Cytokinesis in Schizosaccharomyces pombe requires the construction of an actin- and myosin-based cytokinetic ring (CR) that is coupled to the formation of the division septum (Cheffings et al., 2016; Glotzer, 2017; Mangione & Gould, 2019). The septation initiation network (SIN) is a signaling cascade that promotes CR formation, CR constriction and septum formation [reviewed in (Cullati & Gould, 2019; Simanis, 2015; Xiao & Dong, 2021)]. The SIN is assembled at the mitotic spindle pole body and initiated by the GTPase Spg1 (Schmidt et al., 1997; Sohrmann et al., 1998). Spg1 activates the kinase Cdc7 which in turn activates the Sid1 kinase (Fankhauser & Simanis, 1993; Schmidt et al., 1997). Downstream of Sid1 is the Sid2 kinase and its obligate binding partner, Mob1 . The Sid2- Mob1 complex is the sole SIN component that translocates from the spindle pole body to the CR curing cytokinesis (Guertin et al., 2000; M. C. Hou et al., 2000; Salimova et al., 2000; Sparks et al., 1999). At the CR Sid2- Mob1 phosphorylates and regulates key substrates such as formin Cdc12 , anillin-like Mid1 , and Cdc14 family phosphatase Clp1 , important for various cell division cycle steps (Bohnert et al., 2013; Chen et al., 2008; Sparks et al., 1999; Willet et al., 2019). SIN signaling is inhibited by the Cdc16- Byr4 two-component GAP for Spg1 (Furge et al., 1998; Minet et al., 1979).

Here, we examine a set of temperature-sensitive strains of mob1 ( mob1-N1 , mob1-M17 , mob1-J2 and mob1- R4) that were isolated from a genetic screen designed to identify suppressors of cdc7-A20 cdc16∆ cold-sensitivity (Salimova et al., 2000). The isolated alleles were within the same complementation group and rescued by expression of mob1 ⁺ from a plasmid (Salimova et al., 2000). Further, mob1-R4 was found to suppress cdc16∆ in the absence of cdc7-A20 and all mob1 alleles also rescued byr4∆ lethality (Salimova et al., 2000). An additional temperature sensitive allele, mob1-1 , was designed based on a Saccharomyces cerevisiae allele of the orthologous protein (Hou et al., 2000; Luca and Winey, 1998). Mob1 was found to bind the Sid2 kinase and be essential for its localization and activity (Hou et al., 2000; Salimova et al., 2000). These results established Mob1 as a positive regulator of SIN signaling.

To determine what mutations were present in the mob1 alleles, the open reading frame was amplified from each strain and sequenced. mob1-N1 , mob1-M17 and mob1-J2 encoded the same mutation causing the change of histidine 159 to tyrosine ( Figure 1A ). mob1-R4 encoded a substitution at residue 155 of arginine to cystine ( Figure 1A ). mob1-1 encodes the I55P and A56I mutations (Hou et al., 2000). Thus, there are now three distinct temperature-sensitive mob1 mutant alleles with known mutations.

We further characterized mob1-N1 and mob1-R4 and compared them to mob1-1 , eliminating the duplicative mob1-M17 and mob1-J2 alleles from further analysis. The range of temperature-sensitivity was determined for each strain by spotting at a variety of temperatures. mob1-1 grew less well than wildtype at 32°C and 36°C and mob1-N1 grew less well than wildtype at 36°C ( Figure 1B ). mob1-R4 grew slightly less well than wildtype at both high (32°C and 36°C) and low (25°C) temperatures ( Figure 1B ). Next, to visualize cell phenotypes, we fixed and stained cells to mark nuclei and septa after they were grown at 25°C and also, after shifting to 36˚C for 3.5 hours. All mob1 alleles looked similar to wildtype at 25°C ( Figure 1C ). At 36°C, mob1-1 cells were multinucleated with no septum present ( Figure 1C ), as has been previously reported (Hou et al., 2000). mob1-N1 and mob1-R4 displayed some binucleate cells with no septum ( Figure 1C- D), consistent with previous results for mob1-R4 (Salimova et al., 2000). A percentage of lysed cells were also detected for mob1-N1 and mob1-R4 ( Figure 1C- D). Due to the observed cytokinesis defects at high temperatures, we conclude that all mob1 alleles are likely loss-of-function alleles and mob1-1 is the most severe temperature sensitive allele.

Mob1 is part of a family of small proteins that are allosteric activators of kinases (Duhart and Raftery, 2020). We mapped the amino acids that were changed in the mob1 alleles onto the AlphaFold3 predicted protein structure (Abramson et al., 2024). We found that the mutation sites are not clustered within a specific region of the Mob1 protein and are within regions that mediate intramolecular interactions thus, mutation of these residues may result in a less stable protein ( Figure 1E ).

Mob1 family members typically bind kinase partners within the N-terminal regulatory region just upstream of the catalytic domain (Duhart and Raftery, 2020). In accord, co-immunoprecipitation experiments determined that Mob1 bound a fragment of Sid2 containing residues 101-207, which is just upstream of the kinase domain (Hou et al., 2004). To better understand the interaction, we modelled the Sid2- Mob1 interaction using AF3. It was predicted that a set of Sid2 ɑ-helices formed by residues 125-200 bound Mob1 within the regulatory region ( Figure 1F ). Further, none of the amino acids mutated in the mob1 alleles were involved in the predicted Mob1- Sid2 interaction interface.

Yeast methods

S. pombe strains were grown in yeast extract (YE) and standard S. pombe mating, sporulation, and tetrad dissection techniques were used to construct new strains (Moreno et al., 1991).

Molecular biology methods

The mob1 alleles were amplified using an oligonucleotide 20 bp upstream of the start site (GAGTTTACCTCCCATTTCCTGTTCC) and 50 bp downstream of the stop codon (GACGATGAGTGGAAGGTTGG) (Integrated DNA technologies). The PCR products were sequenced by Plasmidsaurus (Eugene, OR) using Oxford Nanopore Technology with custom analysis and annotation.

Microscopy and image analysis

Strains for fixed-cell imaging experiments were grown at 25°C in YE and then shifted to 36°C for 3.5 hours. Cells were fixed with 70% ethanol for DAPI and methylene blue (MB) staining as described previously (Roberts-Galbraith et al., 2009). Images were acquired using a Zeiss Axio Observer inverted epifluorescence microscope with Zeiss 63× oil (1.46 NA) objective and captured using Zeiss ZEN 3.0 (Blue edition) software. A singular medial Z slice was obtained. All images were further processed using ImageJ (Schindelin et al., 2012).

AlphaFold3 structural prediction

Protein structure predictions were generated with the AlphaFold3 server (Abramson et al., 2024) and visualized using the PyMOL molecular graphics system (version 3.0, Schrodinger, LLC).