Mutations in the gene encoding spastin, a cytoskeleton-associated protein, cause hereditary spastic paraplegia (Liu et al., 2021) . This condition is associated with the degeneration of corticospinal axons due to the breakdown of membrane compartments and the cytoskeletal network (Liu et al., 2021) . C. elegans have a spastin homolog called SPAS-1 (Frohlich, 2001, Matsushita-Ishiodori et al., 2007), which, like spastin, displays an ATP-dependent microtubule severing function (Errico et al., 2007, Salinas et al., 2005, Matsushita-Ishiodori et al., 2007) . In C. elegans the regulation of microtubules by SPAS-1 is important for synapse remodeling (Kurup et al., 2015) , but SPAS-1 is expressed in tissues other than neurons, such as the intestine (Brown and Bejjani, 2017) . In order to facilitate studies in C. elegans that explore the regulation of spastin/ SPAS-1 and its specific role in neurons, we set out to create a worm strain in which the endogenous SPAS-1 protein is visible and able to be degraded with spatial and temporal precision. To do so, we used CRISPR/Cas9 gene editing in conjunction with auxin-inducible degradation (AID). AID relies on the co-expression of the E3 ubiquitin ligase TIR1 in desired cells (spatial control) and the administration of exogenous auxin (temporal control) to provide rapid degradation of a protein of interest (Nishimura et al., 2009, Ashley et al., 2021) .

To avoid interfering with the microtubule-severing C-terminus of SPAS-1 (Onitake et al., 2012) , we elected to target the N-terminus for our CRISPR edit, utilizing the PAM site at the spas-1 start codon ( Fig. 1A ). We injected Cas9 ribonucleoproteins and a repair template consisting of mScarlet::AID::3xFLAG::linker ( Fig. 1B ) (Ashley et al., 2021) into DV3805 worms that express the necessary AID enzyme TIR1 specifically in neurons (Ashley et al., 2021) . After microinjection, we performed PCR with two sets of primers to distinguish between CRISPR-edited and unedited offspring: Primers 1 and 3 were used to produce a 720 bp amplicon in the unedited spas-1 locus. Since Primer 2 binds to the FLAG::linker sequence of our repair template, it was used in conjunction with Primer 3 to produce a 388 bp amplicon that confirms the presence of our insertion ( Fig. 1B ). Lysis and PCR of F3 worms revealed plates that did not yield the 720 bp unedited amplicon ( Fig. 1C top) but did yield an amplicon with the edit-specific primer ( Fig. 1C bottom), suggesting that they were homozygous for the CRISPR edit. Subsequent PCR of homozygous knock-in animals with Primers 1 and 3 using a longer extension time revealed the expected ~1.9 kb knock-in specific band. To confirm that our edit was in frame with spas-1 , we sequenced the junctions between our repair template and the genomic locus. Sequencing revealed an in-frame alignment of the tag with genomic spas-1 ( Fig. 1D ), suggesting that our edited worms should produce mScarlet::AID::SPAS-1, and fluorescence microscopy confirmed that the mScarlet tag was functional ( Fig. 1E ). We were able to detect mScarlet::AID::SPAS-1 fluorescence throughout L4 animals including in the gonad and vulva ( Fig. 1F ).

To validate our strain, we compared fluorescence levels in worms treated with and without auxin, focusing on a region in the tail where the fluorescence of neuronal ganglia is easily observed ( Fig. 1G ). Auxin treatment resulted in a statistically significant reduction in mScarlet fluorescence in this region ( Fig. 1H ) while other fluorescence is still visible, suggesting that we can precisely degrade endogenous SPAS-1 in neurons. This new strain can be used to identify and characterize regulators of the expression, localization, dynamics, and degradation of endogenous SPAS-1 . It can also be used to precisely assess the role of neuronal SPAS-1 across different developmental stages or crossed with other TIR1 transgenes to degrade SPAS-1 in other tissues.

C. elegans strains were housed at 20 ̊C and maintained according to standard procedures (Brenner 1974) . mScarlet::AID*::3xFLAG::linker was amplified from pJW2098 (a gift from Jordan Ward [Addgene plasmid # 163094]) (Ashley et al., 2021) using 5' SP9 modified-primers with and, separately, without 35 nt homology arms flanking the insertion site at the spas-1 genomic locus. Melting and reannealing a mixture of repair templates with and without homology arms produces mixed strands with asymmetric, single stranded homology arms that are better able to be incorporated via homology-directed insertion (Dokshin et al. 2018) . Primers were as follows with homology arms in parentheses, FWD: (aattgttttccaattgtattaaattttcagttcca)ATGGTCTCCAAGGGAGAGGC, REV: (GTTGAGCTGCCGGCGGGACCTTTTGAAAAGGCGAATCC)gcctccggacgatgctcctg. Amplified template was purified using Mag-Bind TotalPure NGS magnetic beads (Omega Biotek) as described (Ghanta et al., 2021) . Cas9/gRNA ribonucleoprotein complexes (RNPs) containing the universal Alt-R CRISPR-Cas9 tracrRNA (IDT), custom Alt-R CRISPR-Cas9 crRNA (locus-specific sequence CCUUUUGAAAAGGCGAACAU) (IDT), and S. pyogenes Cas9-NLS protein (QB3 MacroLab) were assembled as described by Ghanta et al. (2021). Purified repair template was melted according to Ghanta and Mello (2020) and combined with assembled RNPs, pRF4 ( rol-6 ( su1006 )) injection marker (Addgene 92364) at a final concentration of 40 ng/μl (Mello et al., 1991) , and nuclease free water to form a 20 μl injection mix. Adult DV3805 worms (Ashley et al., 2021) were injected and F1 offspring selected as described (Ghanta et al., 2021) . Auxin treatment was performed for 24 hours on nematode growth medium plates with 4 mM synthetic auxin (1-naphthaleneacetic acid) (Sigma 317918) as described (Martinez et al., 2020) .

For fluorescence microscopy, worms were anesthetized in 30 mg/ml 2,3-Butanedione monoxime (Sigma B0753) in M9 buffer (KH ₂ PO ₄ , 22.0 mM; Na ₂ HPO ₄ , 42.3 mM; NaCl, 85.6 mM autoclaved, plus 1 mM sterile MgSO ₄ ) and mounted on 2% agarose pads. Worms were imaged with a 63x objective on an Axio Observer (Carl Zeiss) microscope equipped with an Orca-4 camera (Hamamatsu) and illuminated with a Colibri 7 LED. For autofluorescence images, worms were exposed for 150 ms with 80% LED intensity and 450-490 nm excitation, 500-550 nm emission filters. For mScarlet images, worms were exposed for 1 s with 80% LED intensity and 574-599 nm excitation, 612-682 nm emission filters. Tail fluorescence quantification was performed using FIJI (Schindelin et al., 2012) . A 20 x 30 μm region of interest (ROI) was drawn around the tail ganglia with the edge of the rectum placed in the lower corner. To subtract the background fluorescence, automatic thresholding was applied using the Minimum setting. The average minimum ROI fluorescence in the box (background fluorescence) was used as a floor for the X axis in the resulting graph of mean ROI fluorescence. Statistical analysis was performed using GraphPad Prism version 10.