<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/archiving/1.2/JATS-archivearticle1.dtd">
<article article-type="brief-report" xmlns:xlink="http://www.w3.org/1999/xlink">
  <front>
    <journal-meta>
      <journal-title-group>
        <journal-title>microPublication Biology</journal-title>
      </journal-title-group>
      <issn pub-type="epub">2578-9430</issn>
      <publisher>
        <publisher-name>Caltech Library</publisher-name>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="doi">10.17912/micropub.biology.001415</article-id>
      <article-categories>
        <subj-group subj-group-type="heading">
          <subject>new finding</subject>
        </subj-group>
        <subj-group subj-group-type="subject">
          <subject>expression data</subject>
        </subj-group>
        <subj-group subj-group-type="subject">
          <subject>cell culture</subject>
        </subj-group>
        <subj-group subj-group-type="species">
          <subject>mouse</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>The specificity of CTBP dehydrogenase inhibitors MTOB and 4-Cl-HIPP</article-title>
      </title-group>
      <contrib-group>
        <contrib contrib-type="author" equal-contrib="yes">
          <name>
            <surname>Stickland</surname>
            <given-names>Benjamin A. </given-names>
          </name>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation">Investigation</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing - original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft">Writing - original draft</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing - review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing-review-editing">Writing - review &amp; editing</role>
          <xref ref-type="aff" rid="aff1">1</xref>
          <xref ref-type="aff" rid="aff2">2</xref>
        </contrib>
        <contrib contrib-type="author" equal-contrib="yes">
          <name>
            <surname>Greulich</surname>
            <given-names>Franziska</given-names>
          </name>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation">Data curation</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Project administration" vocab-term-identifier="https://credit.niso.org/contributor-roles/project-administration">Project administration</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing - original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft">Writing - original draft</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Formal analysis" vocab-term-identifier="https://credit.niso.org/contributor-roles/formal-analysis">Formal analysis</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing - review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing-review-editing">Writing - review &amp; editing</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Conceptualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/onceptualization">Conceptualization</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Supervision" vocab-term-identifier="https://credit.niso.org/contributor-roles/supervision">Supervision</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Visualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/visualization">Visualization</role>
          <xref ref-type="aff" rid="aff1">1</xref>
          <xref ref-type="aff" rid="aff2">2</xref>
          <xref ref-type="corresp" rid="cor1">§</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Uhlenhaut</surname>
            <given-names>Nina Henriette</given-names>
          </name>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Funding acquisition" vocab-term-identifier="https://credit.niso.org/contributor-roles/funding-acquisition">Funding acquisition</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Conceptualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/onceptualization">Conceptualization</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing - review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing-review-editing">Writing - review &amp; editing</role>
          <xref ref-type="aff" rid="aff1">1</xref>
          <xref ref-type="aff" rid="aff2">2</xref>
          <xref ref-type="aff" rid="aff3">3</xref>
          <xref ref-type="aff" rid="aff4">4</xref>
        </contrib>
        <aff id="aff1">
          <label>1</label>
          Metabolic Programming, TUM School of Life Sciences, Technical University of Munich, Munich, Bavaria, Germany
        </aff>
        <aff id="aff2">
          <label>2</label>
          ZIEL-Institute for Food &amp; Health, Technical University of Munich, Munich, Bavaria, Germany
        </aff>
        <aff id="aff3">
          <label>3</label>
          Institute for Diabetes and Endocrinology (IDE), Helmholtz Zentrum München, Munich, Bavaria, Germany
        </aff>
        <aff id="aff4">
          <label>4</label>
          German Center for Diabetes Research, Munich, Bavaria, Germany
        </aff>
      </contrib-group>
      <contrib-group>
        <contrib contrib-type="reviewer">
          <anonymous/>
        </contrib>
        <contrib contrib-type="reviewer">
          <name>
            <surname>Quan</surname>
            <given-names>Baiyi</given-names>
          </name>
        </contrib>
      </contrib-group>
      <author-notes>
        <corresp id="cor1">
          <label>§</label>
          Correspondence to: Franziska Greulich (
          <email>franziska.greulich@tum.de</email>
          )
        </corresp>
        <fn fn-type="coi-statement">
          <p>The authors declare that there are no conflicts of interest present.</p>
        </fn>
      </author-notes>
      <pub-date date-type="pub" publication-format="electronic">
        <day>3</day>
        <month>2</month>
        <year>2025</year>
      </pub-date>
      <pub-date date-type="collection" publication-format="electronic">
        <year>2025</year>
      </pub-date>
      <volume>2025</volume>
      <elocation-id>10.17912/micropub.biology.001415</elocation-id>
      <history>
        <date date-type="received">
          <day>13</day>
          <month>11</month>
          <year>2024</year>
        </date>
        <date date-type="rev-recd">
          <day>29</day>
          <month>1</month>
          <year>2025</year>
        </date>
        <date date-type="accepted">
          <day>31</day>
          <month>1</month>
          <year>2025</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>Copyright: © 2025 by the authors</copyright-statement>
        <copyright-year>2025</copyright-year>
        <license license-type="open-access" xlink:href="https://creativecommons.org/licenses/by/4.0/">
          <license-p>This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.</license-p>
        </license>
      </permissions>
      <abstract>
        <p>
          C-terminal binding proteins (CTBPs) are conserved transcriptional repressors important in cancer and inflammation. Uniquely amongst transcriptional co-regulators, CTBPs possess a functional dehydrogenase domain. Since multiple malignancies display elevated CTBP levels, CTBP inhibitors targeting this dehydrogenase domain have been developed. While the importance of CTBPs dehydrogenase function for transcriptional regulation remains unclear, several studies have relied on CTBP inhibitors. 
          <italic>In vitro </italic>
          experiments have confirmed binding of these compounds to CTBP’s active site, however evidence for specificity is lacking. To address this, we treated wildtype and 
          <italic>Ctbp1</italic>
          , 
          <italic>2</italic>
           double knockout J774.1 cells with MTOB or 4-Cl-HIPP and performed RNA-seq. We observed that both inhibitors elicit distinct transcriptional changes indicating non-overlapping modes of action. Moreover, the majority of changes induced by either inhibitor are observed in 
          <italic>Ctbp1/2</italic>
           double knockout cells suggesting off-target effects. We hypothesize that those CTBP dehydrogenase inhibitors lack specificity to CTBPs and emphasise careful revaluation of findings inferred from studies using those inhibitors.
        </p>
      </abstract>
      <funding-group>
        <funding-statement>This project received funding from the DFG (SFB 1064 Chromatin Dynamics (Project-ID 213249687), TRR 205 Adrenal Research (Project-ID 314061271) and DFG-ANR Hepatologic to NHU).</funding-statement>
      </funding-group>
    </article-meta>
  </front>
  <body>
    <fig position="anchor" id="f1">
      <label>
        Figure 1. 
        <bold>Off-targets of CTBP inhibitors MTOB and 4-Cl-HIPP in J774.1 cells</bold>
      </label>
      <caption>
        <p>
          <bold>(A) </bold>
          Overview of the CRISPR double knockout (
          <italic>dKO</italic>
          ) strategy and confirmation of CTBP1 and CTBP2 protein loss by western blot. We have introduced a premature STOP and frameshift mutation in both, the 
          <italic>Ctbp1 </italic>
          and 
          <italic>2</italic>
           gene.
          <bold> (B) </bold>
          Principal component analysis from RNA-seq data of wildtype (grey) and 
          <italic>Ctbp1/2 dKO </italic>
          (red) J774.1 cells after PBS/DMSO (control, grey), 4-Cl-HIPP (250 µM, yellow) and MTOB (1.5 mM, orange) treatment. N=3 
          <bold>(C) </bold>
          Differential expression of MTOB (top) or 4-Cl-HIPP (bottom) treated J774.1 wildtype cells. Significantly induced genes (Benjamini-Hochberg-adjusted P-value (adjP) &lt; 0.05, Fold change (FC) &gt; 1.5-fold) are indicated in purple, repressed genes (adjP &lt; 0.05, FC &gt; 1.5-fold) in green. Selected genes are labelled. Plots on the right show the correlation of fold changes observed in wildtype (x-axis) or 
          <italic>Ctbp1/2 dKO</italic>
           (dKO, y-axis) cells after treatment with the respective inhibitor. Genes with significant changes in wildtype (adjP &lt; 0.05), that do not respond to the respective inhibitor in the 
          <italic>Ctbp1/2 dKO</italic>
           are termed CTBP-dependent (red). Numbers represent the number of genes. N=3 
          <bold>(D)</bold>
           Overrepresentation analysis of genes with CTBP-dependent (dep) or independent (indep) inhibitor effect by gene ontology for biological process. Colors indicate Benjamini-Hochberg-adjusted P-values, dot size the gene ratio. neg. – negative, reg. – regulation, resp. – response
          <bold> (E)</bold>
           Heatmap of genes that are CTBP1/2-dependently regulated by MTOB or 4-Cl-HIPP. Colors show the z-scaled variance-stabilized read counts. Clustering was performed by Euclidian distance. * indicate selected 4-Cl-HIPP regulated genes interblended with the MTOB target genes.
        </p>
        <p>&amp;nbsp;</p>
      </caption>
      <graphic xlink:href="25789430-2025-micropub.biology.001415"/>
    </fig>
    <sec>
      <title>Description</title>
      <p>Here we report a RNA-seq study that elucidates the specificity of two substrate competitive inhibitors of C-terminal binding proteins (CTBP) 1 and 2.</p>
      <p>CTBPs are paralogous transcriptional co-regulators that harbour a d-isomer specific 2-hydroxyacid dehydrogenase domain (D2-HDH) and their overexpression is associated with cancer (Boyd, Subramanian et al., 1993, Dcona, Morris et al., 2017, Schaeper, Boyd et al., 1995). Additionally, CTBPs are mediators of inflammation (Li, Zhang et al., 2020, Li, Zhang et al., 2022, Saijo, Collier et al., 2011, Shen, Kapfhamer et al., 2017). Therefore, inhibition of CTBP function may provide clinical tools to target malignancies or chronic inflammatory diseases.</p>
      <p>
        The D2-HDH domain of CTBPs reduces or oxidises yet unknown substrates using the co-enzyme NAD+/NADH. 4-methylthio-2-oxobutanoate (MTOB) as a substrate analogue that binds the substrate-binding pocket of CTBPs in a CTBP-specific way 
        <xref ref-type="bibr" rid="R9">(Hilbert, Grossman et al., 2014)</xref>
        , thereby antagonizing transcriptional regulation by CTBPs 
        <xref ref-type="bibr" rid="R21">(Straza, Paliwal et al., 2010)</xref>
        . Using MTOB as a lead structure, 1
        <sup>st</sup>
         generation CTBP inhibitors such 2-(hydroxyimino)-3-phenylpropanoic acid and its 2- and 4-chloro analogues were developed 
        <xref ref-type="bibr" rid="R11">(Korwar, Morris et al., 2016)</xref>
        .
      </p>
      <p>
        To test the specificity of the two CTBP inhibitors MTOB and 4-Cl-HIPP (3-(4-Chlorophenyl)-2-(hydroxyimino) propanoic acid), we generated a 
        <italic>Ctbp1/2 </italic>
        double knockout (dKO) in the macrophage cell line J774.1 (
        <bold>
          <xref ref-type="fig" rid="f1">Fig. 1A</xref>
        </bold>
        ). Wildtype and 
        <italic>Ctbp1/2 dKO</italic>
         cells were treated with either DMSO as vehicle control, 1.5 mM MTOB or 250 µM 4-Cl-HIPP for 4 h to investigate direct drug effects on transcription. The concentrations of both inhibitors were chosen in accordance with published dose response curves (Achouri, Nöel et al., 2007, Dcona, Chougoni et al., 2023, Dcona, Damle et al., 2019, Hilbert, Morris et al., 2015, Straza, Paliwal et al., 2010). RNA was collected and drug effects assessed by RNA-seq.
      </p>
      <p>
        Principal component analysis of the RNA-seq results shows a clear separation of double knockout and wildtype cells, explaining 46.8% of variance. Of the inhibitors, MTOB has the strongest influence on gene expression, driving 19.4% of gene expression variation. 4-Cl-HIPP, on the other hand effects only 3.9% of variation. Surprisingly, the inhibitor effects were observed in wildtype and 
        <italic>Ctbp1/2 dKO</italic>
         cells on this global view, indicating off-target effects of both inhibitors (
        <bold>
          <xref ref-type="fig" rid="f1">Fig. 1B</xref>
        </bold>
        ).
      </p>
      <p>
        A more detailed analysis of gene expression in response to either MTOB or 4-Cl-HIPP revealed 290 and 35 differentially expressed genes in wildtype cells, respectively (
        <bold>
          <xref ref-type="fig" rid="f1">Fig. 1C</xref>
        </bold>
        ). A comparison of inhibitor effects in wildtype to the effect in 
        <italic>Ctbp1/2 dKO</italic>
         cells showed that both inhibitors also effect gene expression even when CTBPs 1 and 2 are not expressed further confirming their off-target effects. For MTOB, 93 of the 290 regulated genes were CTBP-dependent (
        <bold>
          <xref ref-type="fig" rid="f1">Fig. 1C</xref>
        </bold>
         top right), whereas for 4-Cl-HIPP 17 of the 35 genes showed CTBP dependency (
        <bold>
          <xref ref-type="fig" rid="f1">Fig. 1C</xref>
        </bold>
         right bottom). Among the CTBP-dependent 4-Cl-HIPP effected genes “regulation of translation elongation” enriched significantly by overrepresentation analysis for gene ontologies of biological process. MTOB, on the other hand, regulates “defense response to viruses”, “innate immune response signaling” and “type I interferon signaling” (
        <bold>
          <xref ref-type="fig" rid="f1">Fig. 1D</xref>
        </bold>
        ). Those results indicate that 4-Cl-HIPP and MTOB do regulate different gene sets, even among their CTBP-dependent target genes hinting towards a different mode of action. To further elucidate the similarities or differences of both inhibitors, we specifically looked at CTBP-dependently regulated genes for both inhibitors (17 for 4-Cl-HIPP, 93 for MTOB) by blotting the z-scaled variance stabilized counts as heatmap and performed clustering analysis by Euclidian distance. Again, MTOB had the stronger effect of the two inhibitors as it contributed 93 genes to the gene set. Among the CTBP-dependent MTOB target genes we identified genes mimicking the 
        <italic>Ctbp1/2</italic>
         double knockout effect and genes that do not mimic the effect of 
        <italic>Ctbp1/2</italic>
         loss-of-function (
        <bold>
          <xref ref-type="fig" rid="f1">Fig. 1E</xref>
        </bold>
        ). The CTBP-dependent MTOB effects that are not mimicked by 
        <italic>Ctbp1/2</italic>
         loss-of-function may depend on its dehydrogenase activity or oligomerization state.
      </p>
      <p>
        In summary, the two CTBP inhibitors MTOB and 4-Cl-HIPP have distinct modes of actions of which only a subset is mimicked by 
        <italic>Ctbp1/2</italic>
         loss-of-function. More importantly, both inhibitors show effects in 
        <italic>Ctbp1/2</italic>
         double knockout cells indicative for off-target effects. We could not identify specific pathways enriched among the off-target genes, but other D2-HDH-containing dehydrogenases may potentially be targeted by those inhibitors. One potential candidate is phosphoglycerate dehydrogenase (PHGDH). Its loss was recently associated with an M2 to M1 phenotype switch in tumour-associated macrophages 
        <xref ref-type="bibr" rid="R3">(Cai, Li et al., 2024)</xref>
        .
      </p>
    </sec>
    <sec>
      <title>Methods</title>
      <p>
        <italic>Generation of Ctbp1 and 2 double knockout cells</italic>
      </p>
      <p>To assemble a functional gRNA, 2 µl Alt-R CRISPR-Cas9 tracrRNA labelled with ATTO 550 and 2 µl crRNA (IDT, 100 µM) were mixed in 20 µl duplex buffer, heated to 95°C for 5 min and slowly cooled back to room temperature within two hours. 0.7 µl annealed oligonucleotides (50 µM) were mixed with 0.5 µl Alt-R Cas9 (IDT) in 1.8 µl PBS and incubated for 20 min at room temperature to assemble RNP complexes. 500,000 cells of the cell line J774.1 were washed with PBS and resuspended in 12 µl electroporation buffer R (Thermo Fisher Scientific). 4 µl of electroporation enhancer (15 µM IDT), 8 µl of electroporation buffer R and 12 µl cell suspension were added to the assembled RNP complexes. The solution was mixed with a 10 µl electroporation tip, the filled tip was placed in the Neon electroporation device (Thermo Fisher Scientific) in 5 mL buffer E and subjected to 3x 1400 V for 10 ms each. Then cells were seeded in 6-well plates pre-filled with full growth medium. Next day, cells were suspended in FACS buffer (5 mM EDTA, 2% FBS, PBS), pipetted through a cell strainer to obtain single cell suspension and subjected to FACS (BD Aria II). To enrich for successfully transfected cells ATTO 550 positive cells were sorted in a container filled with growth medium. Cells were diluted to 2 cells/ 100 µl and 100 µl aliquots were seeded on 96-well plates for single cell outgrowth. During this time, cells were monitored closely to ensure monoclonal origin. After reaching confluence, clonal colonies were propagated and subjected to genotyping by PCR. Selected clones were confirmed as either wildtype or knockout by sequencing of PCR products and western blotting.</p>
      <p>
        <italic>Inhibitor treatment of J774.1</italic>
      </p>
      <p>
        J774.1 wildtype or
        <italic> Ctbp1/2 </italic>
        double knockout cells were seeded at 250,000 cells/ well of a 24-well plate in 1 mL full growth medium (DMEM high glucose, 10 % FBS, 1 % Penicillin/ Streptomycin) and incubated at 37 °C and 5 % CO
        <sub>2</sub>
         overnight. Next day, cells were treated with 1.5 mM MTOB (2 M in PBS, Sigma Aldrich Cat. No.: K6000), 250 µM 4-Cl-HIPP (500 mM in DMSO, gifted by W.E.Royer) or a vehicle control (PBS/ DMSO) for 4 h.
      </p>
      <p>
        <italic>Western blot</italic>
      </p>
      <p>Cells were lysed in RIPA buffer (150 mM NaCl, 50 mM Tris (pH 7.4), 1% Nonidet P-40, 0.5% sodium-deoxycholate, 0.1% sodium-dodecylsulfate). 6x Laemmli-buffer (375 mM Tris-HCl (pH 6.8), 6% SDS, 4.8 % glycerol, 9% 2-mercaptoethanol and 0.03% bromphenolblue) was added to a final concentration of 1X and protein lysates were boiled at for 10 min 95 °C. Proteins were separated by size using a 8% polyacrylamide gel in running buffer (25 mM Tris, 192 mM glycine, 0.1 % SDS) and transferred to a PVDF membrane in transfer buffer (25 mM Tris, 192 mM glycine, 20 % ethanol) using semi-dry transfer. Membranes containing protein lysates were blocked for 1 h in 5 % BSA in TBS-T (150 mM NaCl, 10 mM Tris , 0.1 % Tween-20) and incubated with primary antibody overnight at 4°C. The primary antibody was removed and membranes were washed thrice with TBS-T before incubation with HRP-coupled secondary antibodies for 1 h at room temperature. Membranes were washed again thrice with TBS-T before HRP substrate was added. Chemiluminescence was detected using the Sapphire Azure Bioscanner.</p>
      <p>
        <italic>RNA-seq</italic>
      </p>
      <p>Total RNA was extracted from treated cells using the ReliaPrep RNA Miniprep System (Promega Cat. No.:Z6012) according to the manufacturer’s instructions. The RNA quality was determined on an Agilent 2100 Bioanalyzer with the RNA 6000 Nano kit, following the manufacturer’s instructions. Library preparation and rRNA depletion were conducted using the TruSeq unstranded mRNA Library Prep kit (Illumina) starting with 1 µg of RNA for each biological triplicate. The samples were sequenced on the Illumina NovaSeq6000 with 2x100bp paired-end.</p>
      <p>
        <italic>Data analysis</italic>
      </p>
      <p>NGS data quality was assessed with FastQC (RRID: SCR 014583, http://www.bioinformatics.babraham.ac.uk/projects/fastqc/).</p>
      <p>
        Gene-level quantification was performed with Salmon version 1.9.0 (RRID: SCR_017036 
        <xref ref-type="bibr" rid="R16">(Patro, Duggal et al., 2017)</xref>
        ). Settings were: -libType A, -gcBias, -biasSpeedSamp 5 using the mm39 (M28, GRCm39) reference transcriptome provided by Gencode 
        <xref ref-type="bibr" rid="R7">(Frankish, Diekhans et al., 2021)</xref>
        . Gene count normalization and differential expression analysis were performed with DESeq2 version 1.44.0 (RRID: SCR_015687 
        <xref ref-type="bibr" rid="R14">(Love, Huber et al., 2014)</xref>
        ) after import of gene-level estimates with “tximport” version 1.32.0 (RRID: SCR_016752 
        <xref ref-type="bibr" rid="R20">(Soneson, Love et al., 2015)</xref>
        ) in R (RRID: SCR_001905, R version 4.1.1 
        <xref ref-type="bibr" rid="R23">(Team, 2018)</xref>
        ).
      </p>
      <p>
        For gene annotation, Ensembl gene IDs were mapped to symbols using the Bioconductor package “AnnotationHub” version 3.12.0 (RRID: SCR_024227 
        <xref ref-type="bibr" rid="R15">(Morgan &amp; Shepherd, 2024)</xref>
        ). Genes with expression higher than a 10
        <sup>th</sup>
         percentile, fold change of 1.5, and Benjamini-Hochberg-adjusted p value &lt; 0.05 were called significantly changed. Plots were generated with “ggplot2” version 3.5.1 (RRID: SCR_014601 
        <xref ref-type="bibr" rid="R24">(Wickham, 2016)</xref>
        ) or “pheatmap” version 1.0.12 (RRID: SCR_016418; 
        <ext-link ext-link-type="uri" xlink:href="https://github.com/raivokolde/pheatmap">https://github.com/raivokolde/pheatmap</ext-link>
        ) packages and GO enrichment performed with “clusterProfiler” version 4.12.6 (RRID: SCR 016884 
        <xref ref-type="bibr" rid="R25">(Yu, Wang et al., 2012)</xref>
        ).
      </p>
      <p>
        <italic>Data availability</italic>
      </p>
      <p>
        RNA-seq data is available at
        <bold/>
        GSE281668.
      </p>
      <p>For interactive data exploration: https://franzig.shinyapps.io/ctbpinhibitors/.</p>
    </sec>
    <sec>
      <title>Reagents</title>
      <table-wrap>
        <table>
          <tbody>
            <tr>
              <td>
                <p>
                  <bold>Target</bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>Sequence</bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>Manufacturer</bold>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>
                  <italic>Ctbp1</italic>
                </p>
              </td>
              <td>
                <p>AAGCCCGUUUCCAUUUACCA GUUUUAGAGCUAUGCU</p>
              </td>
              <td>
                <p>IDT</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>
                  <italic>Ctbp1</italic>
                </p>
              </td>
              <td>
                <p>UGAGCGGCCAGUCAAACCAG GUUUUAGAGCUAUGCU</p>
              </td>
              <td>
                <p>IDT</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>
                  <italic>Ctbp2</italic>
                </p>
              </td>
              <td>
                <p>GGGGCCGUUCAUGAUCUGG GUUUUAGAGCUAUGCU</p>
              </td>
              <td>
                <p>IDT</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>
                  <italic>Ctbp2</italic>
                </p>
              </td>
              <td>
                <p>GUUGCACCUCACCUUUACCU GUUUUAGAGCUAUGCU</p>
              </td>
              <td>
                <p>IDT</p>
              </td>
            </tr>
          </tbody>
        </table>
      </table-wrap>
      <p>Table 1. CrRNA for CRISPR clones</p>
      <table-wrap>
        <table>
          <tbody>
            <tr>
              <td>
                <p>
                  <bold>Target</bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>Cat. No.</bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>LOT</bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>RRID</bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>Manufacturer</bold>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>CTBP1</p>
              </td>
              <td>
                <p>612042</p>
              </td>
              <td>
                <p>1209713</p>
              </td>
              <td>
                <p>AB_399429</p>
              </td>
              <td>
                <p>BD Biosciences</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>CTBP2</p>
              </td>
              <td>
                <p>612044</p>
              </td>
              <td>
                <p>1327035</p>
              </td>
              <td>
                <p>AB_399431</p>
              </td>
              <td>
                <p>BD Biosciences</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>Vinculin</p>
              </td>
              <td>
                <p>13901</p>
              </td>
              <td>
                <p>7</p>
              </td>
              <td>
                <p>AB_2728768</p>
              </td>
              <td>
                <p>Cell Signaling</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>anti-mouse IgG (HRP-coupled)</p>
              </td>
              <td>
                <p>7076</p>
              </td>
              <td/>
              <td>
                <p>AB_330924</p>
              </td>
              <td>
                <p>Cell Signaling</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>anti-rabbit IgG (HRP-coupled)</p>
              </td>
              <td>
                <p>111-035-003</p>
              </td>
              <td/>
              <td>
                <p>AB_2313567</p>
              </td>
              <td>
                <p>Jackson ImmunoResearch Labs</p>
              </td>
            </tr>
          </tbody>
        </table>
      </table-wrap>
      <p>Table 2. Antibodies for Western blot</p>
      <table-wrap>
        <table>
          <tbody>
            <tr>
              <td>
                <p>
                  <bold>Name</bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>Sequence</bold>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>CTBP1_geno_F</p>
              </td>
              <td>
                <p>CCCCATTGTTTTGGGCATGG</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>CTBP1_geno_R</p>
              </td>
              <td>
                <p>ACACGCTGATGCAGAGTCAA</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>CTBP2_geno_F</p>
              </td>
              <td>
                <p>AAGGCTGTGTCCCGTCCTG</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>CTBP2_geno_R</p>
              </td>
              <td>
                <p>AGCCACTACCGATTCGCACG</p>
              </td>
            </tr>
          </tbody>
        </table>
      </table-wrap>
      <p>Table 3. Primer sequences</p>
      <table-wrap>
        <table>
          <tbody>
            <tr>
              <td>
                <p>
                  <bold>Software/package</bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>Version</bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>RRID</bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>Reference</bold>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>FastQC</p>
              </td>
              <td/>
              <td>
                <p>SCR 014583</p>
              </td>
              <td>
                <p>http://www.bioinformatics.babraham.ac.uk/projects/fastqc/</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>Salmon</p>
              </td>
              <td>
                <p>1.9.0</p>
              </td>
              <td>
                <p>SCR_017036</p>
              </td>
              <td>
                <p>
                  <xref ref-type="bibr" rid="R16">(Patro et al., 2017)</xref>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>R</p>
              </td>
              <td>
                <p>4.4.1</p>
              </td>
              <td>
                <p>SCR_001905</p>
              </td>
              <td>
                <p>
                  <xref ref-type="bibr" rid="R23">(Team, 2018)</xref>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>DESeq2</p>
              </td>
              <td>
                <p>1.44.0</p>
              </td>
              <td>
                <p>SCR_015687</p>
              </td>
              <td>
                <p>
                  <xref ref-type="bibr" rid="R14">(Love et al., 2014)</xref>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>tximport</p>
              </td>
              <td>
                <p>1.32.0</p>
              </td>
              <td>
                <p>SCR_016752</p>
              </td>
              <td>
                <p>
                  <xref ref-type="bibr" rid="R20">(Soneson et al., 2015)</xref>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>AnnotationHub</p>
              </td>
              <td>
                <p>3.12.0</p>
              </td>
              <td>
                <p>SCR_024227</p>
              </td>
              <td>
                <p>
                  <xref ref-type="bibr" rid="R15">(Morgan &amp; Shepherd, 2024)</xref>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>ggplot2</p>
              </td>
              <td>
                <p>3.5.1</p>
              </td>
              <td>
                <p>SCR_014601</p>
              </td>
              <td>
                <p>
                  <xref ref-type="bibr" rid="R24">(Wickham, 2016)</xref>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>pheatmap</p>
              </td>
              <td>
                <p>1.0.12</p>
              </td>
              <td>
                <p>SCR_016418</p>
              </td>
              <td>
                <p>
                  <ext-link ext-link-type="uri" xlink:href="https://github.com/raivokolde/pheatmap">https://github.com/raivokolde/pheatmap</ext-link>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>clusterProfiler</p>
              </td>
              <td>
                <p>4.12.6</p>
              </td>
              <td>
                <p>SCR 016884</p>
              </td>
              <td>
                <p>
                  <xref ref-type="bibr" rid="R25">(Yu et al., 2012)</xref>
                </p>
              </td>
            </tr>
          </tbody>
        </table>
      </table-wrap>
      <p>Table 4. Software</p>
    </sec>
  </body>
  <back>
    <ack>
      <sec>
        <title>Acknowledgments</title>
        <p>We would sincerely like to thank W. E. Royer Jr. (Department of Biochemistry and Molecular Pharmacology, University of Massachusetts Medical School) for providing 4-Cl-HIPP as well as A. Babl, T. Horn, K. Petzold and R. Scheundel for their assistance in this study. We acknowledge the technical support of Core Facility Genomics at Helmholtz Munich. We thank Dr. Gertrud Eckstein and Dr. Inti de la Rosa Velazquez mRNA library preparation and sequencing.</p>
        <p>Parts of Figure 1A and 1B was created in BioRender (Greulich, 2024, Strickland, 2025).</p>
      </sec>
    </ack>
    <ref-list>
      <ref id="R1">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Achouri</surname>
              <given-names>Younes</given-names>
            </name>
            <name>
              <surname>Noël</surname>
              <given-names>Gaëtane</given-names>
            </name>
            <name>
              <surname>Van Schaftingen</surname>
              <given-names>Emile</given-names>
            </name>
          </person-group>
          <year>2007</year>
          <month>1</month>
          <day>1</day>
          <article-title>2-Keto-4-methylthiobutyrate, an intermediate in the methionine salvage pathway, is a good substrate for CtBP1</article-title>
          <source>Biochemical and Biophysical Research Communications</source>
          <volume>352</volume>
          <issue>4</issue>
          <issn>0006-291X</issn>
          <fpage>903</fpage>
          <lpage>906</lpage>
          <pub-id pub-id-type="doi">10.1016/j.bbrc.2006.11.111</pub-id>
        </element-citation>
      </ref>
      <ref id="R2">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Boyd</surname>
              <given-names>J.M.</given-names>
            </name>
            <name>
              <surname>Subramanian</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Schaeper</surname>
              <given-names>U.</given-names>
            </name>
            <name>
              <surname>La Regina</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Bayley</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Chinnadurai</surname>
              <given-names>G.</given-names>
            </name>
          </person-group>
          <year>1993</year>
          <month>2</month>
          <day>1</day>
          <article-title>A region in the C-terminus of adenovirus 2/5 E1a protein is required for association with a cellular phosphoprotein and important for the negative modulation of T24-ras mediated transformation, tumorigenesis and metastasis.</article-title>
          <source>The EMBO Journal</source>
          <volume>12</volume>
          <issue>2</issue>
          <issn>0261-4189</issn>
          <fpage>469</fpage>
          <lpage>478</lpage>
          <pub-id pub-id-type="doi">10.1002/j.1460-2075.1993.tb05679.x</pub-id>
        </element-citation>
      </ref>
      <ref id="R3">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Cai</surname>
              <given-names>Zhengnan</given-names>
            </name>
            <name>
              <surname>Li</surname>
              <given-names>Wan</given-names>
            </name>
            <name>
              <surname>Hager</surname>
              <given-names>Sonja</given-names>
            </name>
            <name>
              <surname>Wilson</surname>
              <given-names>Jayne Louise</given-names>
            </name>
            <name>
              <surname>Afjehi-Sadat</surname>
              <given-names>Leila</given-names>
            </name>
            <name>
              <surname>Heiss</surname>
              <given-names>Elke H.</given-names>
            </name>
            <name>
              <surname>Weichhart</surname>
              <given-names>Thomas</given-names>
            </name>
            <name>
              <surname>Heffeter</surname>
              <given-names>Petra</given-names>
            </name>
            <name>
              <surname>Weckwerth</surname>
              <given-names>Wolfram</given-names>
            </name>
          </person-group>
          <year>2024</year>
          <month>2</month>
          <day>27</day>
          <article-title>Targeting PHGDH reverses the immunosuppressive phenotype of tumor-associated macrophages through α-ketoglutarate and mTORC1 signaling</article-title>
          <source>Cellular &amp; Molecular Immunology</source>
          <volume>21</volume>
          <issue>5</issue>
          <issn>2042-0226</issn>
          <fpage>448</fpage>
          <lpage>465</lpage>
          <pub-id pub-id-type="doi">10.1038/s41423-024-01134-0</pub-id>
        </element-citation>
      </ref>
      <ref id="R4">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Dcona</surname>
              <given-names>M. Michael</given-names>
            </name>
            <name>
              <surname>Chougoni</surname>
              <given-names>Kranthi Kumar</given-names>
            </name>
            <name>
              <surname>Dcona</surname>
              <given-names>Diana T.</given-names>
            </name>
            <name>
              <surname>West</surname>
              <given-names>Jacqueline L.</given-names>
            </name>
            <name>
              <surname>Singh</surname>
              <given-names>Sahib J.</given-names>
            </name>
            <name>
              <surname>Ellis</surname>
              <given-names>Keith C.</given-names>
            </name>
            <name>
              <surname>Grossman</surname>
              <given-names>Steven R.</given-names>
            </name>
          </person-group>
          <year>2023</year>
          <month>10</month>
          <day>4</day>
          <article-title>Combined Targeting of NAD Biosynthesis and the NAD-dependent Transcription Factor C-terminal Binding Protein as a Promising Novel Therapy for Pancreatic Cancer</article-title>
          <source>Cancer Research Communications</source>
          <volume>3</volume>
          <issue>10</issue>
          <issn>2767-9764</issn>
          <fpage>2003</fpage>
          <lpage>2013</lpage>
          <pub-id pub-id-type="doi">10.1158/2767-9764.crc-22-0521</pub-id>
        </element-citation>
      </ref>
      <ref id="R5">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Dcona</surname>
              <given-names>M. Michael</given-names>
            </name>
            <name>
              <surname>Damle</surname>
              <given-names>Priyadarshan K.</given-names>
            </name>
            <name>
              <surname>Zarate-Perez</surname>
              <given-names>Francisco</given-names>
            </name>
            <name>
              <surname>Morris</surname>
              <given-names>Benjamin L.</given-names>
            </name>
            <name>
              <surname>Nawaz</surname>
              <given-names>Zaid</given-names>
            </name>
            <name>
              <surname>Dennis</surname>
              <given-names>Michael J.</given-names>
            </name>
            <name>
              <surname>Deng</surname>
              <given-names>Xiaoyan</given-names>
            </name>
            <name>
              <surname>Korwar</surname>
              <given-names>Sudha</given-names>
            </name>
            <name>
              <surname>Singh</surname>
              <given-names>Sahib J.</given-names>
            </name>
            <name>
              <surname>Ellis</surname>
              <given-names>Keith C.</given-names>
            </name>
            <name>
              <surname>Royer</surname>
              <given-names>William E.</given-names>
            </name>
            <name>
              <surname>Bandyopadhyay</surname>
              <given-names>Dipankar</given-names>
            </name>
            <name>
              <surname>Escalante</surname>
              <given-names>Carlos</given-names>
            </name>
            <name>
              <surname>Grossman</surname>
              <given-names>Steven R.</given-names>
            </name>
          </person-group>
          <year>2019</year>
          <month>7</month>
          <day>1</day>
          <article-title>Active-Site Tryptophan, the Target of Antineoplastic C-Terminal Binding Protein Inhibitors, Mediates Inhibitor Disruption of CtBP Oligomerization and Transcription Coregulatory Activities</article-title>
          <source>Molecular Pharmacology</source>
          <volume>96</volume>
          <issue>1</issue>
          <issn>0026-895X</issn>
          <fpage>99</fpage>
          <lpage>108</lpage>
          <pub-id pub-id-type="doi">10.1124/mol.118.114363</pub-id>
        </element-citation>
      </ref>
      <ref id="R6">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Dcona</surname>
              <given-names>M. Michael</given-names>
            </name>
            <name>
              <surname>Morris</surname>
              <given-names>Benjamin L.</given-names>
            </name>
            <name>
              <surname>Ellis</surname>
              <given-names>Keith C.</given-names>
            </name>
            <name>
              <surname>Grossman</surname>
              <given-names>Steven R.</given-names>
            </name>
          </person-group>
          <year>2017</year>
          <month>5</month>
          <day>22</day>
          <article-title>CtBP- an emerging oncogene and novel small molecule drug target: Advances in the understanding of its oncogenic action and identification of therapeutic inhibitors</article-title>
          <source>Cancer Biology &amp; Therapy</source>
          <volume>18</volume>
          <issue>6</issue>
          <issn>1538-4047</issn>
          <fpage>379</fpage>
          <lpage>391</lpage>
          <pub-id pub-id-type="doi">10.1080/15384047.2017.1323586</pub-id>
        </element-citation>
      </ref>
      <ref id="R7">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Frankish</surname>
              <given-names>Adam</given-names>
            </name>
            <name>
              <surname>Diekhans</surname>
              <given-names>Mark</given-names>
            </name>
            <name>
              <surname>Jungreis</surname>
              <given-names>Irwin</given-names>
            </name>
            <name>
              <surname>Lagarde</surname>
              <given-names>Julien</given-names>
            </name>
            <name>
              <surname>Loveland</surname>
              <given-names>Jane E</given-names>
            </name>
            <name>
              <surname>Mudge</surname>
              <given-names>Jonathan M</given-names>
            </name>
            <name>
              <surname>Sisu</surname>
              <given-names>Cristina</given-names>
            </name>
            <name>
              <surname>Wright</surname>
              <given-names>James C</given-names>
            </name>
            <name>
              <surname>Armstrong</surname>
              <given-names>Joel</given-names>
            </name>
            <name>
              <surname>Barnes</surname>
              <given-names>If</given-names>
            </name>
            <name>
              <surname>Berry</surname>
              <given-names>Andrew</given-names>
            </name>
            <name>
              <surname>Bignell</surname>
              <given-names>Alexandra</given-names>
            </name>
            <name>
              <surname>Boix</surname>
              <given-names>Carles</given-names>
            </name>
            <name>
              <surname>Carbonell Sala</surname>
              <given-names>Silvia</given-names>
            </name>
            <name>
              <surname>Cunningham</surname>
              <given-names>Fiona</given-names>
            </name>
            <name>
              <surname>Di Domenico</surname>
              <given-names>Tomás</given-names>
            </name>
            <name>
              <surname>Donaldson</surname>
              <given-names>Sarah</given-names>
            </name>
            <name>
              <surname>Fiddes</surname>
              <given-names>Ian T</given-names>
            </name>
            <name>
              <surname>García Girón</surname>
              <given-names>Carlos</given-names>
            </name>
            <name>
              <surname>Gonzalez</surname>
              <given-names>Jose Manuel</given-names>
            </name>
            <name>
              <surname>Grego</surname>
              <given-names>Tiago</given-names>
            </name>
            <name>
              <surname>Hardy</surname>
              <given-names>Matthew</given-names>
            </name>
            <name>
              <surname>Hourlier</surname>
              <given-names>Thibaut</given-names>
            </name>
            <name>
              <surname>Howe</surname>
              <given-names>Kevin L</given-names>
            </name>
            <name>
              <surname>Hunt</surname>
              <given-names>Toby</given-names>
            </name>
            <name>
              <surname>Izuogu</surname>
              <given-names>Osagie G</given-names>
            </name>
            <name>
              <surname>Johnson</surname>
              <given-names>Rory</given-names>
            </name>
            <name>
              <surname>Martin</surname>
              <given-names>Fergal J</given-names>
            </name>
            <name>
              <surname>Martínez</surname>
              <given-names>Laura</given-names>
            </name>
            <name>
              <surname>Mohanan</surname>
              <given-names>Shamika</given-names>
            </name>
            <name>
              <surname>Muir</surname>
              <given-names>Paul</given-names>
            </name>
            <name>
              <surname>Navarro</surname>
              <given-names>Fabio C P</given-names>
            </name>
            <name>
              <surname>Parker</surname>
              <given-names>Anne</given-names>
            </name>
            <name>
              <surname>Pei</surname>
              <given-names>Baikang</given-names>
            </name>
            <name>
              <surname>Pozo</surname>
              <given-names>Fernando</given-names>
            </name>
            <name>
              <surname>Riera</surname>
              <given-names>Ferriol Calvet</given-names>
            </name>
            <name>
              <surname>Ruffier</surname>
              <given-names>Magali</given-names>
            </name>
            <name>
              <surname>Schmitt</surname>
              <given-names>Bianca M</given-names>
            </name>
            <name>
              <surname>Stapleton</surname>
              <given-names>Eloise</given-names>
            </name>
            <name>
              <surname>Suner</surname>
              <given-names>Marie-Marthe</given-names>
            </name>
            <name>
              <surname>Sycheva</surname>
              <given-names>Irina</given-names>
            </name>
            <name>
              <surname>Uszczynska-Ratajczak</surname>
              <given-names>Barbara</given-names>
            </name>
            <name>
              <surname>Wolf</surname>
              <given-names>Maxim Y</given-names>
            </name>
            <name>
              <surname>Xu</surname>
              <given-names>Jinuri</given-names>
            </name>
            <name>
              <surname>Yang</surname>
              <given-names>Yucheng T</given-names>
            </name>
            <name>
              <surname>Yates</surname>
              <given-names>Andrew</given-names>
            </name>
            <name>
              <surname>Zerbino</surname>
              <given-names>Daniel</given-names>
            </name>
            <name>
              <surname>Zhang</surname>
              <given-names>Yan</given-names>
            </name>
            <name>
              <surname>Choudhary</surname>
              <given-names>Jyoti S</given-names>
            </name>
            <name>
              <surname>Gerstein</surname>
              <given-names>Mark</given-names>
            </name>
            <name>
              <surname>Guigó</surname>
              <given-names>Roderic</given-names>
            </name>
            <name>
              <surname>Hubbard</surname>
              <given-names>Tim J P</given-names>
            </name>
            <name>
              <surname>Kellis</surname>
              <given-names>Manolis</given-names>
            </name>
            <name>
              <surname>Paten</surname>
              <given-names>Benedict</given-names>
            </name>
            <name>
              <surname>Tress</surname>
              <given-names>Michael L</given-names>
            </name>
            <name>
              <surname>Flicek</surname>
              <given-names>Paul</given-names>
            </name>
          </person-group>
          <year>2020</year>
          <month>12</month>
          <day>3</day>
          <article-title>GENCODE 2021</article-title>
          <source>Nucleic Acids Research</source>
          <volume>49</volume>
          <issue>D1</issue>
          <issn>0305-1048</issn>
          <fpage>D916</fpage>
          <lpage>D923</lpage>
          <pub-id pub-id-type="doi">10.1093/nar/gkaa1087</pub-id>
        </element-citation>
      </ref>
      <ref id="R8">
        <mixed-citation>Greulich, F. (2024) https://BioRender.com/f39h675</mixed-citation>
      </ref>
      <ref id="R9">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Hilbert</surname>
              <given-names>Brendan J.</given-names>
            </name>
            <name>
              <surname>Grossman</surname>
              <given-names>Steven R.</given-names>
            </name>
            <name>
              <surname>Schiffer</surname>
              <given-names>Celia A.</given-names>
            </name>
            <name>
              <surname>Royer</surname>
              <given-names>William E.</given-names>
            </name>
          </person-group>
          <year>2014</year>
          <month>3</month>
          <day>19</day>
          <article-title>Crystal structures of human CtBP in complex with substrate MTOB reveal active site features useful for inhibitor design</article-title>
          <source>FEBS Letters</source>
          <volume>588</volume>
          <issue>9</issue>
          <issn>0014-5793</issn>
          <fpage>1743</fpage>
          <lpage>1748</lpage>
          <pub-id pub-id-type="doi">10.1016/j.febslet.2014.03.026</pub-id>
        </element-citation>
      </ref>
      <ref id="R10">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Hilbert</surname>
              <given-names>Brendan J.</given-names>
            </name>
            <name>
              <surname>Morris</surname>
              <given-names>Benjamin L.</given-names>
            </name>
            <name>
              <surname>Ellis</surname>
              <given-names>Keith C.</given-names>
            </name>
            <name>
              <surname>Paulsen</surname>
              <given-names>Janet L.</given-names>
            </name>
            <name>
              <surname>Schiffer</surname>
              <given-names>Celia A.</given-names>
            </name>
            <name>
              <surname>Grossman</surname>
              <given-names>Steven R.</given-names>
            </name>
            <name>
              <surname>Royer</surname>
              <given-names>William E.</given-names>
            </name>
          </person-group>
          <year>2015</year>
          <month>1</month>
          <day>30</day>
          <article-title>Structure-Guided Design of a High Affinity Inhibitor to Human CtBP</article-title>
          <source>ACS Chemical Biology</source>
          <volume>10</volume>
          <issue>4</issue>
          <issn>1554-8929</issn>
          <fpage>1118</fpage>
          <lpage>1127</lpage>
          <pub-id pub-id-type="doi">10.1021/cb500820b</pub-id>
        </element-citation>
      </ref>
      <ref id="R11">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Korwar</surname>
              <given-names>Sudha</given-names>
            </name>
            <name>
              <surname>Morris</surname>
              <given-names>Benjamin L.</given-names>
            </name>
            <name>
              <surname>Parikh</surname>
              <given-names>Hardik I.</given-names>
            </name>
            <name>
              <surname>Coover</surname>
              <given-names>Robert A.</given-names>
            </name>
            <name>
              <surname>Doughty</surname>
              <given-names>Tyler W.</given-names>
            </name>
            <name>
              <surname>Love</surname>
              <given-names>Ian M.</given-names>
            </name>
            <name>
              <surname>Hilbert</surname>
              <given-names>Brendan J.</given-names>
            </name>
            <name>
              <surname>Royer</surname>
              <given-names>William E.</given-names>
            </name>
            <name>
              <surname>Kellogg</surname>
              <given-names>Glen E.</given-names>
            </name>
            <name>
              <surname>Grossman</surname>
              <given-names>Steven R.</given-names>
            </name>
            <name>
              <surname>Ellis</surname>
              <given-names>Keith C.</given-names>
            </name>
          </person-group>
          <year>2016</year>
          <month>6</month>
          <day>1</day>
          <article-title>Design, synthesis, and biological evaluation of substrate-competitive inhibitors of C-terminal Binding Protein (CtBP)</article-title>
          <source>Bioorganic &amp; Medicinal Chemistry</source>
          <volume>24</volume>
          <issue>12</issue>
          <issn>0968-0896</issn>
          <fpage>2707</fpage>
          <lpage>2715</lpage>
          <pub-id pub-id-type="doi">10.1016/j.bmc.2016.04.037</pub-id>
        </element-citation>
      </ref>
      <ref id="R12">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Li</surname>
              <given-names>Hong</given-names>
            </name>
            <name>
              <surname>Zhang</surname>
              <given-names>Caiguo</given-names>
            </name>
            <name>
              <surname>Bian</surname>
              <given-names>Li</given-names>
            </name>
            <name>
              <surname>Deng</surname>
              <given-names>Hui</given-names>
            </name>
            <name>
              <surname>Blevins</surname>
              <given-names>Melanie</given-names>
            </name>
            <name>
              <surname>Han</surname>
              <given-names>Gangwen</given-names>
            </name>
            <name>
              <surname>Fan</surname>
              <given-names>Bin</given-names>
            </name>
            <name>
              <surname>Yang</surname>
              <given-names>Chunxia</given-names>
            </name>
            <name>
              <surname>Zhao</surname>
              <given-names>Rui</given-names>
            </name>
            <name>
              <surname>High</surname>
              <given-names>Whitney</given-names>
            </name>
            <name>
              <surname>Norris</surname>
              <given-names>David</given-names>
            </name>
            <name>
              <surname>Fujita</surname>
              <given-names>Mayumi</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>Xiao-Jing</given-names>
            </name>
            <name>
              <surname>Huang</surname>
              <given-names>Mingxia</given-names>
            </name>
          </person-group>
          <year>2022</year>
          <month>2</month>
          <day>1</day>
          <article-title>Inhibition of CtBP-Regulated Proinflammatory Gene Transcription Attenuates Psoriatic Skin Inflammation</article-title>
          <source>Journal of Investigative Dermatology</source>
          <volume>142</volume>
          <issue>2</issue>
          <issn>0022-202X</issn>
          <fpage>390</fpage>
          <lpage>401</lpage>
          <pub-id pub-id-type="doi">10.1016/j.jid.2021.06.029</pub-id>
        </element-citation>
      </ref>
      <ref id="R13">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Li</surname>
              <given-names>Hong</given-names>
            </name>
            <name>
              <surname>Zhang</surname>
              <given-names>Caiguo</given-names>
            </name>
            <name>
              <surname>Yang</surname>
              <given-names>Chunxia</given-names>
            </name>
            <name>
              <surname>Blevins</surname>
              <given-names>Melanie</given-names>
            </name>
            <name>
              <surname>Norris</surname>
              <given-names>David</given-names>
            </name>
            <name>
              <surname>Zhao</surname>
              <given-names>Rui</given-names>
            </name>
            <name>
              <surname>Huang</surname>
              <given-names>Mingxia</given-names>
            </name>
          </person-group>
          <year>2020</year>
          <article-title>C-terminal binding proteins 1 and 2 in traumatic brain injury-induced inflammation and their inhibition as an approach for anti-inflammatory treatment</article-title>
          <source>International Journal of Biological Sciences</source>
          <volume>16</volume>
          <issue>7</issue>
          <issn>1449-2288</issn>
          <fpage>1107</fpage>
          <lpage>1120</lpage>
          <pub-id pub-id-type="doi">10.7150/ijbs.42109</pub-id>
        </element-citation>
      </ref>
      <ref id="R14">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Love</surname>
              <given-names>Michael I</given-names>
            </name>
            <name>
              <surname>Huber</surname>
              <given-names>Wolfgang</given-names>
            </name>
            <name>
              <surname>Anders</surname>
              <given-names>Simon</given-names>
            </name>
          </person-group>
          <year>2014</year>
          <month>12</month>
          <day>1</day>
          <article-title>Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2</article-title>
          <source>Genome Biology</source>
          <volume>15</volume>
          <issue>12</issue>
          <issn>1474-760X</issn>
          <pub-id pub-id-type="doi">10.1186/s13059-014-0550-8</pub-id>
        </element-citation>
      </ref>
      <ref id="R15">
        <mixed-citation>Morgan M, Shepherd L (2024) AnnotationHub: Client to access AnnotationHub resources. R package version 3.14.0. https://bioconductor.org/packages/release/bioc/html/AnnotationHub.html</mixed-citation>
      </ref>
      <ref id="R16">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Patro</surname>
              <given-names>Rob</given-names>
            </name>
            <name>
              <surname>Duggal</surname>
              <given-names>Geet</given-names>
            </name>
            <name>
              <surname>Love</surname>
              <given-names>Michael I</given-names>
            </name>
            <name>
              <surname>Irizarry</surname>
              <given-names>Rafael A</given-names>
            </name>
            <name>
              <surname>Kingsford</surname>
              <given-names>Carl</given-names>
            </name>
          </person-group>
          <year>2017</year>
          <month>3</month>
          <day>6</day>
          <article-title>Salmon provides fast and bias-aware quantification of transcript expression</article-title>
          <source>Nature Methods</source>
          <volume>14</volume>
          <issue>4</issue>
          <issn>1548-7091</issn>
          <fpage>417</fpage>
          <lpage>419</lpage>
          <pub-id pub-id-type="doi">10.1038/nmeth.4197</pub-id>
        </element-citation>
      </ref>
      <ref id="R17">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Saijo</surname>
              <given-names>Kaoru</given-names>
            </name>
            <name>
              <surname>Collier</surname>
              <given-names>Jana G.</given-names>
            </name>
            <name>
              <surname>Li</surname>
              <given-names>Andrew C.</given-names>
            </name>
            <name>
              <surname>Katzenellenbogen</surname>
              <given-names>John A.</given-names>
            </name>
            <name>
              <surname>Glass</surname>
              <given-names>Christopher K.</given-names>
            </name>
          </person-group>
          <year>2011</year>
          <month>5</month>
          <day>1</day>
          <article-title>An ADIOL-ERβ-CtBP Transrepression Pathway Negatively Regulates Microglia-Mediated Inflammation</article-title>
          <source>Cell</source>
          <volume>145</volume>
          <issue>4</issue>
          <issn>0092-8674</issn>
          <fpage>584</fpage>
          <lpage>595</lpage>
          <pub-id pub-id-type="doi">10.1016/j.cell.2011.03.050</pub-id>
        </element-citation>
      </ref>
      <ref id="R18">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Schaeper</surname>
              <given-names>U</given-names>
            </name>
            <name>
              <surname>Boyd</surname>
              <given-names>J M</given-names>
            </name>
            <name>
              <surname>Verma</surname>
              <given-names>S</given-names>
            </name>
            <name>
              <surname>Uhlmann</surname>
              <given-names>E</given-names>
            </name>
            <name>
              <surname>Subramanian</surname>
              <given-names>T</given-names>
            </name>
            <name>
              <surname>Chinnadurai</surname>
              <given-names>G</given-names>
            </name>
          </person-group>
          <year>1995</year>
          <month>11</month>
          <day>7</day>
          <article-title>Molecular cloning and characterization of a cellular phosphoprotein that interacts with a conserved C-terminal domain of adenovirus E1A involved in negative modulation of oncogenic transformation.</article-title>
          <source>Proceedings of the National Academy of Sciences</source>
          <volume>92</volume>
          <issue>23</issue>
          <issn>0027-8424</issn>
          <fpage>10467</fpage>
          <lpage>10471</lpage>
          <pub-id pub-id-type="doi">10.1073/pnas.92.23.10467</pub-id>
        </element-citation>
      </ref>
      <ref id="R19">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Shen</surname>
              <given-names>Yiguo</given-names>
            </name>
            <name>
              <surname>Kapfhamer</surname>
              <given-names>David</given-names>
            </name>
            <name>
              <surname>Minnella</surname>
              <given-names>Angela M.</given-names>
            </name>
            <name>
              <surname>Kim</surname>
              <given-names>Ji-Eun</given-names>
            </name>
            <name>
              <surname>Won</surname>
              <given-names>Seok Joon</given-names>
            </name>
            <name>
              <surname>Chen</surname>
              <given-names>Yanting</given-names>
            </name>
            <name>
              <surname>Huang</surname>
              <given-names>Yong</given-names>
            </name>
            <name>
              <surname>Low</surname>
              <given-names>Ley Hian</given-names>
            </name>
            <name>
              <surname>Massa</surname>
              <given-names>Stephen M.</given-names>
            </name>
            <name>
              <surname>Swanson</surname>
              <given-names>Raymond A.</given-names>
            </name>
          </person-group>
          <year>2017</year>
          <month>9</month>
          <day>22</day>
          <article-title>Bioenergetic state regulates innate inflammatory responses through the transcriptional co-repressor CtBP</article-title>
          <source>Nature Communications</source>
          <volume>8</volume>
          <issue>1</issue>
          <issn>2041-1723</issn>
          <pub-id pub-id-type="doi">10.1038/s41467-017-00707-0</pub-id>
        </element-citation>
      </ref>
      <ref id="R20">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Soneson</surname>
              <given-names>Charlotte</given-names>
            </name>
            <name>
              <surname>Love</surname>
              <given-names>Michael I.</given-names>
            </name>
            <name>
              <surname>Robinson</surname>
              <given-names>Mark D.</given-names>
            </name>
          </person-group>
          <year>2016</year>
          <month>2</month>
          <day>29</day>
          <article-title>Differential analyses for RNA-seq: transcript-level estimates improve gene-level inferences</article-title>
          <source>F1000Research</source>
          <volume>4</volume>
          <issn>2046-1402</issn>
          <fpage>1521</fpage>
          <lpage>1521</lpage>
          <pub-id pub-id-type="doi">10.12688/f1000research.7563.2</pub-id>
        </element-citation>
      </ref>
      <ref id="R21">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Straza</surname>
              <given-names>Michael W.</given-names>
            </name>
            <name>
              <surname>Paliwal</surname>
              <given-names>Seema</given-names>
            </name>
            <name>
              <surname>Kovi</surname>
              <given-names>Ramesh C.</given-names>
            </name>
            <name>
              <surname>Rajeshkumar</surname>
              <given-names>Barur</given-names>
            </name>
            <name>
              <surname>Trenh</surname>
              <given-names>Peter</given-names>
            </name>
            <name>
              <surname>Parker</surname>
              <given-names>Daniel</given-names>
            </name>
            <name>
              <surname>Whalen</surname>
              <given-names>Giles F.</given-names>
            </name>
            <name>
              <surname>Lyle</surname>
              <given-names>Stephen</given-names>
            </name>
            <name>
              <surname>Schiffer</surname>
              <given-names>Celia A.</given-names>
            </name>
            <name>
              <surname>Grossman</surname>
              <given-names>Steven R.</given-names>
            </name>
          </person-group>
          <year>2010</year>
          <month>9</month>
          <day>15</day>
          <article-title>Therapeutic targeting of C-terminal binding protein in human cancer</article-title>
          <source>Cell Cycle</source>
          <volume>9</volume>
          <issue>18</issue>
          <issn>1538-4101</issn>
          <fpage>3764</fpage>
          <lpage>3774</lpage>
          <pub-id pub-id-type="doi">10.4161/cc.9.18.12936</pub-id>
        </element-citation>
      </ref>
      <ref id="R22">
        <mixed-citation>Strickland, B. (2025) https://BioRender.com/k11a387</mixed-citation>
      </ref>
      <ref id="R23">
        <mixed-citation>Team RC (2018) R: A language and environment for statistical computing.</mixed-citation>
      </ref>
      <ref id="R24">
        <mixed-citation>
          Wickham H (2016) 
          <italic>Elegant Graphics for Data Analysis</italic>
          . Springer-Verlag New York.
        </mixed-citation>
      </ref>
      <ref id="R25">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Yu</surname>
              <given-names>Guangchuang</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>Li-Gen</given-names>
            </name>
            <name>
              <surname>Han</surname>
              <given-names>Yanyan</given-names>
            </name>
            <name>
              <surname>He</surname>
              <given-names>Qing-Yu</given-names>
            </name>
          </person-group>
          <year>2012</year>
          <month>5</month>
          <day>1</day>
          <article-title>clusterProfiler: an R Package for Comparing Biological Themes Among Gene Clusters</article-title>
          <source>OMICS: A Journal of Integrative Biology</source>
          <volume>16</volume>
          <issue>5</issue>
          <issn>1536-2310</issn>
          <fpage>284</fpage>
          <lpage>287</lpage>
          <pub-id pub-id-type="doi">10.1089/omi.2011.0118</pub-id>
        </element-citation>
      </ref>
    </ref-list>
  </back>
</article>