Pre-mRNA splicing requires the activity of the spliceosome, a large and dynamic complex comprised of dozens of protein components (Wilkinson et al., 2020). In S. pombe , almost half of the ~5134 protein coding genes contain one or more introns in their pre-mRNAs that require spliceosome-mediated excision (Carme et al., 2026; Rutherford et al., 2024; Wood et al., 2012). This complexity which also includes the use of degenerate splice site sequences, exonic splicing enhancers, and SR proteins, makes S. pombe an attractive organism for the elucidation of pre-mRNA processing mechanisms (Fair and Pleiss, 2017).

Dim1 is an essential, highly conserved component of the U4/U6.U5 tri-snRNP (Berry and Gould, 1997; Gottschalk et al., 1999; Reuter et al., 1999; Stevens and Abelson, 1999; Zhang et al., 2000; Zhang et al., 1999). In a genetic screen designed to identify genes cooperating with Cdk1 to promote the G2/M transition, we isolated the dim1-35 mutation because it reduced the restrictive temperature of cdc2-D217N (Berry and Gould, 1997). The dim1-35 mutant, in which amino acid 126 is changed from G to D, is defective in pre-mRNA splicing (Carnahan et al., 2005), displays significant cell cycle defects (Berry and Gould, 1997), and is synthetically lethal with a mutant in the anaphase-promoting complex, lid1-6 (Berry et al., 1999) and with loss of U6 snRNA m ⁶ A methyltransferase Mtl16 function (Willet et al., 2023). In the same screen used to isolate dim1-35 , three additional dim1 mutant alleles were obtained but not characterized. Here, we determine their mutations and examine their phenotypes and genetic interactions. We also identify the causative gene mutations in two previously unassigned pre-mRNA splicing mutants.

To determine what mutations were present in the previously uncharacterized dim1 alleles, the open reading frame was amplified from each strain and sequenced. The dim1-h8 strain contained the same amino acid change as did dim1-35 (Berry and Gould, 1997) plus a nucleotide change within the second intron that is not at an intron junction or the splicing branch point. dim1-h20 contained four mutations leading to three amino acid changes and the dim1-h58 strain contained a single mutation resulting in an E74K change ( Figure 1A ). The range of growth was determined for each strain by spotting at a variety of temperatures. The dim1-h8 and dim1-h20 mutants showed similar temperature-sensitivity to dim1-35 and failed to form colonies at 36˚C ( Figure 1B ). In contrast, dim1-h58 was not heat-sensitive ( Figure 1B ) and therefore to follow it in crosses, the kanMX6 cassette was inserted after the dim1 stop codon. DAPI and Methyl Blue staining showed that dim1-h8 resembled dim1-35 at the non-permissive temperature with a variety of chromosome segregation errors including chromatin bisected by septa (Berry and Gould, 1997) ( Figure 1C ). dim1-h20 and dim1-h58:kanR cells appeared a bit elongated at 36˚C and the chromosomes were sometimes disorganized but cut cells were not observed ( Figure 1C ). Like dim1-35 (Willet et al., 2023), all three previously uncharacterized dim1 mutants were synthetically lethal with mtl16∆ ( Figure 1D ). Also like dim1-35, dim1-h20 displayed significant negative genetic interactions with prp6-1 and prp31-E1 ( Figure 1E ). Interestingly, despite a lack of heat-sensitivity on its own, dim1-h58 also displayed a significant negative genetic interaction with prp6-1 ( Figure 1E ) and was synthetically lethal with prp31-E1 at 25˚C ( Figure 1F ). These genetic interactions prompted us to test whether dim1-h58 was cold rather than heat sensitive. Indeed, we found that it was ( Figure 1G ).

Like Dim1 , Prp31 is a component of the U4/U6.U5 tri-snRNP and both dim1-35 and prp31-E1 show significant negative genetic interactions with prp6-1 (Bishop et al., 2000; Willet et al., 2023). Interestingly, neither prp6-1 nor prp7-1, among the first S. pombe temperature-sensitive mutants defective in pre-mRNA processing identified (Potashkin et al., 1998; Potashkin et al., 1989; Urushiyama et al., 1996), have been assigned to a gene. To learn what gene mutations gave rise to these two prp mutants, we crossed each of the two strains to wildtype, grew 8 colonies of wildtype and 8 colonies of mutant obtained from crossing to our laboratory wildtype strain, combined the 8 samples of each at equal cell concentrations, and the genomes of the two samples were sequenced and analyzed. A comparison of the mutant sequences to that of wildtype indicated that the prp6-1 strain carries an E71K substitution in the snu13 open reading frame (G211A) ( Figure 1H ). Snu13 is required for both pre-mRNA splicing and pre-rRNA splicing in Saccharomyces cerevisiae and is a tri-snRNP component (Dobbyn et al., 2007; Dobbyn and O'Keefe, 2004) that in S. pombe co-purifies with Dim1 (Carnahan et al., 2005). Amplifying and sequencing the snu13 gene from prp6-1 cells confirmed the presence of this mutation. The psc3 gene is immediately adjacent to snu13 on chromosome I and we found that no wildtype progeny were recovered from a cross between prp6-1 and psc3-1T:kanR (Nonaka et al., 2002) in a plate of tetrads. Further, plasmid-expressed snu13 ⁺ was able to rescue prp6-1 temperature-sensitivity ( Figure 1I ). Taken together, we conclude that the Snu13 E71K substitution is responsible for the prp6-1 phenotype.

Two candidate mutations were identified in the prp7-1 strain relative to wild type: mdn1-D4125N (G12373A) and brl1-C655Y (G1964A). We focused our attention on brl1 because its homolog in S. cerevisiae , BRE1 , has been linked to pre-mRNA splicing (Moehle et al., 2012) through its role in histone H2B ubiquitination (Herissant et al., 2014; Moehle et al., 2012). In contrast, there is no evidence that Mdn1 plays a role in pre-mRNA splicing. Amplifying and sequencing the brl1 gene from prp7-1 cells confirmed the presence of the brl1-C655Y mutation. The bmt5 gene is closely linked to brl1 on chromosome III (Lock et al., 2018) and we found no recombinants between bmt5∆::kanR and prp7-1 in 10 complete tetrads. Although brl1∆ is not an essential gene, brl1∆ cells were reported to be slow growing and highly elongated with an increased septation index (Tanny et al., 2007; Zofall and Grewal, 2007). A similar elongated, hyphal-like phenotype was also noted for prp7-1 cells after shift to the non-permissive temperature (Potashkin et al., 1998). We verified that the brl1∆ strain grows slowly and also determined that it is unable to form colonies at all on YE plates at 36˚C ( Figure 1J ). Finally, plasmid-expressed brl1 ⁺ was able to rescue the temperature-sensitivity and also the slow growth at 25˚C of prp7-1 ( Figure 1K ). We conclude that the prp7-1 pre-mRNA processing phenotype is due to the mutation in brl1 .

In sum, our data provide evidence for the cooperation of Dim1 , Prp31 , and Snu13 in spliceosome activation. Further, by identifying the mutations in the prp6-1 and prp7-1 strains we firmly link both Snu13 and Brl1 to the process of pre-mRNA splicing, enhancing the toolkit of reagents with which to investigate mechanisms of this critical process in S. pombe .

Yeast methods

S. pombe strains were grown in yeast extract (YE) or Edinburgh minimal medium (EMM) supple­mented with appropriate amino acids with appropriate supplements and standard  S. pombe  mating, sporulation, and tetrad dissection techniques were used for backcrossing, outcrossing, and to construct new strains (Forsburg and Rhind, 2006; Moreno et al., 1991). EMM with 5 µg/ml thiamine was used to repress expression of murine dim1 from the nmt1 promoter.

To construct  dim1-h58:kanMX6,  PCR was utilized to amplify a sequence containing the kanamycin resistant gene in a pFA6 cassette (Bahler et al., 1998). Through lithium acetate transformation (Keeney and Boeke, 1994), this sequence was inserted after the final stop codon of the  dim1-h58  gene. Colonies were selected by replication onto YE plates containing G418 (Geneticin, 100 µg/mL, Thermo Fisher Scientific; cat# 11811031), and correct marking of the dim1 allele was confirmed through whole-cell PCR.

For growth assays, strains were grown overnight in YE at 25°C to OD ₅₉₅ =0.1-0.8. Cells were then adjusted to OD ₅₉₅ = 0.20 and then diluted tenfold thrice. 2.5 μL of each dilution were spotted onto YE plates and grown at the indicated temperatures for several days. Each growth assay was performed twice.

Molecular biology methods

A PCR product was generated from each dim1 allele using an oligonucleotide 59 bp upstream of the start site (GTATATTGTGTGACTTACATATCTACA) and 243 bp downstream of the stop codon (GCAGTAATCATGTTCATGC) (Integrated DNA technologies), purified, and sent for sequencing. To construct plasmids containing  brl1   and  snu13 ,  PCR was used to amplify sequences of  brl1   and  snu13   from wildtype genomic DNA that   included 300 bp flanks upstream and downstream of the coding sequence. These fragments were each cloned into the BamHI site of pUR18 (Barbet et al., 1992) using Gibson assembly (Gibson et al., 2009). Subsequently, the pUR18- brl1   and pUR18- snu13   plasmids were transformed into  prp7-1  and  prp6-1,  respectively, using the lithium acetate transformation method (Keeney and Boeke, 1994), and colonies were selected on EMM plates lacking uracil. PCR products, plasmids, and whole genomes were sequenced by Plasmidsaurus using Oxford Nanopore Technologies  (ONT) long-read sequencing.

ONT read mapping and variant calling

Whole-genome ONT sequencing reads were down-sampled to 30x depth coverage using seqtk v1.5-r133 (https://github.com/lh3/seqtk). Down-sampled reads were mapped to the reference genome with minimap2 v2.30-r1287 (https://github.com/lh3/minimap2) (Li, 2018). Variants were called using Clair3 v1.2.0 (https://github.com/HKU-BAL/Clair3) (Zheng et al., 2022) with the r1041_e82_400bps_sup_v500 model. Clair3-generated gVCF files were merged using GLnexus v1.4.1 (https://github.com/dnanexus-rnd/GLnexus) (Yun et al., 2021). Variants were annotated using SnpEff v4_3t (https://pcingola.github.io/SnpEff/) (Cingolani et al., 2012). Candidate mutations were defined as variants predicted to cause amino acid changes that were present in the mutant sample but absent in the wild-type sample. Detailed scripts, commands, and parameters used in this analysis are available at (https://github.com/fsnibs10/prp6_prp7). Whole-genome ONT sequencing reads have been deposited in the Sequence Read Archive (SRA) of the National Center for Biotechnology Information (NCBI) under BioProject accession PRJNA1428504 .

Microscopy methods

To visualize nuclei and septa, cells were grown overnight in YE to log phase at 25°C, shifted to 36.5°C for 3.5 hours and fixed in ice-cold 70% ethanol. Samples were then washed in phosphate-buffered saline three times and stained with 1 mg/mL Methyl Blue (Millipore Sigma) and 4',6-diamidino-2-phenylindole (DAPI). Single medial Z slices were obtained using a Zeiss Axio Observer inverted epifluorescence microscope with an AxioCam 503 mono camera and a Zeiss Plan Apochromat 63x oil (1.46 nA) objective. Representative images were formatted using ImageJ (Schindelin et al., 2012).