (grey dashed line), representing the southern limit of the natural 
          <italic>Agathis australis</italic>
           (kauri) range. 
          <bold>
            (B) PCR screening for 
            <italic>Phytophthora agathidicida</italic>
          </bold>
          . No amplification of the 
          <italic>P. agathidicida</italic>
           PA-LTR region (Palmer et al., 2025) was detected in any environmental sample. The positive control (PA+; 3 pg 
          <italic>P. agathidicida</italic>
           genomic DNA) produced the expected ~161 bp product. 
          <bold>(C)</bold>
          <bold>Inhibition controls.</bold>
           Parallel PA-LTR reactions were spiked with 1 pg 
          <italic>P. agathidicida</italic>
           genomic DNA for each sample. All reactions produced the ~161 bp product, indicating no significant PCR inhibition. 
          <bold>(D)</bold>
          <bold>Extraction controls.</bold>
           Successful extraction of DNA from all soil samples was confirmed using 18S rDNA primers (18S #3 and #5RC; Machida et al., 2012), with reactions yielding the expected ~350 bp product. All panels included a positive control (PA+) and a no-template control (NTC). PCR products were resolved on 2% TAE agarose gels stained with GelGreen (panels B and D) or GelRed (panel C). 100 bp, 100 bp DNA Ladder (New England Biolabs); LMW, Low Molecular Weight DNA Ladder (New England Biolabs). Map data © MapTiler and © OpenStreetMap contributors.
        </p>
      </caption>
    </fig>
    <graphic xlink:href="25789430-2026-micropub.biology.002181"/>
    <sec>
      <title>Description</title>
      <p>
        Numerous 
        <italic>Phytophthora</italic>
         species are established in Aotearoa New Zealand, affecting forestry, agriculture and native ecosystems (Burgess et al., 2017; Cheah et al., 2008; Dick et al., 2014; Scott &amp; Williams, 2014). Of major concern is 
        <italic>Phytophthora agathidicida, </italic>
        which causes dieback disease in New Zealand’s northern kauri (
        <italic>Agathis australis</italic>
        ) forests (Bradshaw et al., 2020; Mainwaring et al., 2023). Management of kauri dieback relies on an accurate understanding of the current distribution of 
        <italic>P.</italic>
        <italic> agathidicida</italic>
         in soils, both within kauri forests and in surrounding landscapes.
      </p>
      <p>
        To date, surveillance for 
        <italic>P. agathidicida</italic>
         has been largely restricted to kauri forests and has primarily relied on soil baiting assays (Froud et al., 2021; Froud et al., 2025; Tiakina Kauri, 2023). However, soil baiting is resource-intensive (McDougal et al., 2014; Singh et al., 2017), which has limited the scale of monitoring efforts and precluded broader landscape-scale testing. Consequently, it remains unknown whether 
        <italic>P. agathidicida</italic>
         persists in environments outside of kauri forests. While it is frequently presumed to be an introduced organism currently expanding its range, an alternative hypothesis suggests it may be a native species that is naturally widespread (Bradshaw et al., 2020; Hood, 2021). Determining its presence or absence in non-kauri landscapes is therefore critical for testing these biogeographical assumptions. The recent development of a species-specific, high-sensitivity PCR-based assay, capable of detecting as little as 1 fg of 
        <italic>P. agathidicida</italic>
         DNA (Palmer et al., 2025), now makes larger-scale surveillance feasible. This diagnostic tool enables the investigation of the pathogen's broader distribution, facilitating testing in previously unexamined regions. Such data are vital for disease management, dispersal tracking, and long-term conservation planning.
      </p>
      <p>
        In this pilot study, we investigated the presence of 
        <italic>P. agathidicida</italic>
         in soils outside the natural latitudinal range of kauri (Steward &amp; Beveridge, 2010). A panel of soil samples from 13 non-forested locations (
        <xref ref-type="fig" rid="f1">Figure 1A</xref>
        ) was processed using the double-filtration technique and screened for 
        <italic>P. agathidicida</italic>
         via endpoint PCR (Palmer et al., 2025). None of the 13 samples tested positive for 
        <italic>P. agathidicida</italic>
         (
        <xref ref-type="fig" rid="f1">Figure 1B</xref>
        ). The success of internal controls—including spiked 
        <italic>P. agathidicida</italic>
         DNA to check for PCR inhibition (
        <xref ref-type="fig" rid="f1">Figure 1C</xref>
        ) and 18S rDNA amplification to confirm DNA extraction efficiency (
        <xref ref-type="fig" rid="f1">Figure 1D</xref>
        )—verified the reliability of these negative results.
      </p>
      <p>
        Beyond the immediate results, the absence of amplification across these geographically diverse samples also provides practical evidence regarding the assay’s performance in complex soil matrices. Given that concerns regarding false-positive results are a primary barrier to the adoption of molecular tools for 
        <italic>P. agathidicida</italic>
        , this study provides further evidence that the assay does not cross-react with common soil taxa in the environments sampled. This reinforces its potential as a tool for kauri dieback surveillance.
      </p>
      <p>
        While we acknowledge the limited scope of this pilot study, the absence of detectable 
        <italic>P. agathidicida</italic>
         DNA suggests that the pathogen was not present at the sampled sites. However, it is possible that low-abundance or spatially heterogeneous populations may fall below the assay’s detection limit of 1 fg and thus remain undetected. Furthermore, our sample size was small and restricted to human-modified, non-forested sites, with only a single sample collected per location. Future research should expand the ecological diversity of sampled sites, including indigenous forests where kauri are absent, to confirm the pathogen’s absence across a broader range of environmental conditions. Additionally, studies should incorporate multiple replicates per site to account for the potential spatial heterogeneity of 
        <italic>P. agathidicida</italic>
         in soil. Nevertheless, these initial results provide a preliminary indication that 
        <italic>P. agathidicida</italic>
         is not widely distributed beyond the natural range of its primary host.
      </p>
    </sec>
    <sec>
      <title>Methods</title>
      <p>In this pilot study, soil samples were collected from private properties between June 2024 and July 2025. Participants were instructed to select a site that had not been disturbed by digging or soil amendment within the preceding six months, then remove loose debris and plant material from that site. Using a clean, inverted plastic bag, participants collected a large handful of soil from the top 5 cm of soil. Samples included fine roots when present. One sample per site was collected. The final sample set comprised soils from established yards, pastures, and plantings in both rural and suburban areas. These samples were sealed, double-bagged and transported at room temperature. Once received, the samples were mixed thoroughly by shaking and breaking up any soil aggregations without opening the sample bags. The homogenised samples were then aliquoted into 50 mL centrifuge tubes and stored at 4 °C until processing.</p>
      <p>DNA was extracted from the samples using the double-filter bag method described by Palmer and Gerth (2025). Briefly, 5–10 g of soil was heat-sealed into a 90 μm nylon mesh pouch (120 x 60 mm), which was nested inside a 25 μm nylon mesh pouch (150 x 80 mm). Pouches were placed in 50 mL sterile water and subjected to wash cycles with vortexing at 2700 rpm to liberate oospores. Material &gt;90 μm was discarded; the oospore-soil slurry captured by the 25 μm mesh was pelleted at 3000g for 2 min. The pellets were then resuspended in 800 μL Solution CD1 and transferred to Precellys 2 mL Soil Grinding Beads Kit (SK38) tubes. Following 10 min of homogenization using a Vortex-Genie 2 with a 24-tube adapter (Qiagen), DNA was extracted using the DNeasy PowerSoil Pro Kit (Qiagen) per the manufacturer's instructions. Eluted DNA was further purified via the DNeasy PowerClean Pro Cleanup Kit (Qiagen) to remove residual PCR inhibitors, and final elution was performed in 100 μL low-EDTA TE buffer (10 mM Tris-HCl, 0.1 mM EDTA) rather than the manufacturer’s supplied buffer to ensure greater DNA stability during storage.</p>
      <p>
        Endpoint PCRs were performed in 40 μL reactions comprising 1× HOT FIREPol Blend Master Mix (Solis BioDyne), 0.5 µM of each primer, 25 µL PCR-grade water, and 5 µL of template DNA. PCR-grade water served as a negative control. Purified 
        <italic>Phytophthora agathidicida</italic>
         genomic DNA (isolate NZFS 3770, 3 pg) served as a positive control. For the PA-LTR primer pair, the following PCR thermal cycling conditions were used: 95 °C for 12 min, followed by 40 cycles of 95 °C for 15 s, 63 °C for 40 s, and 72 °C for 7 s, and a final extension of 72 °C for 5 min. To monitor for PCR inhibition, parallel reactions were spiked with 1 µL of 
        <italic>P. agathidicida</italic>
         genomic DNA at 1 pg/µL.
      </p>
      <p>Extraction success was verified using eukaryotic 18S primers that have been used previously for broad-range taxonomic coverage in soil environmental DNA studies, including the detection of oomycetes (Drummond et al., 2015; Lear et al., 2018; Machida &amp; Knowlton, 2012). For the 18S primer pair, the following PCR thermal cycling conditions were used: 95 °C for 12 min, followed by 30 cycles of 95 °C for 15 s, 63 °C for 30 s, and 72 °C for 60 s, and a final extension of 72 °C for 5 min.</p>
      <p>For all replicates, controls performed as expected: negative controls produced no product; positive and inhibition controls produced the expected ~161 bp product; and extraction controls produced the expected ~350 bp product. The PCR products were visualised by electrophoresis on 2% agarose gels pre-stained with either GelRed or GelGreen (Biotium), run at 85 V for 35 minutes.</p>
    </sec>
    <sec>
      <title>Reagents</title>
      <table-wrap>
        <table>
          <tbody>
            <tr>
              <td colspan="3">
                <p>
                  <bold>Primers</bold>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>
                  <bold>Name</bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>Sequence (5′ - 3′)</bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>Reference</bold>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>18S #3</p>
              </td>
              <td>
                <p>GYGGTGCATGGCCGTTSKTRGTT</p>
              </td>
              <td>
                <p>Machida &amp; Knowlton, 2012</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>18S #5RC</p>
              </td>
              <td>
                <p>GTGTGYACAAAGGBCAGGGAC</p>
              </td>
              <td>
                <p>Machida &amp; Knowlton, 2012</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>PA-LTR-for</p>
              </td>
              <td>
                <p>ACGCGCTCTGTTTCTTTAGC</p>
              </td>
              <td>
                <p>Palmer et al., 2025</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>PA-LTR-rev</p>
              </td>
              <td>
                <p>GCGGGCTTCCATTCAATTCA</p>
              </td>
              <td>
                <p>Palmer et al., 2025</p>
              </td>
            </tr>
          </tbody>
        </table>
      </table-wrap>
      <table-wrap>
        <table>
          <tbody>
            <tr>
              <td colspan="2">
                <p>
                  <bold>Kits and Reagents</bold>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>
                  <bold>Name (Supplier)</bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>Catalogue Number</bold>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>DNeasy PowerSoil Pro Kit (Qiagen)</p>
              </td>
              <td>
                <p>47016</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>Soil grinding SK38 2 mL tubes (Bertin)</p>
              </td>
              <td>
                <p>P000915-LYSK0-A</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>DNeasy PowerClean Pro Cleanup Kit (Qiagen)</p>
              </td>
              <td>
                <p>12997-50</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>Qubit dsDNA High Sensitivity Assay Kit (Invitrogen)</p>
              </td>
              <td>
                <p>Q32854</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>
                  5× HOT FIREPol Blend Master Mix Ready to Load, 10 mM MgCl
                  <sub>2</sub>
                   (Solis Biodyne)
                </p>
              </td>
              <td>
                <p>04-25-00120-5</p>
              </td>
            </tr>
          </tbody>
        </table>
      </table-wrap>
    </sec>
  </body>
  <back>
    <ack>
      <sec>
        <p>We wish to thank the private landowners for providing the samples used in this study, and Jim Hadlow for support in connecting with landowners and obtaining samples. We also thank Dan Moskovitz for assistance in generating the map in Figure 1A.</p>
      </sec>
    </ack>
    <ref-list>
      <ref id="R1">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Bradshaw</surname>
              <given-names>R. E.</given-names>
            </name>
            <name>
              <surname>Bellgard</surname>
              <given-names>S. E.</given-names>
            </name>
            <name>
              <surname>Black</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Burns</surname>
              <given-names>B. R.</given-names>
            </name>
            <name>
              <surname>Gerth</surname>
              <given-names>M. L.</given-names>
            </name>
            <name>
              <surname>McDougal</surname>
              <given-names>R. L.</given-names>
            </name>
            <name>
              <surname>Scott</surname>
              <given-names>P. M.</given-names>
            </name>
            <name>
              <surname>Waipara</surname>
              <given-names>N. W.</given-names>
            </name>
            <name>
              <surname>Weir</surname>
              <given-names>B. S.</given-names>
            </name>
            <name>
              <surname>Williams</surname>
              <given-names>N. M.</given-names>
            </name>
            <name>
              <surname>Winkworth</surname>
              <given-names>R. C.</given-names>
            </name>
            <name>
              <surname>Ashcroft</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Bradley</surname>
              <given-names>E. L.</given-names>
            </name>
            <name>
              <surname>Dijkwel</surname>
              <given-names>P. P.</given-names>
            </name>
            <name>
              <surname>Guo</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Lacey</surname>
              <given-names>R. F.</given-names>
            </name>
            <name>
              <surname>Mesarich</surname>
              <given-names>C. H.</given-names>
            </name>
            <name>
              <surname>Panda</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Horner</surname>
              <given-names>I. J.</given-names>
            </name>
          </person-group>
          <year>2019</year>
          <month>11</month>
          <day>6</day>
          <article-title>
            <italic>Phytophthora agathidicida</italic>
            
                    : research progress, cultural perspectives and knowledge gaps in the control and management of kauri dieback in New Zealand
          </article-title>
          <source>Plant Pathology</source>
          <volume>69</volume>
          <issue>1</issue>
          <issn>0032-0862</issn>
          <fpage>3</fpage>
          <lpage>16</lpage>
          <pub-id pub-id-type="doi">10.1111/ppa.13104</pub-id>
        </element-citation>
      </ref>
      <ref id="R2">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Burgess</surname>
              <given-names>Treena I.</given-names>
            </name>
            <name>
              <surname>Scott</surname>
              <given-names>John K.</given-names>
            </name>
            <name>
              <surname>Mcdougall</surname>
              <given-names>Keith L.</given-names>
            </name>
            <name>
              <surname>Stukely</surname>
              <given-names>Michael J. C.</given-names>
            </name>
            <name>
              <surname>Crane</surname>
              <given-names>Colin</given-names>
            </name>
            <name>
              <surname>Dunstan</surname>
              <given-names>William A.</given-names>
            </name>
            <name>
              <surname>Brigg</surname>
              <given-names>Frances</given-names>
            </name>
            <name>
              <surname>Andjic</surname>
              <given-names>Vera</given-names>
            </name>
            <name>
              <surname>White</surname>
              <given-names>Diane</given-names>
            </name>
            <name>
              <surname>Rudman</surname>
              <given-names>Tim</given-names>
            </name>
            <name>
              <surname>Arentz</surname>
              <given-names>Frans</given-names>
            </name>
            <name>
              <surname>Ota</surname>
              <given-names>Noboru</given-names>
            </name>
            <name>
              <surname>Hardy</surname>
              <given-names>Giles E. St. J.</given-names>
            </name>
          </person-group>
          <year>2016</year>
          <month>10</month>
          <day>11</day>
          <article-title>
            Current and projected global distribution of 
            <italic>Phytophthora cinnamomi</italic>
            , one of the world's worst plant pathogens
          </article-title>
          <source>Global Change Biology</source>
          <volume>23</volume>
          <issue>4</issue>
          <issn>1354-1013</issn>
          <fpage>1661</fpage>
          <lpage>1674</lpage>
          <pub-id pub-id-type="doi">10.1111/gcb.13492</pub-id>
        </element-citation>
      </ref>
      <ref id="R3">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Cheah</surname>
              <given-names>L.-H.</given-names>
            </name>
            <name>
              <surname>Marsh</surname>
              <given-names>A.T.</given-names>
            </name>
            <name>
              <surname>Hedderley</surname>
              <given-names>D.</given-names>
            </name>
            <name>
              <surname>Falloon</surname>
              <given-names>R.E.</given-names>
            </name>
          </person-group>
          <year>2008</year>
          <month>8</month>
          <day>1</day>
          <article-title>Crop rotation with brassicas reduces &lt;i&gt;Phytophthora&lt;/i&gt; populations in potato soil</article-title>
          <source>New Zealand Plant Protection</source>
          <volume>61</volume>
          <issn>1179-352X</issn>
          <fpage>256</fpage>
          <lpage>260</lpage>
          <pub-id pub-id-type="doi">10.30843/nzpp.2008.61.6803</pub-id>
        </element-citation>
      </ref>
      <ref id="R4">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Dick</surname>
              <given-names>Margaret Anne</given-names>
            </name>
            <name>
              <surname>Williams</surname>
              <given-names>Nari Michelle</given-names>
            </name>
            <name>
              <surname>Bader</surname>
              <given-names>Martin Karl-Friedrich</given-names>
            </name>
            <name>
              <surname>Gardner</surname>
              <given-names>Judy Frances</given-names>
            </name>
            <name>
              <surname>Bulman</surname>
              <given-names>Lindsay Stuart</given-names>
            </name>
          </person-group>
          <year>2014</year>
          <month>5</month>
          <day>23</day>
          <article-title>Pathogenicity of Phytophthora pluvialis to Pinus radiata and its relation with red needle cast disease in New Zealand</article-title>
          <source>New Zealand Journal of Forestry Science</source>
          <volume>44</volume>
          <issue>1</issue>
          <issn>1179-5395</issn>
          <pub-id pub-id-type="doi">10.1186/s40490-014-0006-7</pub-id>
        </element-citation>
      </ref>
      <ref id="R5">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Drummond</surname>
              <given-names>Alexei J.</given-names>
            </name>
            <name>
              <surname>Newcomb</surname>
              <given-names>Richard D.</given-names>
            </name>
            <name>
              <surname>Buckley</surname>
              <given-names>Thomas R.</given-names>
            </name>
            <name>
              <surname>Xie</surname>
              <given-names>Dong</given-names>
            </name>
            <name>
              <surname>Dopheide</surname>
              <given-names>Andrew</given-names>
            </name>
            <name>
              <surname>Potter</surname>
              <given-names>Benjamin CM</given-names>
            </name>
            <name>
              <surname>Heled</surname>
              <given-names>Joseph</given-names>
            </name>
            <name>
              <surname>Ross</surname>
              <given-names>Howard A.</given-names>
            </name>
            <name>
              <surname>Tooman</surname>
              <given-names>Leah</given-names>
            </name>
            <name>
              <surname>Grosser</surname>
              <given-names>Stefanie</given-names>
            </name>
            <name>
              <surname>Park</surname>
              <given-names>Duckchul</given-names>
            </name>
            <name>
              <surname>Demetras</surname>
              <given-names>Nicholas J.</given-names>
            </name>
            <name>
              <surname>Stevens</surname>
              <given-names>Mark I.</given-names>
            </name>
            <name>
              <surname>Russell</surname>
              <given-names>James C.</given-names>
            </name>
            <name>
              <surname>Anderson</surname>
              <given-names>Sandra H.</given-names>
            </name>
            <name>
              <surname>Carter</surname>
              <given-names>Anna</given-names>
            </name>
            <name>
              <surname>Nelson</surname>
              <given-names>Nicola</given-names>
            </name>
          </person-group>
          <year>2015</year>
          <month>10</month>
          <day>6</day>
          <article-title>Evaluating a multigene environmental DNA approach for biodiversity assessment</article-title>
          <source>Gigascience</source>
          <volume>4</volume>
          <issue>1</issue>
          <issn>2047-217X</issn>
          <pub-id pub-id-type="doi">10.1186/s13742-015-0086-1</pub-id>
        </element-citation>
      </ref>
      <ref id="R6">
        <mixed-citation>Froud, K, Chew, YC, Kean, J, Meiforth, J, Killick, S, Ashby, E, Taua-Gordon, R, Jamieson, A, Tolich, L. 2021. 2021 Waitākere Ranges kauri population health monitoring survey. Auckland Council Technical Report, 2022/8.</mixed-citation>
      </ref>
      <ref id="R7">
        <mixed-citation>Froud, K, Chew, YC, Kean, J, Meiforth, J, Geddes, H, Jamieson, A, Manukau, E, Te Moni, M, Maxwell-Butler, Z, Andersen, G, Tolich, L, Tuhimata, E, Penrosse, I, Teasdale, S, Le Grice, J, Bennett, M, Killick, S. 2025. Te Ngāherehere o Kohukohunui / Hūnua Ranges kauri population health monitoring survey. Auckland Council Technical Report, 2025/1.</mixed-citation>
      </ref>
      <ref id="R8">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Hood</surname>
              <given-names>Ian</given-names>
            </name>
          </person-group>
          <year>2021</year>
          <month>4</month>
          <day>4</day>
          <article-title>Kauri dieback</article-title>
          <source>Plant Pathology</source>
          <volume>70</volume>
          <issue>4</issue>
          <issn>0032-0862</issn>
          <fpage>764</fpage>
          <lpage>766</lpage>
          <pub-id pub-id-type="doi">10.1111/ppa.13356</pub-id>
        </element-citation>
      </ref>
      <ref id="R9">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Lear</surname>
              <given-names>Gavin</given-names>
            </name>
            <name>
              <surname>Dickie</surname>
              <given-names>Ian</given-names>
            </name>
            <name>
              <surname>Banks</surname>
              <given-names>Jonathan</given-names>
            </name>
            <name>
              <surname>Boyer</surname>
              <given-names>Stephane</given-names>
            </name>
            <name>
              <surname>Buckley</surname>
              <given-names>Hannah</given-names>
            </name>
            <name>
              <surname>Buckley</surname>
              <given-names>Thomas</given-names>
            </name>
            <name>
              <surname>Cruickshank</surname>
              <given-names>Rob</given-names>
            </name>
            <name>
              <surname>Dopheide</surname>
              <given-names>Andrew</given-names>
            </name>
            <name>
              <surname>Handley</surname>
              <given-names>Kim</given-names>
            </name>
            <name>
              <surname>Hermans</surname>
              <given-names>Syrie</given-names>
            </name>
            <name>
              <surname>Kamke</surname>
              <given-names>Janine</given-names>
            </name>
            <name>
              <surname>Lee</surname>
              <given-names>Charles</given-names>
            </name>
            <name>
              <surname>MacDiarmid</surname>
              <given-names>Robin</given-names>
            </name>
            <name>
              <surname>Morales</surname>
              <given-names>Sergio</given-names>
            </name>
            <name>
              <surname>Orlovich</surname>
              <given-names>David</given-names>
            </name>
            <name>
              <surname>Smissen</surname>
              <given-names>Rob</given-names>
            </name>
            <name>
              <surname>Wood</surname>
              <given-names>Jamie</given-names>
            </name>
            <name>
              <surname>Holdaway</surname>
              <given-names>Robert</given-names>
            </name>
          </person-group>
          <year>2018</year>
          <article-title>Methods for the extraction, storage, amplification and sequencing of DNA from environmental samples</article-title>
          <source>New Zealand Journal of Ecology</source>
          <pub-id pub-id-type="doi">10.20417/nzjecol.42.9</pub-id>
        </element-citation>
      </ref>
      <ref id="R10">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Machida</surname>
              <given-names>Ryuji J.</given-names>
            </name>
            <name>
              <surname>Knowlton</surname>
              <given-names>Nancy</given-names>
            </name>
          </person-group>
          <year>2012</year>
          <month>9</month>
          <day>25</day>
          <article-title>PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences</article-title>
          <source>PLoS ONE</source>
          <volume>7</volume>
          <issue>9</issue>
          <issn>1932-6203</issn>
          <fpage>e46180</fpage>
          <lpage>e46180</lpage>
          <pub-id pub-id-type="doi">10.1371/journal.pone.0046180</pub-id>
        </element-citation>
      </ref>
      <ref id="R11">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Mainwaring</surname>
              <given-names>Josie C.</given-names>
            </name>
            <name>
              <surname>Vink</surname>
              <given-names>Jochem N.A.</given-names>
            </name>
            <name>
              <surname>Gerth</surname>
              <given-names>Monica L.</given-names>
            </name>
          </person-group>
          <year>2023</year>
          <month>6</month>
          <day>1</day>
          <article-title>Plant-pathogen management in a native forest ecosystem</article-title>
          <source>Current Biology</source>
          <volume>33</volume>
          <issue>11</issue>
          <issn>0960-9822</issn>
          <fpage>R500</fpage>
          <lpage>R505</lpage>
          <pub-id pub-id-type="doi">10.1016/j.cub.2023.02.047</pub-id>
        </element-citation>
      </ref>
      <ref id="R12">
        <mixed-citation>
          McDougal, R, Bellgard, S, Scott, P, Ganley, B. 2014. Comparison of a real-time PCR assay and a soil bioassay technique for detection of 
          <italic>Phytophthora</italic>
           taxon 
          <italic>Agathis</italic>
           from soil. Scion. Report prepared for the Kauri Dieback Joint Agency Response. https://www.kauriprotection.co.nz/assets/Research-reports/Surveillance-Detection-Diagnostics-and-Pathways/Comparison-of-a-real-time-PCR-assay-soil-bioassay-PA.pdf
        </mixed-citation>
      </ref>
      <ref id="R13">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Palmer</surname>
              <given-names>Jade T.T.</given-names>
            </name>
            <name>
              <surname>Vink</surname>
              <given-names>Jochem N.A.</given-names>
            </name>
            <name>
              <surname>Castro</surname>
              <given-names>Leticia M.</given-names>
            </name>
            <name>
              <surname>Craig</surname>
              <given-names>Oliver J.S.</given-names>
            </name>
            <name>
              <surname>Davison</surname>
              <given-names>Emily E.</given-names>
            </name>
            <name>
              <surname>Gerth</surname>
              <given-names>Monica L.</given-names>
            </name>
          </person-group>
          <year>2025</year>
          <month>5</month>
          <day>6</day>
          <article-title>
            Improved isolation and PCR detection of
            
            <italic>Phytophthora agathidicida</italic>
            
            oospores from soils
          </article-title>
          <source>Microbiology Spectrum</source>
          <volume>13</volume>
          <issue>5</issue>
          <issn>2165-0497</issn>
          <pub-id pub-id-type="doi">10.1128/spectrum.00135-25</pub-id>
        </element-citation>
      </ref>
      <ref id="R14">
        <mixed-citation>
          Scott, P, Williams, N. 2014. 
          <italic>Phytophthora</italic>
           diseases in New Zealand forests. New Zealand Journal of Forestry, 59(2), 14–21.
        </mixed-citation>
      </ref>
      <ref id="R15">
        <mixed-citation>
          Singh, J, Curran-Cournane, F, Waipara, N, Schwendenmann, L, Lear, G. 2017. Comparison of methods used to detect the organism responsible for kauri dieback, 
          <italic>Phytophthora agathidicida</italic>
          , from soil samples. Auckland Council Technical Report, TR2017/019.
        </mixed-citation>
      </ref>
      <ref id="R16">
        <mixed-citation>
          Steward, GA, Beveridge, AE. 2010. A review of New Zealand kauri (
          <italic>Agathis australis </italic>
          (D.Don) Lindl.): its ecology, history, growth and potential for management for timber. New Zealand Journal of Forestry Science, 40, 33–59.
        </mixed-citation>
      </ref>
      <ref id="R17">
        <mixed-citation>
          Tiakina Kauri. 2023. Approved soil baiting method for
          <italic> Phytophthora agathidicida</italic>
          . https://www.kauriprotection.co.nz/assets/content-blocks/downloads/MPI-Approved-Test-Soil-bioassay-baiting-protocol-FINAL-June-2023.pdf
        </mixed-citation>
      </ref>
    </ref-list>
  </back>
</article>