<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/archiving/1.2/JATS-archivearticle1.dtd">
<article article-type="brief-report" xmlns:xlink="http://www.w3.org/1999/xlink">
  <front>
    <journal-meta>
      <journal-title-group>
        <journal-title>microPublication Biology</journal-title>
      </journal-title-group>
      <issn pub-type="epub">2578-9430</issn>
      <publisher>
        <publisher-name>Caltech Library</publisher-name>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="doi">10.17912/micropub.biology.001552</article-id>
      <article-categories>
        <subj-group subj-group-type="heading">
          <subject>new finding</subject>
        </subj-group>
        <subj-group subj-group-type="heading">
          <subject>materials and reagents</subject>
        </subj-group>
        <subj-group subj-group-type="subject">
          <subject>phenotype data</subject>
        </subj-group>
        <subj-group subj-group-type="subject">
          <subject>genotype data</subject>
        </subj-group>
        <subj-group subj-group-type="species">
          <subject>s. pombe</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>
          Characterization of temperature-sensitive alleles of anillin-like Mid1 and polo kinase Plo1 in 
          <italic>Schizosaccharomyces pombe</italic>
        </article-title>
      </title-group>
      <contrib-group>
        <contrib contrib-type="author">
          <name>
            <surname>Park</surname>
            <given-names>Joshua S.</given-names>
          </name>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing - original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft">Writing - original draft</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation">Investigation</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Formal analysis" vocab-term-identifier="https://credit.niso.org/contributor-roles/formal-analysis">Formal analysis</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Visualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/visualization">Visualization</role>
          <xref ref-type="aff" rid="aff1">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Turner</surname>
            <given-names>Lesley A.</given-names>
          </name>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing - review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing-review-editing">Writing - review &amp; editing</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation">Investigation</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Formal analysis" vocab-term-identifier="https://credit.niso.org/contributor-roles/formal-analysis">Formal analysis</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Visualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/visualization">Visualization</role>
          <xref ref-type="aff" rid="aff1">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Gould</surname>
            <given-names>Kathleen L.</given-names>
          </name>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Conceptualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/onceptualization">Conceptualization</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Project administration" vocab-term-identifier="https://credit.niso.org/contributor-roles/project-administration">Project administration</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Funding acquisition" vocab-term-identifier="https://credit.niso.org/contributor-roles/funding-acquisition">Funding acquisition</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing - review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing-review-editing">Writing - review &amp; editing</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Resources" vocab-term-identifier="https://credit.niso.org/contributor-roles/resources">Resources</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Supervision" vocab-term-identifier="https://credit.niso.org/contributor-roles/supervision">Supervision</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Validation" vocab-term-identifier="https://credit.niso.org/contributor-roles/validation">Validation</role>
          <xref ref-type="aff" rid="aff1">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Willet</surname>
            <given-names>Alaina H.</given-names>
          </name>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Project administration" vocab-term-identifier="https://credit.niso.org/contributor-roles/project-administration">Project administration</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing - original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft">Writing - original draft</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing - review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing-review-editing">Writing - review &amp; editing</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation">Data curation</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation">Investigation</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Formal analysis" vocab-term-identifier="https://credit.niso.org/contributor-roles/formal-analysis">Formal analysis</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Visualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/visualization">Visualization</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Supervision" vocab-term-identifier="https://credit.niso.org/contributor-roles/supervision">Supervision</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Validation" vocab-term-identifier="https://credit.niso.org/contributor-roles/validation">Validation</role>
          <xref ref-type="aff" rid="aff1">1</xref>
          <xref ref-type="corresp" rid="cor1">§</xref>
        </contrib>
        <aff id="aff1">
          <label>1</label>
          Cell and Developmental Biology, Vanderbilt University School of Medicine, Nashville, TN, US
        </aff>
      </contrib-group>
      <contrib-group>
        <contrib contrib-type="reviewer">
          <name>
            <surname>Chen</surname>
            <given-names>Qian </given-names>
          </name>
        </contrib>
      </contrib-group>
      <author-notes>
        <corresp id="cor1">
          <label>§</label>
          Correspondence to: Alaina H. Willet (
          <email>alaina.h.willet@vanderbilt.edu</email>
          )
        </corresp>
        <fn fn-type="coi-statement">
          <p>The authors declare that there are no conflicts of interest present.</p>
        </fn>
      </author-notes>
      <pub-date date-type="pub" publication-format="electronic">
        <day>13</day>
        <month>3</month>
        <year>2025</year>
      </pub-date>
      <pub-date date-type="collection" publication-format="electronic">
        <year>2025</year>
      </pub-date>
      <volume>2025</volume>
      <elocation-id>10.17912/micropub.biology.001552</elocation-id>
      <history>
        <date date-type="received">
          <day>20</day>
          <month>2</month>
          <year>2025</year>
        </date>
        <date date-type="rev-recd">
          <day>11</day>
          <month>3</month>
          <year>2025</year>
        </date>
        <date date-type="accepted">
          <day>11</day>
          <month>3</month>
          <year>2025</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>Copyright: © 2025 by the authors</copyright-statement>
        <copyright-year>2025</copyright-year>
        <license license-type="open-access" xlink:href="https://creativecommons.org/licenses/by/4.0/">
          <license-p>This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.</license-p>
        </license>
      </permissions>
      <abstract>
        <p>
          The 
          <italic>Schizosaccharomyces pombe</italic>
           anillin-like Mid1 is important for the correct positioning of the cell division site. A key regulator of Mid1 is the polo kinase Plo1 which is important for several mitotic and cytokinetic events including spindle formation and division site placement. Here, we defined the mutations within a set of temperature-sensitive 
          <italic>mid1</italic>
           and 
          <italic>plo1</italic>
           alleles and compared the growth and morphological defects of the strains. This work expands the repertoire of 
          <italic>mid1</italic>
           and 
          <italic>plo1</italic>
           mutants for studying cytokinesis and highlights the requirement of the Mid1 C2 domain and the Plo1 kinase domain C-terminal lobe as particularly important for cytokinesis.
        </p>
      </abstract>
      <funding-group>
        <award-group>
          <funding-source>
            <institution-wrap>
              <institution>National Institute of General Medical Sciences (United States)</institution>
              <institution-id>https://ror.org/04q48ey07</institution-id>
            </institution-wrap>
          </funding-source>
          <award-id>R35GM131799</award-id>
          <principal-award-recipient>Kathleen L. Gould</principal-award-recipient>
        </award-group>
        <funding-statement>null</funding-statement>
      </funding-group>
    </article-meta>
  </front>
  <body>
    <fig position="anchor" id="f1">
      <label>
        Figure 1. 
        <bold>
          Characterization of 
          <italic>plo1 </italic>
          and 
          <italic>mid1</italic>
           mutant alleles.
        </bold>
      </label>
      <caption>
        <p>
          (A) Schematics of Mid1 and Plo1, drawn to scale. The C2 and pleckstrin homology (PH) domains of Mid1 are indicated in yellow and purple, respectively. The protein kinase catalytic domain and polo box domain of Plo1 are indicated in blue and green, respectively. The amino acid and nucleotide substitutions in the indicated temperature-sensitive alleles are provided in the charts. (B) The indicated strains were grown in liquid YE media at 25°C until they reached mid-log phase and then adjusted to the same cell concentration measured by optical density (Moreno et al., 1991). Next, 10-fold serial dilutions were made and 2.5 µL of each was spotted on YE agar plates and incubated at the indicated temperatures for 2-3 days prior to imaging. (C) The indicated strains were grown in liquid YE media. Samples were collected after cells were grown at 25˚C and again after growing the cells for an additional 4 hours at 36˚C. The cells were then fixed and stained with DAPI and methyl blue. Scale bars, 5 µm. (D) The number of nuclei (top) or septa (bottom) per cell was quantified from the same experiment as in C. n ≥ 100 for each. (E) Ribbon diagram of a structural model of 
          <italic>S. pombe</italic>
           Plo1 kinase domain bound to an ATP molecule using AlphaFold3 (Abramson et al., 2024). The positions of the N- and C-termini of the kinase domain are labelled. A section of the model containing the kinase domain C-terminal lobe is enlarged below and the positions of the mutated residues are indicated.
        </p>
      </caption>
      <graphic xlink:href="25789430-2025-micropub.biology.001552"/>
    </fig>
    <sec>
      <title>Description</title>
      <p>
        The fission yeast 
        <italic>Schizosaccharomyces pombe</italic>
         utilizes an actin- and myosin-based cytokinetic ring (CR) to accomplish cytokinesis (Cheffings et al., 2016; Glotzer, 2017; Mangione &amp; Gould, 2019). The 
        <italic>S. pombe </italic>
        CR is built from medial cytokinetic nodes established by the anillin-like 
        <ext-link ext-link-type="pombase" xlink:href="SPCC4B3.15">Mid1</ext-link>
         protein (reviewed in Rincon &amp; Paoletti, 2012). These nodes condense into a coherent ring structure that will eventually constrict concomitant with septum ingression (reviewed in Willet et al., 2015). The precise spatial and temporal ordering of mitotic and cytokinetic events is critical for the faithful segregation of the genetic material into daughter cells. One mechanism by which mitosis and cytokinesis are coordinated is through the action of mitotic kinases that phosphorylate substrates in a cell cycle-dependent manner. One such enzyme is the 
        <italic>S. pombe</italic>
         polo kinase 
        <ext-link ext-link-type="pombase" xlink:href="SPAC23C11.16">Plo1</ext-link>
         which operates downstream of Cdk1 to promote successful mitosis and cytokinesis (Ohkura et al., 1995; Tanaka et al., 2001). One of 
        <ext-link ext-link-type="pombase" xlink:href="SPAC23C11.16">Plo1</ext-link>
        's substrates is 
        <ext-link ext-link-type="pombase" xlink:href="SPCC4B3.15">Mid1</ext-link>
         and Plo1-dependent phosphorylation of 
        <ext-link ext-link-type="pombase" xlink:href="SPCC4B3.15">Mid1</ext-link>
         promotes the nuclear export of 
        <ext-link ext-link-type="pombase" xlink:href="SPCC4B3.15">Mid1</ext-link>
         (Almonacid et al., 2011; Bähler et al., 1998; Ohkura et al., 1995). This ensures that 
        <ext-link ext-link-type="pombase" xlink:href="SPCC4B3.15">Mid1</ext-link>
         can localize to the medial cytokinetic nodes at mitotic entry to promote CR formation (Almonacid et al., 2009, 2011). Here, we examine 
        <italic>
          <ext-link ext-link-type="pombase" xlink:href="SPCC4B3.15">mid1</ext-link>
        </italic>
        and 
        <italic>
          <ext-link ext-link-type="pombase" xlink:href="SPAC23C11.16">plo1</ext-link>
        </italic>
         temperature-sensitive alleles obtained from various genetic screens, some previously uncharacterized and many lacking information as to the sites of mutations (Bähler et al., 1998; Balasubramanian et al., 1998; MacIver et al., 2003).
      </p>
      <p>
        To better understand the nature of the 
        <italic>
          <ext-link ext-link-type="pombase" xlink:href="SPCC4B3.15">mid1</ext-link>
        </italic>
        and 
        <italic>
          <ext-link ext-link-type="pombase" xlink:href="SPAC23C11.16">plo1</ext-link>
        </italic>
         alleles, the respective open reading frames were amplified from nine strains (
        <italic>mid1-18, mid1-C1,</italic>
        <italic>mid1-C2, mid1-2075, plo1-1, plo1-ts4, plo1-24c, plo1-25 </italic>
        and 
        <italic>plo1-ts35</italic>
        ) in which the relevant mutations have not been reported (Rutherford et al., 2024) and the PCR products sequenced. In each case, a single point mutation was detected (
        <xref ref-type="fig" rid="f1">Figure 1A</xref>
        ). 
        <italic>mid1-18</italic>
         encodes a serine to phenylalanine substitution at position 873 (S873F), both 
        <italic>mid1-C1</italic>
         and 
        <italic>mid1-C2</italic>
         encode a glycine to aspartic acid substitution at position 764 (G764D) and 
        <italic>mid1-2075</italic>
         encodes a glycine to aspartic acid substitution at position 584 (
        <xref ref-type="fig" rid="f1">Figure 1A</xref>
        ). All of the mutated amino acids reside in structured regions of the protein (
        <xref ref-type="fig" rid="f1">Figure 1A</xref>
        ). Another previously characterized 
        <italic>
          <ext-link ext-link-type="pombase" xlink:href="SPCC4B3.15">mid1</ext-link>
        </italic>
        allele, 
        <italic>mid1-366</italic>
        , encodes a different mutation within the C2 domain (G718D) (Chang et al., 1996; Sun et al., 2015). Thus, our results bring the total number of distinct 
        <italic>
          <ext-link ext-link-type="pombase" xlink:href="SPCC4B3.15">mid1</ext-link>
        </italic>
         temperature-sensitive alleles to four.
      </p>
      <p>
        Two 
        <italic>
          <ext-link ext-link-type="pombase" xlink:href="SPAC23C11.16">plo1</ext-link>
        </italic>
         alleles (
        <italic>plo1-1 </italic>
        and 
        <italic>plo1-ts4) </italic>
        encode the same mutation causing an arginine to glutamine change at residue 132 (R132Q). 
        <italic>plo1-24c</italic>
         encodes a mutation resulting in a change at residue 295 from phenylalanine to leucine, 
        <italic>plo1-25</italic>
         encodes an arginine to tryptophan substitution at residue 141 (R141W) and 
        <italic>plo1-ts35 </italic>
        encodes a glutamic acid to lysine change at position 139 (E139K) (
        <xref ref-type="fig" rid="f1">Figure 1A</xref>
        ). E139K is the same mutation previously identified in the 
        <italic>plo1-ts2</italic>
         allele (MacIver et al., 2003). Thus, in addition to two previously sequenced temperature-sensitive 
        <italic>
          <ext-link ext-link-type="pombase" xlink:href="SPAC23C11.16">plo1</ext-link>
        </italic>
        alleles (
        <italic>plo1-ts2 </italic>
        and
        <italic> plo1-ts19</italic>
        ), there are three additional distinct temperature-sensitive 
        <italic>
          <ext-link ext-link-type="pombase" xlink:href="SPAC23C11.16">plo1</ext-link>
        </italic>
         alleles.
      </p>
      <p>
        To examine the 
        <italic>
          <ext-link ext-link-type="pombase" xlink:href="SPCC4B3.15">mid1</ext-link>
        </italic>
        and
        <italic>
          <ext-link ext-link-type="pombase" xlink:href="SPAC23C11.16">plo1</ext-link>
        </italic>
         mutant cohorts further, we compared the temperature-sensitivity of each strain with a growth assay. 
        <italic>mid1-18, mid1-C1 and mid1-C2 </italic>
        grew similar to wildtype at all temperatures but 
        <italic>mid1-2075</italic>
         showed almost no growth at 36°C (
        <xref ref-type="fig" rid="f1">Figure 1B</xref>
        ). Two 
        <italic>
          <ext-link ext-link-type="pombase" xlink:href="SPAC23C11.16">plo1</ext-link>
        </italic>
         alleles, 
        <italic>plo1-ts2</italic>
         and 
        <italic>plo1-ts35,</italic>
         had almost no growth at 36°C and reduced growth at 32°C, and all other 
        <italic>
          <ext-link ext-link-type="pombase" xlink:href="SPAC23C11.16">plo1</ext-link>
        </italic>
         alleles were slightly impaired in growth compared to wildtype at 36°C (
        <xref ref-type="fig" rid="f1">Figure 1B</xref>
        ). These results are consistent with previously published growth assays in which some of the mutants were examined (MacIver et al., 2003; Petersen &amp; Hagan, 2005; Rachfall et al., 2014).
      </p>
      <p>
        Finally, to visualize and compare the cell phenotypes, we examined each mutant by staining for nuclei and septa after the cells were grown at 25°C and then shifted to 36°C for 4 hours. We found that all temperature sensitive alleles
        <italic/>
        looked similar to wildtype at 25°C, but at 36°C the cells were multinucleated with abnormal septa present (
        <xref ref-type="fig" rid="f1">Figure 1C-</xref>
        D). Our data are consistent with previous descriptions of the subset of previously studied alleles (Bähler et al., 1998; Balasubramanian et al., 1998; Bhutta et al., 2014; Huang et al., 2008; MacIver et al., 2003; Wachtler et al., 2006).
      </p>
      <p>
        All 
        <italic>
          <ext-link ext-link-type="pombase" xlink:href="SPCC4B3.15">mid1</ext-link>
        </italic>
         temperature-sensitive alleles displayed phenotypes similar to 
        <italic>mid1∆ </italic>
        (Chang et al., 1996; Sohrmann et al., 1996), suggesting that they are loss-of-function alleles. 
        <italic>mid1-18</italic>
         has a mutation in the PH domain while 
        <italic>mid1-C1</italic>
        , 
        <italic>mid1-C2, mid1-2075 </italic>
        and 
        <italic>mid1-366</italic>
         contain mutations in the C2 domain (
        <xref ref-type="fig" rid="f1">Figure 1A</xref>
        ). The C2 domain appears to directly bind the plasma membrane and is required for 
        <ext-link ext-link-type="pombase" xlink:href="SPCC4B3.15">Mid1</ext-link>
         function (Lee &amp; Wu, 2012; Sun et al., 2015). Cells with a mutant 
        <ext-link ext-link-type="pombase" xlink:href="SPCC4B3.15">Mid1</ext-link>
         lacking the entire PH domain have only mild cell division site positioning defects, thus the function of the PH domain is not fully clear (Lee &amp; Wu, 2012; Paoletti &amp; Chang, 2000). It has been suggested that the PH domain may be important for protein stability and/or play a role in membrane binding in collaboration with the C2 domain, like human anillin (Hall et al., 2024; Liu et al., 2012; Sun et al., 2015). Taken together, we speculate that the 
        <italic>mid1-18</italic>
         allele produces a less stable protein at high temperatures while the other alleles disrupt C2 domain function.
      </p>
      <p>
        <ext-link ext-link-type="pombase" xlink:href="SPAC23C11.16">Plo1</ext-link>
         has two essential domains, the N-terminal kinase domain and the C-terminal polo box domain (PBD) (Reynolds &amp; Ohkura, 2003) (
        <xref ref-type="fig" rid="f1">Figure 1A</xref>
        ). While the kinase domain phosphorylates protein substrates, the PBD binds both substrates and protein partners to direct subcellular localization (Park et al., 2010). Interestingly, all mutations encoded by the 
        <italic>
          <ext-link ext-link-type="pombase" xlink:href="SPAC23C11.16">plo1</ext-link>
        </italic>
         temperature sensitive alleles map within the kinase domain and none are within the PBD (
        <xref ref-type="fig" rid="f1">Figure 1A</xref>
        ). The one unique allele previously sequenced is 
        <italic>plo1-ts19</italic>
         which contains an early stop codon at tryptophan 316 (MacIver et al., 2003). The W316* mutation truncates an ɑ-helix within the kinase domain and eliminates an unstructured region and the PBD (MacIver et al., 2003) which is a surprising result given the reported requirement for the PBD for 
        <ext-link ext-link-type="pombase" xlink:href="SPAC23C11.16">Plo1</ext-link>
         function (Reynolds &amp; Ohkura, 2003).
      </p>
      <p>
        To follow up these observations, we used AlphaFold3 to model the 
        <ext-link ext-link-type="pombase" xlink:href="SPAC23C11.16">Plo1</ext-link>
         kinase domain with an ATP molecule (Abramson et al., 2024), and mapped the mutated residues encoded by the 
        <italic>
          <ext-link ext-link-type="pombase" xlink:href="SPAC23C11.16">plo1</ext-link>
        </italic>
         alleles onto the predicted structure. We found that all of the mutated residues clustered in the C-terminal lobe of the kinase domain (
        <xref ref-type="fig" rid="f1">Figure 1E</xref>
        ). Deciphering if ATP binding, substrate binding or other protein partner binding is defective in these 
        <italic>
          <ext-link ext-link-type="pombase" xlink:href="SPAC23C11.16">plo1</ext-link>
        </italic>
        alleles will be exciting direction for future studies. Further, how cells tolerate a lack of the 
        <ext-link ext-link-type="pombase" xlink:href="SPAC23C11.16">Plo1</ext-link>
         PBD will be an interesting avenue of study.
      </p>
    </sec>
    <sec>
      <title>Methods</title>
      <p>
        <underline>Yeast methods</underline>
      </p>
      <p>
        <italic>S. pombe</italic>
         strains were grown in yeast extract (YE) and standard 
        <italic>S. pombe</italic>
         mating, sporulation, and tetrad dissection techniques were used to construct new strains (Moreno et al., 1991).
      </p>
      <p>
        <underline>Molecular biology methods</underline>
      </p>
      <p>
        The 
        <italic>
          <ext-link ext-link-type="pombase" xlink:href="SPCC4B3.15">mid1</ext-link>
        </italic>
        open reading frames from 
        <italic>mid1-C1 </italic>
        and 
        <italic>mid1-C18 </italic>
        cells were amplified by generating a PCR product with an oligonucleotide
        <italic/>
        74 bp upstream of the start site (GTTGTACTTCAGGGTGCTTA) and an oligonucleotide 380 bp downstream of the stop codon (AGGTTCTCCATCTCATGGCT) (Integrated DNA technologies). The 
        <italic>
          <ext-link ext-link-type="pombase" xlink:href="SPCC4B3.15">mid1</ext-link>
        </italic>
         open reading frame was amplified from 
        <italic>mid1-C2 </italic>
        cells using two sets of overlapping oligonucleotides. The first PCR product was generated with the above-mentioned oligonucleotide 74 bp upstream of the start site and an oligonucleotide 1350 bp into the open reading frame (GTTGCATTGATGGGTGACGT). The second PCR product was produced with an oligonucleotide 1200 bp within the open reading frame (GTATGGTCATGGATCTGTAACG) and the above-mentioned oligonucleotide 380 bp downstream of the stop codon.
      </p>
      <p>
        The 
        <italic>
          <ext-link ext-link-type="pombase" xlink:href="SPAC23C11.16">plo1</ext-link>
        </italic>
         alleles were amplified by generating two PCR products. One PCR reaction used an oligonucleotide 40 bp upstream of the start site (GCAACCACTTTGTTTACCCTCA) and an oligonucleotide 1100 bp into the open reading frame of 
        <italic>
          <ext-link ext-link-type="pombase" xlink:href="SPAC23C11.16">plo1</ext-link>
        </italic>
         (TGGACTTAAAACACTTGGTAATATTCG) (Integrated DNA technologies). The second PCR reaction used an oligonucleotide 900 bp into the open reading frame (TCCAGATGAAATTTTACATTCAATGCCT) with an oligonucleotide 20 bp downstream of the stop codon (GCATAGTAACTTAACGCCCAAGTA). 
      </p>
      <p>The PCR products were sequenced by Plasmidsaurus using Oxford Nanopore Technology with custom analysis and annotation.</p>
      <p>
        <underline>Microscopy and image analysis</underline>
      </p>
      <p>Strains for fixed-cell imaging experiments were grown at 25°C in YE and then shifted to 36°C for 3 hours. Cells were fixed with 70% ethanol for DAPI and methyl blue (MB) staining as described previously (Roberts-Galbraith et al., 2009). Images were acquired using a Zeiss Axio Observer inverted epifluorescence microscope with Zeiss 63× oil (1.46 NA) objective and captured using Zeiss ZEN 3.0 (Blue edition) software. A singular medial Z slice was obtained. All images were further processed using ImageJ (Schindelin et al., 2012).</p>
      <p>
        <underline>AlphaFold3 structural prediction</underline>
      </p>
      <p>Protein structure predictions were generated with the AlphaFold3 server (Abramson et al., 2024) and visualized using the PyMOL molecular graphics system (version 3.0, Schrodinger, LLC).</p>
    </sec>
    <sec>
      <title>Reagents</title>
      <p>The strains used in this study and their genotypes are listed below.</p>
      <table-wrap>
        <table>
          <tbody>
            <tr>
              <td>
                <p>
                  <bold>Strain</bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>Genotype</bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>Source</bold>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>KGY246</p>
              </td>
              <td>
                <p>
                  <italic>ade6-M210 leu1-32 ura4-D18</italic>
                  <italic>
                    h
                    <sup>-</sup>
                  </italic>
                </p>
              </td>
              <td>
                <p>Lab stock</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>KGY1001</p>
              </td>
              <td>
                <p>
                  <italic>
                    plo1-1 ura4-D18 leu1-32 ade6-M21X h
                    <sup>+</sup>
                  </italic>
                </p>
              </td>
              <td>
                <p>
                  <italic>Bahler et al., 1998</italic>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>KGY846</p>
              </td>
              <td>
                <p>
                  <italic>
                    plo1-ts4:ura4
                    <sup>+</sup>
                     ura4-D18 leu1-32 ade6-M210 h
                    <sup>+</sup>
                  </italic>
                </p>
              </td>
              <td>
                <p>
                  <italic>MacIver et al., 2003</italic>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>KGY1460</p>
              </td>
              <td>
                <p>
                  <italic>
                    plo1-24C leu1-32 ura4-D18 ade6-M216 his3-D1 h
                    <sup>+</sup>
                  </italic>
                </p>
              </td>
              <td>
                <p>
                  <italic>Bahler et al., 1998</italic>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>KGY16150-2</p>
              </td>
              <td>
                <p>
                  <italic>
                    plo1-ts35:ura4
                    <sup>+</sup>
                     ura4-D18 leu1-32 ade6-M210 h-
                  </italic>
                </p>
              </td>
              <td>
                <p>
                  <italic>Anderson et al., 2002</italic>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>KGY15085</p>
              </td>
              <td>
                <p>
                  <italic>
                    plo1-25 ade6-M21X leu1-32 ura4-D18 h
                    <sup>+</sup>
                  </italic>
                </p>
              </td>
              <td>
                <p>
                  <italic>Bahler et al., 1998</italic>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>KGY16148-2</p>
              </td>
              <td>
                <p>
                  <italic>
                    plo1-ts2:ura4
                    <sup>+</sup>
                     ura4-D18 leu1-32 ade6-M210 h
                    <sup>-</sup>
                  </italic>
                </p>
              </td>
              <td>
                <p>
                  <italic>MacIver et al., 2003</italic>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>KGY16149-2</p>
              </td>
              <td>
                <p>
                  <italic>
                    plo1-ts19:ura4
                    <sup>+</sup>
                     ura4-D18 leu1-32 ade6-M210 h
                    <sup>-</sup>
                  </italic>
                </p>
              </td>
              <td>
                <p>
                  <italic>MacIver et al., 2003</italic>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>KGY1058</p>
              </td>
              <td>
                <p>
                  <italic>
                    mid1-C1 ura1 leu1-32 mam2::LEU2 ade6-216 h
                    <sup>90</sup>
                  </italic>
                </p>
              </td>
              <td>
                <p>Balasubramanian et al., 1998</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>KGY1059</p>
              </td>
              <td>
                <p>
                  <italic>mid1-C2 ura1 leu1-32 mam2::LEU2 ade6-216</italic>
                </p>
              </td>
              <td>
                <p>Balasubramanian et al., 1998</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>KGY19270</p>
              </td>
              <td>
                <p>
                  <italic>
                    mid1-18 ura4-D18 leu1-32 ade6-21X h
                    <sup>-</sup>
                  </italic>
                </p>
              </td>
              <td>
                <p>Balasubramanian et al., 1998</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>KGY442-2</p>
              </td>
              <td>
                <p>
                  <italic>
                    mid1-C1 ura4-D18 h
                    <sup>90</sup>
                  </italic>
                </p>
              </td>
              <td>
                <p>This study</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>KGY436-2</p>
              </td>
              <td>
                <p>
                  <italic>
                    mid1-C2 ura4-D18 h
                    <sup>-</sup>
                  </italic>
                </p>
              </td>
              <td>
                <p>This study</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>KGY3717</p>
              </td>
              <td>
                <p>
                  <italic>
                    mid1-2075 ura4-D18 ade6-21X h
                    <sup>-</sup>
                  </italic>
                </p>
              </td>
              <td>
                <p>This study</p>
              </td>
            </tr>
          </tbody>
        </table>
      </table-wrap>
    </sec>
  </body>
  <back>
    <ack>
      <sec>
        <p>
          We are grateful to PomBase for compiling and making freely available a wealth of information on 
          <italic>S. pombe</italic>
           proteins. Protein structure predictions were generated with the AlphaFold3 server.
        </p>
      </sec>
    </ack>
    <ref-list>
      <ref id="R1">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Abramson</surname>
              <given-names>Josh</given-names>
            </name>
            <name>
              <surname>Adler</surname>
              <given-names>Jonas</given-names>
            </name>
            <name>
              <surname>Dunger</surname>
              <given-names>Jack</given-names>
            </name>
            <name>
              <surname>Evans</surname>
              <given-names>Richard</given-names>
            </name>
            <name>
              <surname>Green</surname>
              <given-names>Tim</given-names>
            </name>
            <name>
              <surname>Pritzel</surname>
              <given-names>Alexander</given-names>
            </name>
            <name>
              <surname>Ronneberger</surname>
              <given-names>Olaf</given-names>
            </name>
            <name>
              <surname>Willmore</surname>
              <given-names>Lindsay</given-names>
            </name>
            <name>
              <surname>Ballard</surname>
              <given-names>Andrew J.</given-names>
            </name>
            <name>
              <surname>Bambrick</surname>
              <given-names>Joshua</given-names>
            </name>
            <name>
              <surname>Bodenstein</surname>
              <given-names>Sebastian W.</given-names>
            </name>
            <name>
              <surname>Evans</surname>
              <given-names>David A.</given-names>
            </name>
            <name>
              <surname>Hung</surname>
              <given-names>Chia-Chun</given-names>
            </name>
            <name>
              <surname>O’Neill</surname>
              <given-names>Michael</given-names>
            </name>
            <name>
              <surname>Reiman</surname>
              <given-names>David</given-names>
            </name>
            <name>
              <surname>Tunyasuvunakool</surname>
              <given-names>Kathryn</given-names>
            </name>
            <name>
              <surname>Wu</surname>
              <given-names>Zachary</given-names>
            </name>
            <name>
              <surname>Žemgulytė</surname>
              <given-names>Akvilė</given-names>
            </name>
            <name>
              <surname>Arvaniti</surname>
              <given-names>Eirini</given-names>
            </name>
            <name>
              <surname>Beattie</surname>
              <given-names>Charles</given-names>
            </name>
            <name>
              <surname>Bertolli</surname>
              <given-names>Ottavia</given-names>
            </name>
            <name>
              <surname>Bridgland</surname>
              <given-names>Alex</given-names>
            </name>
            <name>
              <surname>Cherepanov</surname>
              <given-names>Alexey</given-names>
            </name>
            <name>
              <surname>Congreve</surname>
              <given-names>Miles</given-names>
            </name>
            <name>
              <surname>Cowen-Rivers</surname>
              <given-names>Alexander I.</given-names>
            </name>
            <name>
              <surname>Cowie</surname>
              <given-names>Andrew</given-names>
            </name>
            <name>
              <surname>Figurnov</surname>
              <given-names>Michael</given-names>
            </name>
            <name>
              <surname>Fuchs</surname>
              <given-names>Fabian B.</given-names>
            </name>
            <name>
              <surname>Gladman</surname>
              <given-names>Hannah</given-names>
            </name>
            <name>
              <surname>Jain</surname>
              <given-names>Rishub</given-names>
            </name>
            <name>
              <surname>Khan</surname>
              <given-names>Yousuf A.</given-names>
            </name>
            <name>
              <surname>Low</surname>
              <given-names>Caroline M. R.</given-names>
            </name>
            <name>
              <surname>Perlin</surname>
              <given-names>Kuba</given-names>
            </name>
            <name>
              <surname>Potapenko</surname>
              <given-names>Anna</given-names>
            </name>
            <name>
              <surname>Savy</surname>
              <given-names>Pascal</given-names>
            </name>
            <name>
              <surname>Singh</surname>
              <given-names>Sukhdeep</given-names>
            </name>
            <name>
              <surname>Stecula</surname>
              <given-names>Adrian</given-names>
            </name>
            <name>
              <surname>Thillaisundaram</surname>
              <given-names>Ashok</given-names>
            </name>
            <name>
              <surname>Tong</surname>
              <given-names>Catherine</given-names>
            </name>
            <name>
              <surname>Yakneen</surname>
              <given-names>Sergei</given-names>
            </name>
            <name>
              <surname>Zhong</surname>
              <given-names>Ellen D.</given-names>
            </name>
            <name>
              <surname>Zielinski</surname>
              <given-names>Michal</given-names>
            </name>
            <name>
              <surname>Žídek</surname>
              <given-names>Augustin</given-names>
            </name>
            <name>
              <surname>Bapst</surname>
              <given-names>Victor</given-names>
            </name>
            <name>
              <surname>Kohli</surname>
              <given-names>Pushmeet</given-names>
            </name>
            <name>
              <surname>Jaderberg</surname>
              <given-names>Max</given-names>
            </name>
            <name>
              <surname>Hassabis</surname>
              <given-names>Demis</given-names>
            </name>
            <name>
              <surname>Jumper</surname>
              <given-names>John M.</given-names>
            </name>
          </person-group>
          <year>2024</year>
          <month>5</month>
          <day>8</day>
          <article-title>Accurate structure prediction of biomolecular interactions with AlphaFold 3</article-title>
          <source>Nature</source>
          <volume>630</volume>
          <issue>8016</issue>
          <issn>0028-0836</issn>
          <fpage>493</fpage>
          <lpage>500</lpage>
          <pub-id pub-id-type="doi">10.1038/s41586-024-07487-w</pub-id>
        </element-citation>
      </ref>
      <ref id="R2">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Almonacid</surname>
              <given-names>Maria</given-names>
            </name>
            <name>
              <surname>Celton-Morizur</surname>
              <given-names>Séverine</given-names>
            </name>
            <name>
              <surname>Jakubowski</surname>
              <given-names>Jennifer L.</given-names>
            </name>
            <name>
              <surname>Dingli</surname>
              <given-names>Florent</given-names>
            </name>
            <name>
              <surname>Loew</surname>
              <given-names>Damarys</given-names>
            </name>
            <name>
              <surname>Mayeux</surname>
              <given-names>Adeline</given-names>
            </name>
            <name>
              <surname>Chen</surname>
              <given-names>Jun-Song</given-names>
            </name>
            <name>
              <surname>Gould</surname>
              <given-names>Kathleen L.</given-names>
            </name>
            <name>
              <surname>Clifford</surname>
              <given-names>Dawn M.</given-names>
            </name>
            <name>
              <surname>Paoletti</surname>
              <given-names>Anne</given-names>
            </name>
          </person-group>
          <year>2011</year>
          <month>3</month>
          <day>1</day>
          <article-title>Temporal Control of Contractile Ring Assembly by Plo1 Regulation of Myosin II Recruitment by Mid1/Anillin</article-title>
          <source>Current Biology</source>
          <volume>21</volume>
          <issue>6</issue>
          <issn>0960-9822</issn>
          <fpage>473</fpage>
          <lpage>479</lpage>
          <pub-id pub-id-type="doi">10.1016/j.cub.2011.02.003</pub-id>
        </element-citation>
      </ref>
      <ref id="R3">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Almonacid</surname>
              <given-names>Maria</given-names>
            </name>
            <name>
              <surname>Moseley</surname>
              <given-names>James B.</given-names>
            </name>
            <name>
              <surname>Janvore</surname>
              <given-names>Julie</given-names>
            </name>
            <name>
              <surname>Mayeux</surname>
              <given-names>Adeline</given-names>
            </name>
            <name>
              <surname>Fraisier</surname>
              <given-names>Vincent</given-names>
            </name>
            <name>
              <surname>Nurse</surname>
              <given-names>Paul</given-names>
            </name>
            <name>
              <surname>Paoletti</surname>
              <given-names>Anne</given-names>
            </name>
          </person-group>
          <year>2009</year>
          <month>6</month>
          <day>1</day>
          <article-title>Spatial Control of Cytokinesis by Cdr2 Kinase and Mid1/Anillin Nuclear Export</article-title>
          <source>Current Biology</source>
          <volume>19</volume>
          <issue>11</issue>
          <issn>0960-9822</issn>
          <fpage>961</fpage>
          <lpage>966</lpage>
          <pub-id pub-id-type="doi">10.1016/j.cub.2009.04.024</pub-id>
        </element-citation>
      </ref>
      <ref id="R4">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Bähler</surname>
              <given-names>Jürg</given-names>
            </name>
            <name>
              <surname>Steever</surname>
              <given-names>Alexander B.</given-names>
            </name>
            <name>
              <surname>Wheatley</surname>
              <given-names>Sally</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>Yu-li</given-names>
            </name>
            <name>
              <surname>Pringle</surname>
              <given-names>John R.</given-names>
            </name>
            <name>
              <surname>Gould</surname>
              <given-names>Kathleen L.</given-names>
            </name>
            <name>
              <surname>McCollum</surname>
              <given-names>Dannel</given-names>
            </name>
          </person-group>
          <year>1998</year>
          <month>12</month>
          <day>14</day>
          <article-title>Role of Polo Kinase and Mid1p in Determining the Site of Cell Division in Fission Yeast</article-title>
          <source>The Journal of Cell Biology</source>
          <volume>143</volume>
          <issue>6</issue>
          <issn>0021-9525</issn>
          <fpage>1603</fpage>
          <lpage>1616</lpage>
          <pub-id pub-id-type="doi">10.1083/jcb.143.6.1603</pub-id>
        </element-citation>
      </ref>
      <ref id="R5">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Balasubramanian</surname>
              <given-names>Mohan K</given-names>
            </name>
            <name>
              <surname>McCollum</surname>
              <given-names>Dannel</given-names>
            </name>
            <name>
              <surname>Chang</surname>
              <given-names>Louise</given-names>
            </name>
            <name>
              <surname>Wong</surname>
              <given-names>Kelvin C Y</given-names>
            </name>
            <name>
              <surname>Naqvi</surname>
              <given-names>Naweed I</given-names>
            </name>
            <name>
              <surname>He</surname>
              <given-names>Xiangwei</given-names>
            </name>
            <name>
              <surname>Sazer</surname>
              <given-names>Shelley</given-names>
            </name>
            <name>
              <surname>Gould</surname>
              <given-names>Kathleen L</given-names>
            </name>
          </person-group>
          <year>1998</year>
          <month>7</month>
          <day>1</day>
          <article-title>Isolation and Characterization of New Fission Yeast Cytokinesis Mutants</article-title>
          <source>Genetics</source>
          <volume>149</volume>
          <issue>3</issue>
          <issn>1943-2631</issn>
          <fpage>1265</fpage>
          <lpage>1275</lpage>
          <pub-id pub-id-type="doi">10.1093/genetics/149.3.1265</pub-id>
        </element-citation>
      </ref>
      <ref id="R6">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Bhutta</surname>
              <given-names>Musab</given-names>
            </name>
            <name>
              <surname>McInerny</surname>
              <given-names>Christopher</given-names>
            </name>
            <name>
              <surname>Gould</surname>
              <given-names>Gwyn</given-names>
            </name>
          </person-group>
          <year>2014</year>
          <month>11</month>
          <day>25</day>
          <article-title>ESCRT Function in Cytokinesis: Location, Dynamics and Regulation by Mitotic Kinases</article-title>
          <source>International Journal of Molecular Sciences</source>
          <volume>15</volume>
          <issue>12</issue>
          <issn>1422-0067</issn>
          <fpage>21723</fpage>
          <lpage>21739</lpage>
          <pub-id pub-id-type="doi">10.3390/ijms151221723</pub-id>
        </element-citation>
      </ref>
      <ref id="R7">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Chang</surname>
              <given-names>Fred</given-names>
            </name>
            <name>
              <surname>Woollard</surname>
              <given-names>Alison</given-names>
            </name>
            <name>
              <surname>Nurse</surname>
              <given-names>Paul</given-names>
            </name>
          </person-group>
          <year>1996</year>
          <month>1</month>
          <day>1</day>
          <article-title>Isolation and characterization of fission yeast mutants defective in the assembly and placement of the contractile actin ring</article-title>
          <source>Journal of Cell Science</source>
          <volume>109</volume>
          <issue>1</issue>
          <issn>0021-9533</issn>
          <fpage>131</fpage>
          <lpage>142</lpage>
          <pub-id pub-id-type="doi">10.1242/jcs.109.1.131</pub-id>
        </element-citation>
      </ref>
      <ref id="R8">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Cheffings</surname>
              <given-names>Thomas H.</given-names>
            </name>
            <name>
              <surname>Burroughs</surname>
              <given-names>Nigel J.</given-names>
            </name>
            <name>
              <surname>Balasubramanian</surname>
              <given-names>Mohan K.</given-names>
            </name>
          </person-group>
          <year>2016</year>
          <month>8</month>
          <day>1</day>
          <article-title>Actomyosin Ring Formation and Tension Generation in Eukaryotic Cytokinesis</article-title>
          <source>Current Biology</source>
          <volume>26</volume>
          <issue>15</issue>
          <issn>0960-9822</issn>
          <fpage>R719</fpage>
          <lpage>R737</lpage>
          <pub-id pub-id-type="doi">10.1016/j.cub.2016.06.071</pub-id>
        </element-citation>
      </ref>
      <ref id="R9">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Glotzer</surname>
              <given-names>Michael</given-names>
            </name>
          </person-group>
          <year>2016</year>
          <month>12</month>
          <day>22</day>
          <article-title>Cytokinesis in Metazoa and Fungi</article-title>
          <source>Cold Spring Harbor Perspectives in Biology</source>
          <volume>9</volume>
          <issue>10</issue>
          <issn>1943-0264</issn>
          <fpage>a022343</fpage>
          <lpage>a022343</lpage>
          <pub-id pub-id-type="doi">10.1101/cshperspect.a022343</pub-id>
        </element-citation>
      </ref>
      <ref id="R10">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Hall</surname>
              <given-names>Aaron R.</given-names>
            </name>
            <name>
              <surname>Choi</surname>
              <given-names>Yeol Kyo</given-names>
            </name>
            <name>
              <surname>Im</surname>
              <given-names>Wonpil</given-names>
            </name>
            <name>
              <surname>Vavylonis</surname>
              <given-names>Dimitrios</given-names>
            </name>
          </person-group>
          <year>2024</year>
          <month>2</month>
          <day>1</day>
          <article-title>Anillin-related Mid1 as an adaptive and multimodal contractile ring anchoring protein: A simulation study</article-title>
          <source>Structure</source>
          <volume>32</volume>
          <issue>2</issue>
          <issn>0969-2126</issn>
          <fpage>242</fpage>
          <lpage>252.e2</lpage>
          <pub-id pub-id-type="doi">10.1016/j.str.2023.11.010</pub-id>
        </element-citation>
      </ref>
      <ref id="R11">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Huang</surname>
              <given-names>Yinyi</given-names>
            </name>
            <name>
              <surname>Yan</surname>
              <given-names>Hongyan</given-names>
            </name>
            <name>
              <surname>Balasubramanian</surname>
              <given-names>Mohan K.</given-names>
            </name>
          </person-group>
          <year>2008</year>
          <month>12</month>
          <day>15</day>
          <article-title>Assembly of normal actomyosin rings in the absence of Mid1p and cortical nodes in fission yeast</article-title>
          <source>The Journal of Cell Biology</source>
          <volume>183</volume>
          <issue>6</issue>
          <issn>1540-8140</issn>
          <fpage>979</fpage>
          <lpage>988</lpage>
          <pub-id pub-id-type="doi">10.1083/jcb.200806151</pub-id>
        </element-citation>
      </ref>
      <ref id="R12">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Lee</surname>
              <given-names>I-Ju</given-names>
            </name>
            <name>
              <surname>Wu</surname>
              <given-names>Jian-Qiu</given-names>
            </name>
          </person-group>
          <year>2012</year>
          <month>1</month>
          <day>1</day>
          <article-title>Characterization of Mid1 domains for targeting and scaffolding in fission yeast cytokinesis</article-title>
          <source>Journal of Cell Science</source>
          <issn>1477-9137</issn>
          <pub-id pub-id-type="doi">10.1242/jcs.102574</pub-id>
        </element-citation>
      </ref>
      <ref id="R13">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Liu</surname>
              <given-names>Jinghe</given-names>
            </name>
            <name>
              <surname>Fairn</surname>
              <given-names>Gregory D.</given-names>
            </name>
            <name>
              <surname>Ceccarelli</surname>
              <given-names>Derek F.</given-names>
            </name>
            <name>
              <surname>Sicheri</surname>
              <given-names>Frank</given-names>
            </name>
            <name>
              <surname>Wilde</surname>
              <given-names>Andrew</given-names>
            </name>
          </person-group>
          <year>2012</year>
          <month>1</month>
          <day>1</day>
          <article-title>Cleavage Furrow Organization Requires PIP2-Mediated Recruitment of Anillin</article-title>
          <source>Current Biology</source>
          <volume>22</volume>
          <issue>1</issue>
          <issn>0960-9822</issn>
          <fpage>64</fpage>
          <lpage>69</lpage>
          <pub-id pub-id-type="doi">10.1016/j.cub.2011.11.040</pub-id>
        </element-citation>
      </ref>
      <ref id="R14">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>MacIver</surname>
              <given-names>Fiona H.</given-names>
            </name>
            <name>
              <surname>Tanaka</surname>
              <given-names>Kayoko</given-names>
            </name>
            <name>
              <surname>Robertson</surname>
              <given-names>Alasdair M.</given-names>
            </name>
            <name>
              <surname>Hagan</surname>
              <given-names>Iain M.</given-names>
            </name>
          </person-group>
          <year>2003</year>
          <month>6</month>
          <day>15</day>
          <article-title>
            Physical and functional interactions between polo kinase and the spindle pole component Cut12 regulate mitotic commitment in
            <italic>S. pombe</italic>
          </article-title>
          <source>Genes &amp; Development</source>
          <volume>17</volume>
          <issue>12</issue>
          <issn>0890-9369</issn>
          <fpage>1507</fpage>
          <lpage>1523</lpage>
          <pub-id pub-id-type="doi">10.1101/gad.256003</pub-id>
        </element-citation>
      </ref>
      <ref id="R15">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Mangione</surname>
              <given-names>M. C.</given-names>
            </name>
            <name>
              <surname>Gould</surname>
              <given-names>Kathleen L.</given-names>
            </name>
          </person-group>
          <year>2019</year>
          <month>6</month>
          <day>15</day>
          <article-title>Molecular form and function of the cytokinetic ring</article-title>
          <source>Journal of Cell Science</source>
          <volume>132</volume>
          <issue>12</issue>
          <issn>1477-9137</issn>
          <pub-id pub-id-type="doi">10.1242/jcs.226928</pub-id>
        </element-citation>
      </ref>
      <ref id="R16">
        <element-citation publication-type="book-chapter">
          <person-group person-group-type="author">
            <name>
              <surname>Moreno</surname>
              <given-names>Sergio</given-names>
            </name>
            <name>
              <surname>Klar</surname>
              <given-names>Amar</given-names>
            </name>
            <name>
              <surname>Nurse</surname>
              <given-names>Paul</given-names>
            </name>
          </person-group>
          <year>1991</year>
          <article-title>[56] Molecular genetic analysis of fission yeast Schizosaccharomyces pombe</article-title>
          <source>Guide to Yeast Genetics and Molecular Biology</source>
          <issn>0076-6879</issn>
          <fpage>795</fpage>
          <lpage>823</lpage>
          <pub-id pub-id-type="doi">10.1016/0076-6879(91)94059-l</pub-id>
        </element-citation>
      </ref>
      <ref id="R17">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Ohkura</surname>
              <given-names>H</given-names>
            </name>
            <name>
              <surname>Hagan</surname>
              <given-names>I M</given-names>
            </name>
            <name>
              <surname>Glover</surname>
              <given-names>D M</given-names>
            </name>
          </person-group>
          <year>1995</year>
          <month>5</month>
          <day>1</day>
          <article-title>The conserved Schizosaccharomyces pombe kinase plo1, required to form a bipolar spindle, the actin ring, and septum, can drive septum formation in G1 and G2 cells.</article-title>
          <source>Genes &amp; Development</source>
          <volume>9</volume>
          <issue>9</issue>
          <issn>0890-9369</issn>
          <fpage>1059</fpage>
          <lpage>1073</lpage>
          <pub-id pub-id-type="doi">10.1101/gad.9.9.1059</pub-id>
        </element-citation>
      </ref>
      <ref id="R18">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Paoletti</surname>
              <given-names>Anne</given-names>
            </name>
            <name>
              <surname>Chang</surname>
              <given-names>Fred</given-names>
            </name>
          </person-group>
          <year>2000</year>
          <month>8</month>
          <day>1</day>
          <article-title>Analysis of mid1p, a Protein Required for Placement of the Cell Division Site, Reveals a Link between the Nucleus and the Cell Surface in Fission Yeast</article-title>
          <source>Molecular Biology of the Cell</source>
          <volume>11</volume>
          <issue>8</issue>
          <issn>1059-1524</issn>
          <fpage>2757</fpage>
          <lpage>2773</lpage>
          <pub-id pub-id-type="doi">10.1091/mbc.11.8.2757</pub-id>
        </element-citation>
      </ref>
      <ref id="R19">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Park</surname>
              <given-names>Jung-Eun</given-names>
            </name>
            <name>
              <surname>Soung</surname>
              <given-names>Nak-Kyun</given-names>
            </name>
            <name>
              <surname>Johmura</surname>
              <given-names>Yoshikazu</given-names>
            </name>
            <name>
              <surname>Kang</surname>
              <given-names>Young H.</given-names>
            </name>
            <name>
              <surname>Liao</surname>
              <given-names>Chenzhong</given-names>
            </name>
            <name>
              <surname>Lee</surname>
              <given-names>Kyung H.</given-names>
            </name>
            <name>
              <surname>Park</surname>
              <given-names>Chi Hoon</given-names>
            </name>
            <name>
              <surname>Nicklaus</surname>
              <given-names>Marc C.</given-names>
            </name>
            <name>
              <surname>Lee</surname>
              <given-names>Kyung S.</given-names>
            </name>
          </person-group>
          <year>2010</year>
          <month>2</month>
          <day>11</day>
          <article-title>Polo-box domain: a versatile mediator of polo-like kinase function</article-title>
          <source>Cellular and Molecular Life Sciences</source>
          <volume>67</volume>
          <issue>12</issue>
          <issn>1420-682X</issn>
          <fpage>1957</fpage>
          <lpage>1970</lpage>
          <pub-id pub-id-type="doi">10.1007/s00018-010-0279-9</pub-id>
        </element-citation>
      </ref>
      <ref id="R20">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Petersen</surname>
              <given-names>Janni</given-names>
            </name>
            <name>
              <surname>Hagan</surname>
              <given-names>Iain M.</given-names>
            </name>
          </person-group>
          <year>2005</year>
          <month>5</month>
          <day>1</day>
          <article-title>Polo kinase links the stress pathway to cell cycle control and tip growth in fission yeast</article-title>
          <source>Nature</source>
          <volume>435</volume>
          <issue>7041</issue>
          <issn>0028-0836</issn>
          <fpage>507</fpage>
          <lpage>512</lpage>
          <pub-id pub-id-type="doi">10.1038/nature03590</pub-id>
        </element-citation>
      </ref>
      <ref id="R21">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Rachfall</surname>
              <given-names>Nicole</given-names>
            </name>
            <name>
              <surname>Johnson</surname>
              <given-names>Alyssa E.</given-names>
            </name>
            <name>
              <surname>Mehta</surname>
              <given-names>Sapna</given-names>
            </name>
            <name>
              <surname>Chen</surname>
              <given-names>Jun-Song</given-names>
            </name>
            <name>
              <surname>Gould</surname>
              <given-names>Kathleen L.</given-names>
            </name>
          </person-group>
          <year>2014</year>
          <month>8</month>
          <day>1</day>
          <article-title>Cdk1 promotes cytokinesis in fission yeast through activation of the septation initiation network</article-title>
          <source>Molecular Biology of the Cell</source>
          <volume>25</volume>
          <issue>15</issue>
          <issn>1059-1524</issn>
          <fpage>2250</fpage>
          <lpage>2259</lpage>
          <pub-id pub-id-type="doi">10.1091/mbc.e14-04-0936</pub-id>
        </element-citation>
      </ref>
      <ref id="R22">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Reynolds</surname>
              <given-names>Nicola</given-names>
            </name>
            <name>
              <surname>Ohkura</surname>
              <given-names>Hiroyuki</given-names>
            </name>
          </person-group>
          <year>2003</year>
          <month>4</month>
          <day>1</day>
          <article-title>Polo boxes form a single functional domain that mediates interactions with multiple proteins in fission yeast polo kinase</article-title>
          <source>Journal of Cell Science</source>
          <volume>116</volume>
          <issue>7</issue>
          <issn>1477-9137</issn>
          <fpage>1377</fpage>
          <lpage>1387</lpage>
          <pub-id pub-id-type="doi">10.1242/jcs.00314</pub-id>
        </element-citation>
      </ref>
      <ref id="R23">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Rincon</surname>
              <given-names>Sergio A.</given-names>
            </name>
            <name>
              <surname>Paoletti</surname>
              <given-names>Anne</given-names>
            </name>
          </person-group>
          <year>2016</year>
          <month>5</month>
          <day>1</day>
          <article-title>Molecular control of fission yeast cytokinesis</article-title>
          <source>Seminars in Cell &amp; Developmental Biology</source>
          <volume>53</volume>
          <issn>1084-9521</issn>
          <fpage>28</fpage>
          <lpage>38</lpage>
          <pub-id pub-id-type="doi">10.1016/j.semcdb.2016.01.007</pub-id>
        </element-citation>
      </ref>
      <ref id="R24">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Roberts-Galbraith</surname>
              <given-names>Rachel H.</given-names>
            </name>
            <name>
              <surname>Chen</surname>
              <given-names>Jun-Song</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>Jianqiu</given-names>
            </name>
            <name>
              <surname>Gould</surname>
              <given-names>Kathleen L.</given-names>
            </name>
          </person-group>
          <year>2009</year>
          <month>1</month>
          <day>12</day>
          <article-title>
            The SH3 domains of two PCH family members cooperate in assembly of the 
            <italic>Schizosaccharomyces pombe</italic>
             contractile ring
          </article-title>
          <source>The Journal of Cell Biology</source>
          <volume>184</volume>
          <issue>1</issue>
          <issn>1540-8140</issn>
          <fpage>113</fpage>
          <lpage>127</lpage>
          <pub-id pub-id-type="doi">10.1083/jcb.200806044</pub-id>
        </element-citation>
      </ref>
      <ref id="R25">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Rutherford</surname>
              <given-names>Kim M</given-names>
            </name>
            <name>
              <surname>Lera-Ramírez</surname>
              <given-names>Manuel</given-names>
            </name>
            <name>
              <surname>Wood</surname>
              <given-names>Valerie</given-names>
            </name>
          </person-group>
          <year>2024</year>
          <month>2</month>
          <day>20</day>
          <article-title>PomBase: a Global Core Biodata Resource—growth, collaboration, and sustainability</article-title>
          <source>GENETICS</source>
          <volume>227</volume>
          <issue>1</issue>
          <issn>1943-2631</issn>
          <pub-id pub-id-type="doi">10.1093/genetics/iyae007</pub-id>
        </element-citation>
      </ref>
      <ref id="R26">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Schindelin</surname>
              <given-names>Johannes</given-names>
            </name>
            <name>
              <surname>Arganda-Carreras</surname>
              <given-names>Ignacio</given-names>
            </name>
            <name>
              <surname>Frise</surname>
              <given-names>Erwin</given-names>
            </name>
            <name>
              <surname>Kaynig</surname>
              <given-names>Verena</given-names>
            </name>
            <name>
              <surname>Longair</surname>
              <given-names>Mark</given-names>
            </name>
            <name>
              <surname>Pietzsch</surname>
              <given-names>Tobias</given-names>
            </name>
            <name>
              <surname>Preibisch</surname>
              <given-names>Stephan</given-names>
            </name>
            <name>
              <surname>Rueden</surname>
              <given-names>Curtis</given-names>
            </name>
            <name>
              <surname>Saalfeld</surname>
              <given-names>Stephan</given-names>
            </name>
            <name>
              <surname>Schmid</surname>
              <given-names>Benjamin</given-names>
            </name>
            <name>
              <surname>Tinevez</surname>
              <given-names>Jean-Yves</given-names>
            </name>
            <name>
              <surname>White</surname>
              <given-names>Daniel James</given-names>
            </name>
            <name>
              <surname>Hartenstein</surname>
              <given-names>Volker</given-names>
            </name>
            <name>
              <surname>Eliceiri</surname>
              <given-names>Kevin</given-names>
            </name>
            <name>
              <surname>Tomancak</surname>
              <given-names>Pavel</given-names>
            </name>
            <name>
              <surname>Cardona</surname>
              <given-names>Albert</given-names>
            </name>
          </person-group>
          <year>2012</year>
          <month>6</month>
          <day>28</day>
          <article-title>Fiji: an open-source platform for biological-image analysis</article-title>
          <source>Nature Methods</source>
          <volume>9</volume>
          <issue>7</issue>
          <issn>1548-7091</issn>
          <fpage>676</fpage>
          <lpage>682</lpage>
          <pub-id pub-id-type="doi">10.1038/nmeth.2019</pub-id>
        </element-citation>
      </ref>
      <ref id="R27">
        <mixed-citation>Sohrmann M, Fankhauser C, Brodbeck C, Simanis V. 1996. The dmf1/mid1 gene is essential for correct positioning of the division septum in fission yeast. Genes &amp; development. 10: 2707.</mixed-citation>
      </ref>
      <ref id="R28">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Sun</surname>
              <given-names>Lingfei</given-names>
            </name>
            <name>
              <surname>Guan</surname>
              <given-names>Ruifang</given-names>
            </name>
            <name>
              <surname>Lee</surname>
              <given-names>I-Ju</given-names>
            </name>
            <name>
              <surname>Liu</surname>
              <given-names>Yajun</given-names>
            </name>
            <name>
              <surname>Chen</surname>
              <given-names>Mengran</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>Jiawei</given-names>
            </name>
            <name>
              <surname>Wu</surname>
              <given-names>Jian-Qiu</given-names>
            </name>
            <name>
              <surname>Chen</surname>
              <given-names>Zhucheng</given-names>
            </name>
          </person-group>
          <year>2015</year>
          <month>5</month>
          <day>1</day>
          <article-title>Mechanistic Insights into the Anchorage of the Contractile Ring by Anillin and Mid1</article-title>
          <source>Developmental Cell</source>
          <volume>33</volume>
          <issue>4</issue>
          <issn>1534-5807</issn>
          <fpage>413</fpage>
          <lpage>426</lpage>
          <pub-id pub-id-type="doi">10.1016/j.devcel.2015.03.003</pub-id>
        </element-citation>
      </ref>
      <ref id="R29">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Tanaka</surname>
              <given-names>Kayoko</given-names>
            </name>
            <name>
              <surname>Petersen</surname>
              <given-names>Janni</given-names>
            </name>
            <name>
              <surname>MacIver</surname>
              <given-names>Fiona</given-names>
            </name>
            <name>
              <surname>Mulvihill</surname>
              <given-names>Daniel P.</given-names>
            </name>
            <name>
              <surname>Glover</surname>
              <given-names>David M.</given-names>
            </name>
            <name>
              <surname>Hagan</surname>
              <given-names>Iain M.</given-names>
            </name>
          </person-group>
          <year>2001</year>
          <month>3</month>
          <day>15</day>
          <article-title>The role of Plo1 kinase in mitotic commitment and septation in Schizosaccharomyces pombe</article-title>
          <source>The EMBO Journal</source>
          <volume>20</volume>
          <issue>6</issue>
          <issn>0261-4189</issn>
          <fpage>1259</fpage>
          <lpage>1270</lpage>
          <pub-id pub-id-type="doi">10.1093/emboj/20.6.1259</pub-id>
        </element-citation>
      </ref>
      <ref id="R30">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Wachtler</surname>
              <given-names>Volker</given-names>
            </name>
            <name>
              <surname>Huang</surname>
              <given-names>Yinyi</given-names>
            </name>
            <name>
              <surname>Karagiannis</surname>
              <given-names>Jim</given-names>
            </name>
            <name>
              <surname>Balasubramanian</surname>
              <given-names>Mohan K.</given-names>
            </name>
          </person-group>
          <year>2006</year>
          <month>7</month>
          <day>1</day>
          <article-title>
            Cell Cycle-dependent Roles for the FCH-Domain Protein Cdc15p in Formation of the Actomyosin Ring in
            <italic>Schizosaccharomyces pombe</italic>
          </article-title>
          <source>Molecular Biology of the Cell</source>
          <volume>17</volume>
          <issue>7</issue>
          <issn>1059-1524</issn>
          <fpage>3254</fpage>
          <lpage>3266</lpage>
          <pub-id pub-id-type="doi">10.1091/mbc.e05-11-1086</pub-id>
        </element-citation>
      </ref>
      <ref id="R31">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Willet</surname>
              <given-names>Alaina H</given-names>
            </name>
            <name>
              <surname>McDonald</surname>
              <given-names>Nathan A</given-names>
            </name>
            <name>
              <surname>Gould</surname>
              <given-names>Kathleen L</given-names>
            </name>
          </person-group>
          <year>2015</year>
          <month>12</month>
          <day>1</day>
          <article-title>Regulation of contractile ring formation and septation in Schizosaccharomyces pombe</article-title>
          <source>Current Opinion in Microbiology</source>
          <volume>28</volume>
          <issn>1369-5274</issn>
          <fpage>46</fpage>
          <lpage>52</lpage>
          <pub-id pub-id-type="doi">10.1016/j.mib.2015.08.001</pub-id>
        </element-citation>
      </ref>
    </ref-list>
  </back>
</article>