<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/archiving/1.2/JATS-archivearticle1.dtd">
<article article-type="brief-report" xmlns:xlink="http://www.w3.org/1999/xlink">
  <front>
    <journal-meta>
      <journal-title-group>
        <journal-title>microPublication Biology</journal-title>
      </journal-title-group>
      <issn pub-type="epub">2578-9430</issn>
      <publisher>
        <publisher-name>Caltech Library</publisher-name>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="doi">10.17912/micropub.biology.001275</article-id>
      <article-categories>
        <subj-group subj-group-type="heading">
          <subject>replication successful</subject>
        </subj-group>
        <subj-group subj-group-type="heading">
          <subject>replication unsuccessful</subject>
        </subj-group>
        <subj-group subj-group-type="heading">
          <subject>materials and reagents</subject>
        </subj-group>
        <subj-group subj-group-type="subject">
          <subject>methods</subject>
        </subj-group>
        <subj-group subj-group-type="subject">
          <subject>ecology and evolution</subject>
        </subj-group>
        <subj-group subj-group-type="species">
          <subject>fungi</subject>
        </subj-group>
        <subj-group subj-group-type="species">
          <subject>other</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>Developing robust quantitative PCR primers for comparative biomass analysis of Tall Fescue (Festuca arundinacea) and its Epichloë endophyte</article-title>
      </title-group>
      <contrib-group>
        <contrib contrib-type="author">
          <name>
            <surname>Talamantes</surname>
            <given-names>Darrian</given-names>
          </name>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing - original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft">Writing - original draft</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing - review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing-review-editing">Writing - review &amp; editing</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation">Investigation</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Conceptualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/onceptualization">Conceptualization</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation">Data curation</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Formal analysis" vocab-term-identifier="https://credit.niso.org/contributor-roles/formal-analysis">Formal analysis</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Methodology" vocab-term-identifier="https://credit.niso.org/contributor-roles/methodology">Methodology</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Visualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/visualization">Visualization</role>
          <xref ref-type="aff" rid="aff1">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Kirkpatrick</surname>
            <given-names>Caitlin</given-names>
          </name>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation">Investigation</role>
          <xref ref-type="aff" rid="aff2">2</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Wallace</surname>
            <given-names>Jason</given-names>
          </name>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Conceptualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/onceptualization">Conceptualization</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Resources" vocab-term-identifier="https://credit.niso.org/contributor-roles/resources">Resources</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Funding acquisition" vocab-term-identifier="https://credit.niso.org/contributor-roles/funding-acquisition">Funding acquisition</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing - review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing-review-editing">Writing - review &amp; editing</role>
          <xref ref-type="aff" rid="aff3">3</xref>
          <xref ref-type="aff" rid="aff1">1</xref>
          <xref ref-type="corresp" rid="cor1">§</xref>
        </contrib>
        <aff id="aff1">
          <label>1</label>
          Institute of Bioinformatics, University of Georgia, Athens, GA, United States
        </aff>
        <aff id="aff2">
          <label>2</label>
          School of Medicine, Emory University, Atlanta, Georgia, United States
        </aff>
        <aff id="aff3">
          <label>3</label>
          Department of Crop and Soil Sciences, University of Georgia, Athens, GA, United States
        </aff>
      </contrib-group>
      <contrib-group>
        <contrib contrib-type="reviewer">
          <anonymous/>
        </contrib>
      </contrib-group>
      <author-notes>
        <corresp id="cor1">
          <label>§</label>
          Correspondence to: Jason Wallace (
          <email>jason.wallace@uga.edu</email>
          )
        </corresp>
        <fn fn-type="coi-statement">
          <p>The authors declare that there are no conflicts of interest present.</p>
        </fn>
      </author-notes>
      <pub-date date-type="pub" publication-format="electronic">
        <day>6</day>
        <month>12</month>
        <year>2024</year>
      </pub-date>
      <pub-date date-type="collection" publication-format="electronic">
        <year>2024</year>
      </pub-date>
      <volume>2024</volume>
      <elocation-id>10.17912/micropub.biology.001275</elocation-id>
      <history>
        <date date-type="received">
          <day>1</day>
          <month>7</month>
          <year>2024</year>
        </date>
        <date date-type="rev-recd">
          <day>12</day>
          <month>11</month>
          <year>2024</year>
        </date>
        <date date-type="accepted">
          <day>5</day>
          <month>12</month>
          <year>2024</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>Copyright: © 2024 by the authors</copyright-statement>
        <copyright-year>2024</copyright-year>
        <license license-type="open-access" xlink:href="https://creativecommons.org/licenses/by/4.0/">
          <license-p>This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.</license-p>
        </license>
      </permissions>
      <abstract>
        <p>
          Tall fescue (
          <italic>Festuca arundinacea</italic>
          ) is a widely adopted forage and turf grass. This is partly due to a fungal endophyte, 
          <italic>Epichloë coenophiala,</italic>
           which confers both abiotic and biotic stress tolerance. Although PCR primers exist to test for endophyte presence, these were not designed to quantitatively analyze the amount of fungus in the plant. In this study, we test different primer sets for quantitative biomass analysis of tall fescue and 
          <italic>E. coenophiala. </italic>
          We report standard curves, r-squared, and efficiency values for every primer set and identify those most suited for qPCR in this system.
        </p>
      </abstract>
      <funding-group>
        <award-group>
          <funding-source>
            <institution-wrap>
              <institution>National Science Foundation (United States)</institution>
              <institution-id>https://ror.org/021nxhr62</institution-id>
            </institution-wrap>
          </funding-source>
          <award-id>1764127</award-id>
          <principal-award-recipient>Jason Wallace</principal-award-recipient>
        </award-group>
        <funding-statement>Funding was provided by NSF grant #1764127 and the University of Georgia.</funding-statement>
      </funding-group>
    </article-meta>
  </front>
  <body>
    <fig position="anchor" id="f1">
      <label>Figure 1. Log DNA Concentration vs CT Values of all primers</label>
      <caption>
        <p>
          The CT values for each primer set at each DNA concentration are shown, with individual replicates indicated by color. Cool colors (top two rows) are for tall fescue primers, while warm colors (bottom two rows) are for 
          <italic>Epichloë</italic>
           primers. Only G3P4 and G3P5 have acceptable amplification for tall fescue, while all primer sets for 
          <italic>Epichloë </italic>
          are acceptable.
        </p>
      </caption>
      <graphic xlink:href="25789430-2024-micropub.biology.001275"/>
    </fig>
    <sec>
      <title>Description</title>
      <p>
        Tall fescue is a cool-season grass that currently covers 14.2 million hectares of land in the Eastern United States 
        <xref ref-type="bibr" rid="R9">(Hmielowski, 2016)</xref>
        <bold>;</bold>
         it is also used widely in Australia, New Zealand, and Europe 
        <xref ref-type="bibr" rid="R13">(Repussard et al., 2014; Saikkonen et al., 2016)</xref>
        <bold>. </bold>
        Tall fescue is widely planted as both forage and turf because it is very resilient to a variety of environmental stresses. Many of the advantages of tall fescue are due to a fungal endophyte, 
        <italic>Epichloë coenophiala</italic>
        . Plants with 
        <italic>Epichloë</italic>
         endophytes can better resist drought 
        <xref ref-type="bibr" rid="R11">(Nagabhyru et al., 2013)</xref>
        , insects 
        <xref ref-type="bibr" rid="R4">(Clay, 1991)</xref>
        , and nematodes 
        <xref ref-type="bibr" rid="R7">(Elmi et al., 2000)</xref>
        , and also show increased vigor 
        <xref ref-type="bibr" rid="R4">(Clay, 1990)</xref>
        . However, the most common strain of 
        <italic>E. coenophiala </italic>
        causes “fescue toxicosis” in cattle, with symptoms including shaggy coats, poor weight gain, poor calving and milk production, and gangrene-like symptoms in extremities, all of which result in lost profits for farmers 
        <xref ref-type="bibr" rid="R10">(Kallenbach, 2015)</xref>
        . “Novel” 
        <italic>Epichloë </italic>
        endophytes that provide stress tolerance without harming livestock have been introduced into elite tall fescue varieties
        <italic/>
        <xref ref-type="bibr" rid="R12">(Realini et al., 2005)</xref>
        , but these are not yet widespread.
      </p>
      <p>
        The presence or absence of 
        <italic>Epichloë </italic>
        in tall fescue
        <italic/>
        can be determined either by immunoblot 
        <xref ref-type="bibr" rid="R8">(Hiatt III et al., 1999)</xref>
         or PCR 
        <xref ref-type="bibr" rid="R18">(Young et al., 2015)</xref>
        . While these tests are reliable for determining the presence of 
        <italic>Epichloë</italic>
        , they are not quantitative. One method for quantitatively determining the amount of 
        <italic>Epichloë</italic>
         present in a sample is quantitative PCR (qPCR), where the relative amounts of fungal and plant DNA are used as proxies for relative biomass 
        <xref ref-type="bibr" rid="R16">(Tellenbach et al., 2010; Young et al., 2005)</xref>
        . However, when we attempted to use primers from the literature for this purpose 
        <xref ref-type="bibr" rid="R1">(Amombo et al., 2018; Charlton et al., 2012)</xref>
        , we found many of them to be unsuitable for quantitative analysis (
        <xref ref-type="fig" rid="f1">Figure 1</xref>
        ).
      </p>
      <p>
        To fill this gap, we designed and tested a series of qPCR primers for both tall fescue and 
        <italic>Epichloë coenophiala</italic>
        . Primers for tall fescue targeted the glyceraldehyde-3-phosphate dehydrogenase gene (Genbank: GQ480772; primer sets G3P4, G3P5, and G3P6). We compared these with primers from the literature, specifically, Tf-ACS which targets acetyl-CoA synthetase 
        <xref ref-type="bibr" rid="R1">(Amombo et al., 2018)</xref>
        ; Tf-Gap, which targets glyceraldehyde-3-phosphate dehydrogenase 
        <xref ref-type="bibr" rid="R2">(Charlton et al., 2012)</xref>
        ; and Tf-EF1-1α, which targets translation elongation factor 1 alpha 
        <xref ref-type="bibr" rid="R1">(Amombo et al., 2018)</xref>
        . Primers for 
        <italic>Epichloë</italic>
         targeted the DmaW gene (GeneBank: KX712371.1; primer sets DMA1 through DMA4) 
        <xref ref-type="bibr" rid="R6">(Ekanayake et al., 2017)</xref>
        , which encodes dimethylallyl-tryptophan synthase, the enzyme that catalyzes the first committed step of ergot alkaloid biosynthesis 
        <xref ref-type="bibr" rid="R6">(Ekanayake et al., 2017)</xref>
        . We compared these sets to published primers, namely, ProA.5/ProA.1, which targets the ProA transcriptional regulator sequence 
        <xref ref-type="bibr" rid="R15">(Tanaka et al., 2013)</xref>
        ; TC351/TC352, which targets the DmaW promoter region 
        <xref ref-type="bibr" rid="R3">(Chujo &amp; Scott, 2014)</xref>
        ; and Endo-EF1 which targets 
        <italic>Epichloë</italic>
        ’s translation elongation factor 1 alpha 
        <xref ref-type="bibr" rid="R2">(Charlton et al., 2012)</xref>
        .
      </p>
      <p>
        Purified tall fescue and 
        <italic>Epichloë</italic>
         DNA were diluted to make standard curves for their respective primer sets, which were then tested in triplicate (
        <xref ref-type="fig" rid="f1">Figure 1</xref>
        ; Table 1). Most tall fescue primers performed poorly. Only G3P4 and G3P5 had r
        <sup>2</sup>
         values above 0.95 and only G3P5 had an efficiency value above 0.8. In contrast, all
        <italic> Epichloë </italic>
        primer sets performed well, with r
        <sup>2</sup>
         values above 0.95 and all except Endo-EF showing efficiencies above 0.85.
      </p>
      <p>
        From these results, we conclude that the G3P4 and G3P5 primer sets are the most effective for tall fescue, while any of the tested sets will work for 
        <italic>Epichloë</italic>
        . The latter is particularly useful since it allows researchers to tailor their amplicon to traits of interest: Endo-EF1 and ProA.5/ProA.1 for general endophyte presence, and the rest to check for ergot alkaloid biosynthesis capability.
      </p>
    </sec>
    <sec>
      <title>Methods</title>
      <p>
        New primer sets for both tall fescue and 
        <italic>Epichloë coenophiala </italic>
        were created with Primer3 
        <xref ref-type="bibr" rid="R17">(Untergasser et al., 2012)</xref>
        . Purified DNA for 
        <italic>Epichloë coenophiala </italic>
        was isolated by growing hypha in potato dextrose broth with 200 μg/mL of streptomycin, 100 μg/ml of ampicillin and 8 μg/ml of chloramphenicol on an orbital shaker at room temperature (approximately 23° C) for 8 days at 60 rpm. (The concentrations of streptomycin and chloramphenicol were lower than their intended 500 μg/mL and 40 μg/mL due to a miscalculation by the student making the media; since the culture remained clear of bacterial growth it was still used as planned.) Hyphae were strained from the broth with cheesecloth and lyophilized, and DNA was extracted with a Zymo Quick-DNA Fungal/Bacterial miniprep kit (Zymo #D3024) according to the manufacturer’s instructions. Purified DNA was diluted to 10 ng/μl in nuclease-free water, and a set of five 10-fold dilutions were made to be used as qPCR standards. Purified DNA for tall fescue was made from the bottom 2.5 cm of tillers of an endophyte-free plant that was freeze-dried, extracted, and diluted for standards the same way.
      </p>
      <p>
        All qPCR reactions used a SYBR Green master mix (Roche 04707516001) and were run on a Roche 480 II machine with the following qPCR settings: pre-incubation at 95°C for 5 minutes, followed by 45 cycles of 95°C for 10 seconds, 50°C for 15 seconds, and 72°C for 16 seconds. CT (crossing threshold) values were determined using the instrument software. Primer r
        <sup>2</sup>
         and efficiency values were calculated in R using the CT values and log-transformed DNA concentration for each sample.
      </p>
    </sec>
    <sec>
      <title>Reagents</title>
      <table-wrap>
        <table>
          <tbody>
            <tr>
              <td>
                <p>Primer names</p>
              </td>
              <td>
                <p>Primer Sequences</p>
              </td>
              <td>
                <p>
                  r
                  <sup>2</sup>
                </p>
              </td>
              <td>
                <p>Efficiency</p>
              </td>
              <td>
                <p>Targets</p>
              </td>
              <td>
                <p>Amplicon Length (bp)</p>
              </td>
              <td>
                <p>Primer Origin</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>Tf-ACS</p>
              </td>
              <td>
                <p>ACCGCGTTCACGTTGTTTTGCCACAACCATGTCGTC</p>
              </td>
              <td>
                <p>0.466</p>
              </td>
              <td>
                <p>9.508</p>
              </td>
              <td>
                <p>Tall Fescue</p>
              </td>
              <td>
                <p>
                  Unknown
                  <sup>*</sup>
                </p>
              </td>
              <td>
                <p>Amombo et al., 2018</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>Tf-Gap</p>
              </td>
              <td>
                <p>CTCAAGGGCATTTTGGGTTATTTCAGAGCAATCCCAGCCTT</p>
              </td>
              <td>
                <p>0.694</p>
              </td>
              <td>
                <p>3.776</p>
              </td>
              <td>
                <p>Tall Fescue</p>
              </td>
              <td>
                <p>
                  ~200
                  <sup>†</sup>
                </p>
              </td>
              <td>
                <p>Charlton et al., 2012</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>Tf-EF1-1α</p>
              </td>
              <td>
                <p>ATGGGTAAGGAAGACAAGACGGAGGTACCAGTGATCATGTT</p>
              </td>
              <td>
                <p>0.81</p>
              </td>
              <td>
                <p>3.671</p>
              </td>
              <td>
                <p>Tall Fescue</p>
              </td>
              <td>
                <p>
                  ~1000
                  <sup>†</sup>
                </p>
              </td>
              <td>
                <p>Amombo et al., 2018</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>G3P4</p>
              </td>
              <td>
                <p>TCGATGAGGACCTTGTTTCCGCTGTATCCCCACTCGTTGT</p>
              </td>
              <td>
                <p>0.972</p>
              </td>
              <td>
                <p>0.774</p>
              </td>
              <td>
                <p>Tall Fescue</p>
              </td>
              <td>
                <p>134</p>
              </td>
              <td>
                <p>Novel</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>G3P5</p>
              </td>
              <td>
                <p>AGGAGGAGTCTGAGGGTAAGAAGTTGTCGTTCAGAGCAAT</p>
              </td>
              <td>
                <p>0.984</p>
              </td>
              <td>
                <p>0.834</p>
              </td>
              <td>
                <p>Tall Fescue</p>
              </td>
              <td>
                <p>133</p>
              </td>
              <td>
                <p>Novel</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>G3P6</p>
              </td>
              <td>
                <p>CTTAACGGAAAGTTGACAGGCTTACCCTCAGACTCCTCCT</p>
              </td>
              <td>
                <p>0.868</p>
              </td>
              <td>
                <p>1.468</p>
              </td>
              <td>
                <p>Tall Fescue</p>
              </td>
              <td>
                <p>138</p>
              </td>
              <td>
                <p>Novel</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>DMAW1</p>
              </td>
              <td>
                <p>GTCCGTCGCAACTGGTAAATTTGTGACTGTCATCCGTGGT</p>
              </td>
              <td>
                <p>0.984</p>
              </td>
              <td>
                <p>0.882</p>
              </td>
              <td>
                <p>Epichloë</p>
              </td>
              <td>
                <p>153</p>
              </td>
              <td>
                <p>Novel</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>DMAW2</p>
              </td>
              <td>
                <p>GGATTGGAGATGATCCGAGAAAGTTGCTCATTGGGAATGG</p>
              </td>
              <td>
                <p>0.99</p>
              </td>
              <td>
                <p>0.863</p>
              </td>
              <td>
                <p>Epichloë</p>
              </td>
              <td>
                <p>108</p>
              </td>
              <td>
                <p>Novel</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>DMAW3</p>
              </td>
              <td>
                <p>CATGATTACGAAGCCCTGAATGGCCATTTACCAGTTTCAA</p>
              </td>
              <td>
                <p>0.987</p>
              </td>
              <td>
                <p>0.922</p>
              </td>
              <td>
                <p>Epichloë</p>
              </td>
              <td>
                <p>111</p>
              </td>
              <td>
                <p>Novel</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>DMAW4</p>
              </td>
              <td>
                <p>CCCGCATCATGATTACGAACTGGCCATTTACCAGTTTCAA</p>
              </td>
              <td>
                <p>0.989</p>
              </td>
              <td>
                <p>0.938</p>
              </td>
              <td>
                <p>Epichloë</p>
              </td>
              <td>
                <p>119</p>
              </td>
              <td>
                <p>Novel</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>ProA.5/ProA.1</p>
              </td>
              <td>
                <p>GCAGTGGAAACTCGAAATCGGCACTTCTTTCGTCTCAATC</p>
              </td>
              <td>
                <p>0.984</p>
              </td>
              <td>
                <p>0.851</p>
              </td>
              <td>
                <p>Epichloë</p>
              </td>
              <td>
                <p>186</p>
              </td>
              <td>
                <p>Tanaka et al., 2013</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>TC351/TC352</p>
              </td>
              <td>
                <p>GAGCGCAAAGGTGACTTGTTAAGAAGAGGACGAGCGGAAT</p>
              </td>
              <td>
                <p>0.985</p>
              </td>
              <td>
                <p>0.87</p>
              </td>
              <td>
                <p>Epichloë</p>
              </td>
              <td>
                <p>90</p>
              </td>
              <td>
                <p>Chujo &amp; Scott, 2014</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>Endo-EF1</p>
              </td>
              <td>
                <p>CGACATTGCCCTCTGGAAGTGGCTTACCAATGACGGTGACA</p>
              </td>
              <td>
                <p>0.986</p>
              </td>
              <td>
                <p>0.743</p>
              </td>
              <td>
                <p>Epichloë</p>
              </td>
              <td>
                <p>60</p>
              </td>
              <td>
                <p>Charlton et al., 2012</p>
              </td>
            </tr>
          </tbody>
        </table>
      </table-wrap>
      <p>Notes for table 1: * Tf-ACS did not show a band in gel electrophoresis, and we could not identify targets informatically. † Approximate length based on gel electrophoresis of the PCR product. Primers are named by the gene they target and then a number to distinguish them.</p>
    </sec>
  </body>
  <back>
    <ack>
      <sec>
        <title>Acknowledgments</title>
        <p>We would like to thank Courtney Phillips for the growth and management of plants.</p>
      </sec>
    </ack>
    <ref-list>
      <ref id="R1">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Amombo</surname>
              <given-names>Erick</given-names>
            </name>
            <name>
              <surname>Li</surname>
              <given-names>Xiaoning</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>Guangyang</given-names>
            </name>
            <name>
              <surname>An</surname>
              <given-names>Shao</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>Wei</given-names>
            </name>
            <name>
              <surname>Fu</surname>
              <given-names>Jinmin</given-names>
            </name>
          </person-group>
          <year>2018</year>
          <month>9</month>
          <day>21</day>
          <article-title>Comprehensive Transcriptome Profiling and Identification of Potential Genes Responsible for Salt Tolerance in Tall Fescue Leaves under Salinity Stress</article-title>
          <source>Genes</source>
          <volume>9</volume>
          <issue>10</issue>
          <issn>2073-4425</issn>
          <fpage>466</fpage>
          <lpage>466</lpage>
          <pub-id pub-id-type="doi">10.3390/genes9100466</pub-id>
        </element-citation>
      </ref>
      <ref id="R2">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Charlton</surname>
              <given-names>Nikki D.</given-names>
            </name>
            <name>
              <surname>Shoji</surname>
              <given-names>Jun-Ya</given-names>
            </name>
            <name>
              <surname>Ghimire</surname>
              <given-names>Sita R.</given-names>
            </name>
            <name>
              <surname>Nakashima</surname>
              <given-names>Jin</given-names>
            </name>
            <name>
              <surname>Craven</surname>
              <given-names>Kelly D.</given-names>
            </name>
          </person-group>
          <year>2012</year>
          <month>12</month>
          <day>1</day>
          <article-title>
            Deletion of the Fungal Gene
            
            <italic>soft</italic>
            
            Disrupts Mutualistic Symbiosis between the Grass Endophyte Epichloë festucae and the Host Plant
          </article-title>
          <source>Eukaryotic Cell</source>
          <volume>11</volume>
          <issue>12</issue>
          <issn>1535-9778</issn>
          <fpage>1463</fpage>
          <lpage>1471</lpage>
          <pub-id pub-id-type="doi">10.1128/ec.00191-12</pub-id>
        </element-citation>
      </ref>
      <ref id="R3">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Chujo</surname>
              <given-names>Tetsuya</given-names>
            </name>
            <name>
              <surname>Scott</surname>
              <given-names>Barry</given-names>
            </name>
          </person-group>
          <year>2014</year>
          <month>3</month>
          <day>17</day>
          <article-title>
            Histone H3K9 and H3K27 methylation regulates fungal alkaloid biosynthesis in a fungal endophyte–plant symbiosis
          </article-title>
          <source>Molecular Microbiology</source>
          <volume>92</volume>
          <issue>2</issue>
          <issn>0950-382X</issn>
          <fpage>413</fpage>
          <lpage>434</lpage>
          <pub-id pub-id-type="doi">10.1111/mmi.12567</pub-id>
        </element-citation>
      </ref>
      <ref id="R4">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Clay</surname>
              <given-names>Keith</given-names>
            </name>
          </person-group>
          <year>1990</year>
          <month>11</month>
          <day>1</day>
          <article-title>Fungal Endophytes of Grasses</article-title>
          <source>Annual Review of Ecology and Systematics</source>
          <volume>21</volume>
          <issue>1</issue>
          <issn>0066-4162</issn>
          <fpage>275</fpage>
          <lpage>297</lpage>
          <pub-id pub-id-type="doi">10.1146/annurev.es.21.110190.001423</pub-id>
        </element-citation>
      </ref>
      <ref id="R5">
        <element-citation publication-type="book-chapter">
          <person-group person-group-type="author">
            <name>
              <surname>Clay</surname>
              <given-names>Keith</given-names>
            </name>
          </person-group>
          <year>1991</year>
          <article-title>Endophytes as Antagonists of Plant Pests</article-title>
          <source>Brock/Springer Series in Contemporary Bioscience</source>
          <issn>1432-0061</issn>
          <fpage>331</fpage>
          <lpage>357</lpage>
          <pub-id pub-id-type="doi">10.1007/978-1-4612-3168-4_17</pub-id>
        </element-citation>
      </ref>
      <ref id="R6">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Ekanayake</surname>
              <given-names>PN</given-names>
            </name>
            <name>
              <surname>Kaur</surname>
              <given-names>J</given-names>
            </name>
            <name>
              <surname>Tian</surname>
              <given-names>P</given-names>
            </name>
            <name>
              <surname>Rochfort</surname>
              <given-names>SJ</given-names>
            </name>
            <name>
              <surname>Guthridge</surname>
              <given-names>KM</given-names>
            </name>
            <name>
              <surname>Sawbridge</surname>
              <given-names>TI</given-names>
            </name>
            <name>
              <surname>Spangenberg</surname>
              <given-names>GC</given-names>
            </name>
            <name>
              <surname>Forster</surname>
              <given-names>JW</given-names>
            </name>
          </person-group>
          <year>2017</year>
          <month>1</month>
          <day>4</day>
          <article-title>Genomic and metabolic characterisation of alkaloid biosynthesis by asexual Epichloë fungal endophytes of tall fescue pasture grasses.</article-title>
          <source>Genome</source>
          <volume>60</volume>
          <issue>6</issue>
          <issn>0831-2796</issn>
          <fpage>496</fpage>
          <lpage>509</lpage>
          <pub-id pub-id-type="doi">10.1139/gen-2016-0173</pub-id>
          <pub-id pub-id-type="pmid">28177829</pub-id>
        </element-citation>
      </ref>
      <ref id="R7">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Elmi</surname>
            </name>
            <name>
              <surname>West</surname>
            </name>
            <name>
              <surname>Robbins</surname>
            </name>
            <name>
              <surname>Kirkpatrick</surname>
            </name>
          </person-group>
          <year>2000</year>
          <month>6</month>
          <day>1</day>
          <article-title>
            Endophyte effects on reproduction of a root‐knot nematode (
            <italic>Meloidogyne marylandi</italic>
            ) and osmotic adjustment in tall fescue
          </article-title>
          <source>Grass and Forage Science</source>
          <volume>55</volume>
          <issue>2</issue>
          <issn>0142-5242</issn>
          <fpage>166</fpage>
          <lpage>172</lpage>
          <pub-id pub-id-type="doi">10.1046/j.1365-2494.2000.00210.x</pub-id>
        </element-citation>
      </ref>
      <ref id="R8">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Hiatt</surname>
              <given-names>E. E.</given-names>
            </name>
            <name>
              <surname>Hill</surname>
              <given-names>N. S.</given-names>
            </name>
            <name>
              <surname>Bouton</surname>
              <given-names>J. H.</given-names>
            </name>
            <name>
              <surname>Stuedemann</surname>
              <given-names>J. A.</given-names>
            </name>
          </person-group>
          <year>1999</year>
          <month>5</month>
          <day>1</day>
          <article-title>Tall Fescue Endophyte Detection: Commercial Immunoblot Test Kit Compared with Microscopic Analysis</article-title>
          <source>Crop Science</source>
          <volume>39</volume>
          <issue>3</issue>
          <issn>0011-183X</issn>
          <fpage>796</fpage>
          <lpage>799</lpage>
          <pub-id pub-id-type="doi">10.2135/cropsci1999.0011183x003900030030x</pub-id>
        </element-citation>
      </ref>
      <ref id="R9">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Hmielowski</surname>
              <given-names>Tracy</given-names>
            </name>
          </person-group>
          <year>2016</year>
          <month>12</month>
          <day>1</day>
          <article-title>The fascinating tale of tall fescue</article-title>
          <source>CSA News</source>
          <volume>61</volume>
          <issue>12</issue>
          <issn>1529-9163</issn>
          <fpage>4</fpage>
          <lpage>9</lpage>
          <pub-id pub-id-type="doi">10.2134/csa2016-61-12-1</pub-id>
        </element-citation>
      </ref>
      <ref id="R10">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kallenbach</surname>
              <given-names>R. L.</given-names>
            </name>
          </person-group>
          <year>2015</year>
          <month>12</month>
          <day>1</day>
          <article-title>BILL E. KUNKLE INTERDISCIPLINARY BEEF SYMPOSIUM: Coping with tall fescue toxicosis: Solutions and realities1,2</article-title>
          <source>Journal of Animal Science</source>
          <volume>93</volume>
          <issue>12</issue>
          <issn>0021-8812</issn>
          <fpage>5487</fpage>
          <lpage>5495</lpage>
          <pub-id pub-id-type="doi">10.2527/jas.2015-9229</pub-id>
        </element-citation>
      </ref>
      <ref id="R11">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Nagabhyru</surname>
              <given-names>Padmaja</given-names>
            </name>
            <name>
              <surname>Dinkins</surname>
              <given-names>Randy D</given-names>
            </name>
            <name>
              <surname>Wood</surname>
              <given-names>Constance L</given-names>
            </name>
            <name>
              <surname>Bacon</surname>
              <given-names>Charles W</given-names>
            </name>
            <name>
              <surname>Schardl</surname>
              <given-names>Christopher L</given-names>
            </name>
          </person-group>
          <year>2013</year>
          <month>9</month>
          <day>9</day>
          <article-title>Tall fescue endophyte effects on tolerance to water-deficit stress</article-title>
          <source>BMC Plant Biology</source>
          <volume>13</volume>
          <issue>1</issue>
          <issn>1471-2229</issn>
          <pub-id pub-id-type="doi">10.1186/1471-2229-13-127</pub-id>
        </element-citation>
      </ref>
      <ref id="R12">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Realini</surname>
              <given-names>C. E.</given-names>
            </name>
            <name>
              <surname>Duckett</surname>
              <given-names>S. K.</given-names>
            </name>
            <name>
              <surname>Hill</surname>
              <given-names>N. S.</given-names>
            </name>
            <name>
              <surname>Hoveland</surname>
              <given-names>C. S.</given-names>
            </name>
            <name>
              <surname>Lyon</surname>
              <given-names>B. G.</given-names>
            </name>
            <name>
              <surname>Sackmann</surname>
              <given-names>J. R.</given-names>
            </name>
            <name>
              <surname>Gillis</surname>
              <given-names>M. H.</given-names>
            </name>
          </person-group>
          <year>2005</year>
          <month>2</month>
          <day>1</day>
          <article-title>Effect of endophyte type on carcass traits, meat quality, and fatty acid composition of beef cattle grazing tall fescue</article-title>
          <source>Journal of Animal Science</source>
          <volume>83</volume>
          <issue>2</issue>
          <issn>0021-8812</issn>
          <fpage>430</fpage>
          <lpage>439</lpage>
          <pub-id pub-id-type="doi">10.2527/2005.832430x</pub-id>
        </element-citation>
      </ref>
      <ref id="R13">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Repussard</surname>
              <given-names>Céline</given-names>
            </name>
            <name>
              <surname>Zbib</surname>
              <given-names>Nasrallah</given-names>
            </name>
            <name>
              <surname>Tardieu</surname>
              <given-names>Didier</given-names>
            </name>
            <name>
              <surname>Guerre</surname>
              <given-names>Philippe</given-names>
            </name>
          </person-group>
          <year>2014</year>
          <month>9</month>
          <day>18</day>
          <article-title>Endophyte Infection of Tall Fescue and the Impact of Climatic Factors on Ergovaline Concentrations in Field Crops Cultivated in Southern France</article-title>
          <source>Journal of Agricultural and Food Chemistry</source>
          <volume>62</volume>
          <issue>39</issue>
          <issn>0021-8561</issn>
          <fpage>9609</fpage>
          <lpage>9614</lpage>
          <pub-id pub-id-type="doi">10.1021/jf503015m</pub-id>
        </element-citation>
      </ref>
      <ref id="R14">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Saikkonen</surname>
              <given-names>Kari</given-names>
            </name>
            <name>
              <surname>Phillips</surname>
              <given-names>Timothy D.</given-names>
            </name>
            <name>
              <surname>Faeth</surname>
              <given-names>Stanley H.</given-names>
            </name>
            <name>
              <surname>McCulley</surname>
              <given-names>Rebecca L.</given-names>
            </name>
            <name>
              <surname>Saloniemi</surname>
              <given-names>Irma</given-names>
            </name>
            <name>
              <surname>Helander</surname>
              <given-names>Marjo</given-names>
            </name>
          </person-group>
          <year>2016</year>
          <month>6</month>
          <day>10</day>
          <article-title>Performance of Endophyte Infected Tall Fescue in Europe and North America</article-title>
          <source>PLOS ONE</source>
          <volume>11</volume>
          <issue>6</issue>
          <issn>1932-6203</issn>
          <fpage>e0157382</fpage>
          <lpage>e0157382</lpage>
          <pub-id pub-id-type="doi">10.1371/journal.pone.0157382</pub-id>
        </element-citation>
      </ref>
      <ref id="R15">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Tanaka</surname>
              <given-names>Aiko</given-names>
            </name>
            <name>
              <surname>Cartwright</surname>
              <given-names>Gemma M.</given-names>
            </name>
            <name>
              <surname>Saikia</surname>
              <given-names>Sanjay</given-names>
            </name>
            <name>
              <surname>Kayano</surname>
              <given-names>Yuka</given-names>
            </name>
            <name>
              <surname>Takemoto</surname>
              <given-names>Daigo</given-names>
            </name>
            <name>
              <surname>Kato</surname>
              <given-names>Masashi</given-names>
            </name>
            <name>
              <surname>Tsuge</surname>
              <given-names>Takashi</given-names>
            </name>
            <name>
              <surname>Scott</surname>
              <given-names>Barry</given-names>
            </name>
          </person-group>
          <year>2013</year>
          <month>9</month>
          <day>18</day>
          <article-title>
            ProA, a transcriptional regulator of fungal fruiting body development, regulates leaf hyphal network development in the 
            <italic>
              Epichloë festucae
            </italic>
            –
            <italic>
              Lolium perenne
            </italic>
             symbiosis
          </article-title>
          <source>Molecular Microbiology</source>
          <volume>90</volume>
          <issue>3</issue>
          <issn>0950-382X</issn>
          <fpage>551</fpage>
          <lpage>568</lpage>
          <pub-id pub-id-type="doi">10.1111/mmi.12385</pub-id>
        </element-citation>
      </ref>
      <ref id="R16">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Tellenbach</surname>
              <given-names>Christoph</given-names>
            </name>
            <name>
              <surname>Grünig</surname>
              <given-names>Christoph R.</given-names>
            </name>
            <name>
              <surname>Sieber</surname>
              <given-names>Thomas N.</given-names>
            </name>
          </person-group>
          <year>2010</year>
          <month>9</month>
          <day>1</day>
          <article-title>Suitability of Quantitative Real-Time PCR To Estimate the Biomass of Fungal Root Endophytes</article-title>
          <source>Applied and Environmental Microbiology</source>
          <volume>76</volume>
          <issue>17</issue>
          <issn>0099-2240</issn>
          <fpage>5764</fpage>
          <lpage>5772</lpage>
          <pub-id pub-id-type="doi">10.1128/aem.00907-10</pub-id>
        </element-citation>
      </ref>
      <ref id="R17">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Untergasser</surname>
              <given-names>Andreas</given-names>
            </name>
            <name>
              <surname>Cutcutache</surname>
              <given-names>Ioana</given-names>
            </name>
            <name>
              <surname>Koressaar</surname>
              <given-names>Triinu</given-names>
            </name>
            <name>
              <surname>Ye</surname>
              <given-names>Jian</given-names>
            </name>
            <name>
              <surname>Faircloth</surname>
              <given-names>Brant C.</given-names>
            </name>
            <name>
              <surname>Remm</surname>
              <given-names>Maido</given-names>
            </name>
            <name>
              <surname>Rozen</surname>
              <given-names>Steven G.</given-names>
            </name>
          </person-group>
          <year>2012</year>
          <month>6</month>
          <day>21</day>
          <article-title>Primer3—new capabilities and interfaces</article-title>
          <source>Nucleic Acids Research</source>
          <volume>40</volume>
          <issue>15</issue>
          <issn>1362-4962</issn>
          <fpage>e115</fpage>
          <lpage>e115</lpage>
          <pub-id pub-id-type="doi">10.1093/nar/gks596</pub-id>
        </element-citation>
      </ref>
      <ref id="R18">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Young</surname>
              <given-names>C. A.</given-names>
            </name>
            <name>
              <surname>Bryant</surname>
              <given-names>M. K.</given-names>
            </name>
            <name>
              <surname>Christensen</surname>
              <given-names>M. J.</given-names>
            </name>
            <name>
              <surname>Tapper</surname>
              <given-names>B. A.</given-names>
            </name>
            <name>
              <surname>Bryan</surname>
              <given-names>G. T.</given-names>
            </name>
            <name>
              <surname>Scott</surname>
              <given-names>B.</given-names>
            </name>
          </person-group>
          <year>2005</year>
          <month>7</month>
          <day>1</day>
          <article-title>Molecular cloning and genetic analysis of a symbiosis-expressed gene cluster for lolitrem biosynthesis from a mutualistic endophyte of perennial ryegrass</article-title>
          <source>Molecular Genetics and Genomics</source>
          <volume>274</volume>
          <issue>1</issue>
          <issn>1617-4615</issn>
          <fpage>13</fpage>
          <lpage>29</lpage>
          <pub-id pub-id-type="doi">10.1007/s00438-005-1130-0</pub-id>
        </element-citation>
      </ref>
      <ref id="R19">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Young</surname>
              <given-names>Carolyn</given-names>
            </name>
            <name>
              <surname>Schardl</surname>
              <given-names>Christopher</given-names>
            </name>
            <name>
              <surname>Panaccione</surname>
              <given-names>Daniel</given-names>
            </name>
            <name>
              <surname>Florea</surname>
              <given-names>Simona</given-names>
            </name>
            <name>
              <surname>Takach</surname>
              <given-names>Johanna</given-names>
            </name>
            <name>
              <surname>Charlton</surname>
              <given-names>Nikki</given-names>
            </name>
            <name>
              <surname>Moore</surname>
              <given-names>Neil</given-names>
            </name>
            <name>
              <surname>Webb</surname>
              <given-names>Jennifer</given-names>
            </name>
            <name>
              <surname>Jaromczyk</surname>
              <given-names>Jolanta</given-names>
            </name>
          </person-group>
          <year>2015</year>
          <month>4</month>
          <day>14</day>
          <article-title>Genetics, Genomics and Evolution of Ergot Alkaloid Diversity</article-title>
          <source>Toxins</source>
          <volume>7</volume>
          <issue>4</issue>
          <issn>2072-6651</issn>
          <fpage>1273</fpage>
          <lpage>1302</lpage>
          <pub-id pub-id-type="doi">10.3390/toxins7041273</pub-id>
        </element-citation>
      </ref>
    </ref-list>
  </back>
</article>
