<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/archiving/1.2/JATS-archivearticle1.dtd">
<article article-type="brief-report" xmlns:xlink="http://www.w3.org/1999/xlink">
  <front>
    <journal-meta>
      <journal-title-group>
        <journal-title>microPublication Biology</journal-title>
      </journal-title-group>
      <issn pub-type="epub">2578-9430</issn>
      <publisher>
        <publisher-name>Caltech Library</publisher-name>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="doi">10.17912/micropub.biology.001266</article-id>
      <article-categories>
        <subj-group subj-group-type="heading">
          <subject>new finding</subject>
        </subj-group>
        <subj-group subj-group-type="subject">
          <subject>methods</subject>
        </subj-group>
        <subj-group subj-group-type="species">
          <subject>other</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>
          Simplified J774A.1 macrophage assay for fungal pathogenicity demonstrates non-clinical 
          <italic>Nakaseomyces glabratus </italic>
          strains survive better than lab strains.
        </article-title>
      </title-group>
      <contrib-group>
        <contrib contrib-type="author">
          <name>
            <surname>Pezak</surname>
            <given-names>Corey M.</given-names>
          </name>
          <xref ref-type="aff" rid="aff1">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Iosue</surname>
            <given-names>Christine L.</given-names>
          </name>
          <xref ref-type="aff" rid="aff1">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <name>
            <surname>Wykoff</surname>
            <given-names>Dennis D.</given-names>
          </name>
          <xref ref-type="aff" rid="aff1">1</xref>
          <xref ref-type="corresp" rid="cor1">§</xref>
        </contrib>
        <aff id="aff1">
          <label>1</label>
          Biology, Villanova University, Radnor, Pennsylvania, United States
        </aff>
      </contrib-group>
      <contrib-group>
        <contrib contrib-type="reviewer">
          <anonymous/>
        </contrib>
      </contrib-group>
      <author-notes>
        <corresp id="cor1">
          <label>§</label>
          Correspondence to: Dennis D. Wykoff (
          <email>dennis.wykoff@villanova.edu</email>
          )
        </corresp>
        <fn fn-type="coi-statement">
          <p>The authors declare that there are no conflicts of interest present.</p>
        </fn>
      </author-notes>
      <pub-date date-type="pub" publication-format="electronic">
        <day>22</day>
        <month>8</month>
        <year>2024</year>
      </pub-date>
      <pub-date date-type="collection" publication-format="electronic">
        <year>2024</year>
      </pub-date>
      <volume>2024</volume>
      <elocation-id>10.17912/micropub.biology.001266</elocation-id>
      <history>
        <date date-type="received">
          <day>25</day>
          <month>6</month>
          <year>2024</year>
        </date>
        <date date-type="rev-recd">
          <day>19</day>
          <month>8</month>
          <year>2024</year>
        </date>
        <date date-type="accepted">
          <day>21</day>
          <month>8</month>
          <year>2024</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>Copyright: © 2024 by the authors</copyright-statement>
        <copyright-year>2024</copyright-year>
        <license license-type="open-access" xlink:href="https://creativecommons.org/licenses/by/4.0/">
          <license-p>This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.</license-p>
        </license>
      </permissions>
      <abstract>
        <p>
          <italic>Nakaseomyces glabratus </italic>
          (formerly known as 
          <italic>Candida glabrata</italic>
          ) is the second most common cause of candidiasis, whereas the closely related yeast, 
          <italic>Saccharomyces cerevisiae,</italic>
           causes few infections. Macrophages can control 
          <italic>N. glabratus</italic>
           infections through phagocytosis, but in cell culture, 
          <italic>N. glabratus</italic>
           is able to persist in macrophages better than non-pathogenic yeast. Using J774A.1 macrophages, we simplified a standard persistence/survival assay by counting yeast cells with flow cytometry and incorporating an antifungal treatment. These improvements minimized wash steps and variation so fewer replicates were needed. Here, we demonstrate that loss of 
          <italic>NgTUP11</italic>
           does not lower pathogenicity, and that three non-clinical 
          <italic>N. glabratus </italic>
          strains survive in macrophages better than a laboratory strain.
        </p>
      </abstract>
      <funding-group>
        <award-group>
          <funding-source>
            <institution-wrap>
              <institution>National Science Foundation (United States)</institution>
              <institution-id>https://ror.org/021nxhr62</institution-id>
            </institution-wrap>
          </funding-source>
          <award-id>MCB1921632 </award-id>
          <principal-award-recipient>Dennis D. Wykoff</principal-award-recipient>
        </award-group>
        <funding-statement>This work was funded by National Science Foundation grant (MCB 1921632 to D.D.W.), the Dennis M. Cook Endowed Gregor Mendel Chair in Genetics Endowment, the Villanova College of Liberal Arts and Sciences, and the Villanova Department of Biology.</funding-statement>
      </funding-group>
    </article-meta>
  </front>
  <body>
    <fig position="anchor" id="f1">
      <label>Figure 1. </label>
      <caption>
        <p>
          <bold>(A)</bold>
           Workflow of modified macrophage survival/persistence assay. Flow cytometry is used to obtain a cell count of fluorescent (or non-fluorescent) yeast cells, which are then used to infect macrophage cells. Antimycotic-antibiotic solution is added for half of the infection time. Macrophage cells are lysed 2 hours and 24 hours after infection and flow cytometry is used to count fluorescent yeast cells present within the lysed macrophages. The schematic was generated using BioRender.
        </p>
        <p>
          <bold>(B)</bold>
           Fluorescent yeast cells present in lysed macrophage cells were quantified by flow cytometry 2 hours and 24 hours after infection (except for 
          <italic>yHSCL38</italic>
           which was generated by counting colony number). The number of replicates varied for each strain and replicates are represented by individual data points. A one-way ANOVA with post-hoc Tukey’s test was performed to compare all strains at both time points to yield a compact letter display to identify statistically significant differences.
        </p>
        <p>
          <bold>(C)</bold>
           Yeast strains were incubated with or without antimycotic-antibiotic for 1 hour. Each sample was plated on YEPD petri plates and colonies were counted. The data reported is two biological replicates and four technical replicates for each strain. A student’s t test was used to compare the number of colonies for each yeast strain in the presence and absence of antibiotic-antimycotic and there was no significant difference for any of the strains.
        </p>
        <p>
          <bold>(D)</bold>
           Macrophages were infected with a non-clinical 
          <italic>N. glabratus</italic>
           strain (
          <italic>yHRVM15</italic>
          ) with either the 
          <italic>URA3</italic>
           gene intact (
          <italic>URA3</italic>
          +) or replaced by integration of 
          <italic>NgADH1</italic>
          pr-YFP (
          <italic>URA3</italic>
          -). The strain without YFP was plated to determine number of colonies and the strain with YFP was counted by flow cytometry at 2 hours and 24 hours after infection. The data reported is two biological replicates and 6 technical replicates for each strain. A one-way ANOVA with post-hoc Tukey’s test was performed to compare both strains at both time points with a compact letter display.
        </p>
      </caption>
      <graphic xlink:href="25789430-2024-micropub.biology.001266"/>
    </fig>
    <sec>
      <title>Description</title>
      <p>
        <italic>N. glabratus</italic>
         is a commensal, opportunistic pathogen, but is phylogenetically closely related to 
        <italic>Saccharomyces cerevisiae</italic>
        , which is not generally pathogenic (Angoulvant, Guitard, and Hennequin 2015; Gabaldón Estevan et al. 2013)
        <italic>.</italic>
         Many virulence factors have been identified, including adhesins and yapsins 
        <xref ref-type="bibr" rid="R2">(Askari, Rasheed, and Kaur 2022; Katsipoulaki et al. 2024; Domergue et al. 2005)</xref>
        . Studies have used murine macrophage-like cells to assess aspects of pathogenicity and demonstrated that yapsins are required for persistence in macrophages 
        <xref ref-type="bibr" rid="R10">(Kaur, Ma, and Cormack 2007; Kumar et al. 2019)</xref>
        . Macrophages are critical for clearing circulating fungal cells, and whether yeast cells can survive and persist in macrophages is a proxy for the ability of an organism to clear an infection.
      </p>
      <p>
        In a standard assay, macrophages are grown in cell culture medium, yeast cells are introduced and phagocytosed, cells that are not phagocytosed are washed from the wells, macrophages are lysed after 2 hours and 24 hours, and the number of fungal cells is quantified by plating on nutrient agar 
        <xref ref-type="bibr" rid="R10">(Kaur, Ma, and Cormack 2007)</xref>
        . Pathogenic strains persist, or even increase in cell number, in the macrophages, and less pathogenic cells are eliminated from the macrophages. While this assay sounds simple, in practice, there is variability. J774A.1 cells are not strongly adherent on tissue culture plastic, and repeated washes wash away the macrophages, removing fungal cells as well. Additionally, if a fungal cell is not phagocytosed it can rapidly outcompete the macrophages and lead to fungal overgrowth, which is readily identified by the turning of phenol red in the cell culture medium to yellow. Finally, plating and counting of fungal cells requires serial dilution, time for colonies to form, and equal plating efficiency.
      </p>
      <p>
        To address these issues, we have incorporated two changes to the standard assay. First, the introduction of a 1-hour treatment with antimycotic (amphotericin B)-antibiotic reduced the likelihood of fungal overgrowth in the cell culture medium and removed the need for three extra wash steps in our assay. Second, by integrating into yeast cells a constitutively expressed YFP gene, we were able to immediately assess fungal census and reduce plating variability by using flow cytometry to count yeast cells (
        <bold>
          <xref ref-type="fig" rid="f1">Figure 1A</xref>
        </bold>
        ). We performed the persistence/survival assay with the added antimycotic-antibiotic step reducing washes. We were able to demonstrate very low variability and replicate the results published by the Cormack laboratory 
        <xref ref-type="bibr" rid="R10">(Kaur, Ma, and Cormack 2007)</xref>
         for 
        <italic>S. cerevisiae </italic>
        wild-type, 
        <italic>N. glabratus</italic>
         wild-type, and 
        <italic>Ngyps1</italic>
        Δ (
        <bold>
          <xref ref-type="fig" rid="f1">Figure 1B</xref>
        </bold>
        ). We present the fluorescent yeast cell count as determined by flow cytometry at 2 hours and 24 hours after infection for each strain. 
        <italic>S. cerevisiae</italic>
         cell counts decrease after 24 hours while 
        <italic>N. glabratus</italic>
         wild-type shows minimal change. 
        <italic>Ngyps1</italic>
        Δ shows a decrease when compared to 
        <italic>N. glabratus</italic>
         wild-type at 24 hours after infection, confirming that 
        <italic>NgYPS1</italic>
         is important for survival in macrophages.
      </p>
      <p>
        With the assay being less variable, we then queried the persistence/survival of four additional 
        <italic>N. glabratus</italic>
         strains: 
        <italic>Ngtup11</italic>
        Δ and three non-clinical strains isolated from various environments such as soil containing berries (
        <italic>yHSLC38</italic>
        ), a sand/soil mixture (
        <italic>yHKS744</italic>
        ), and a fungus (
        <italic>yHRVM15</italic>
        ) 
        <xref ref-type="bibr" rid="R12">(Opulente et al. 2019; Spurley et al. 2022)</xref>
        . We examined the 
        <italic>Ngtup11</italic>
        Δ strain because many yapsin genes change expression in it 
        <xref ref-type="bibr" rid="R3">(Bui, Iosue, and Wykoff 2022)</xref>
        , suggesting that there may be an increase in persistence in macrophages. Here, we demonstrate that the 
        <italic>Ngtup11</italic>
        Δ strain persists similar to the 
        <italic>N. glabratus</italic>
         wild-type strain, and that the three environmental strains appear to thrive in macrophages and grow better than our 
        <italic>N. glabratus</italic>
         wild-type laboratory strain, which was isolated from a patient more than thirty years ago 
        <xref ref-type="bibr" rid="R4">(Cormack and Falkow 1999)</xref>
        . We were unable to incorporate a YFP tag into one of the non-clinical 
        <italic>N. glabratus</italic>
         strains, 
        <italic>yHSLC38</italic>
        , and so we performed the assay by counting colony numbers to measure persistence. The other two non-clinical strains (
        <italic>yHKS744</italic>
         and 
        <italic>yHRVM15</italic>
        ) were assayed with the YFP tag and flow cytometry. Since the values were similar for strains with and without the YFP tag, the 
        <italic>yHSLC38</italic>
         strain is included in 
        <bold>
          <xref ref-type="fig" rid="f1">Figure 1B</xref>
        </bold>
        .
      </p>
      <p>
        There are many reasons that we may be observing persistence in macrophages that are not related to direct pathogenicity. One cause could be the incorporation of an antimycotic-antibiotic solution for one hour. If the solution killed the nonpathogenic appearing strains differentially, then we would observe the results in 
        <bold>
          <xref ref-type="fig" rid="f1">Figure 1B</xref>
        </bold>
         as a consequence of sensitivity to antifungal treatment. To test this, we treated 
        <italic>S. cerevisiae </italic>
        wild-type, 
        <italic>N. glabratus </italic>
        wild-type, 
        <italic>Ngyps1</italic>
        Δ, and a non-clinical strain (
        <italic>yHKS744</italic>
        ) with antimycotic-antibiotic for one hour and observed no significant difference in the number of colonies grown after treatment when compared to strains not exposed to the antimycotic-antibiotic (
        <bold>
          <xref ref-type="fig" rid="f1">Figure 1C</xref>
        </bold>
        ). Additionally, these data indicate that fungal cells are not killed with this concentration of antimycotic (25 μg/mL of Amphotericin B in Gibco antibiotic-antimycotic solution). We hypothesize that our decrease in fungal overgrowth observed with the antimycotic treatment is due to an arrest of cells in the medium, giving macrophages more time to phagocytose any remaining fungal cells in the cell culture medium, although we cannot eliminate the possibility that the antibiotics are lowering contaminations as well.
      </p>
      <p>
        Finally, we examined whether the integration of YFP into the genome in the 
        <italic>URA3</italic>
         locus had a significant effect on the persistence of yeast cells in macrophages. It is reasonable to think that disruption of 
        <italic>URA3</italic>
         and the subsequent auxotrophy for uracil might impact persistence. To test this, we used an environmental strain (
        <italic>yHRVM15</italic>
        ) where 
        <italic>URA3 </italic>
        is left intact or replaced with 
        <italic>NgADH1pr-</italic>
        YFP (
        <bold>
          <xref ref-type="fig" rid="f1">Figure 1D</xref>
        </bold>
        ). While there is a statistically significant decrease in the number of cells after 24 hours for the strain where 
        <italic>URA3</italic>
         is replaced with 
        <italic>NgADH1</italic>
        pr-YFP, both strains persist in macrophages, suggesting that loss of 
        <italic>URA3</italic>
         is not critical for persistence. Additionally, the data in 
        <bold>
          <xref ref-type="fig" rid="f1">Figure 1B</xref>
        </bold>
         (both yHKS744 and 
        <italic>yHRVM15</italic>
        ) suggest that this replacement does not have a strong effect, as the three environmental strains appear to have similar persistence after 24 hours whether or not 
        <italic>URA3</italic>
         is disrupted.
      </p>
      <p>
        We believe that the incorporation of an antimycotic-antibiotic treatment for one hour during infection lowers the variability of the assay for persistence/survival in macrophage cells. With this treatment, there is no need to perform the customary wash steps, resulting in more consistent results since there is less chance of washing macrophage cells off of the cell culture substrate. We initially believed the macrophages might lower the effective concentration of antimycotic inside the macrophage cells, but 
        <bold>
          <xref ref-type="fig" rid="f1">Figure 1C</xref>
        </bold>
         demonstrates it is irrelevant. Additionally, using fluorescently labeled cells allows for accurate, rapid quantifying of yeast cells using flow cytometry. However, the incorporation of a fluorescent tag into the genome of cells is not required. We performed these assays with yeast strains containing 
        <italic>NgADH1pr-</italic>
        YFP on a plasmid and observed similar results, suggesting that the use of plasmids may be a viable option if genomic integration is not successful. We also performed the persistence/survival assay with exogenous ketoconazole and observed similar results, but cells were more sensitive to the ketoconazole. The treatment with antimycotic-antibiotic solution is simple as it is often added to cell culture medium, and it essentially eliminates fungal overgrowth. Finally, we believe the reproducibility of the assay will allow for high-throughput analysis of strains for the ability to survive in macrophages.
      </p>
    </sec>
    <sec>
      <title>Methods</title>
      <p>
        <bold>Infection of J774.A1 Macrophage cells</bold>
      </p>
      <p>
        J774.A1 macrophages were cultured in T75 flasks in DMEM+Glutamax (Gibco), supplemented with 10% FBS, sodium bicarbonate, and 1x antibiotic-antimycotic (Gibco – cat #15240062 Thermo Fisher), at 37° C in a 5% CO
        <sub>2</sub>
         containing incubator. Cells were passaged every 2-3 days. Prior to infection, macrophages were grown to ~90% confluency. Culture media was removed, and cells were harvested with a cell scraper and resuspended by gentle pipetting in 30 mL DMEM (supplemented as described above). 0.5 mL of this cell suspension was seeded into a 24 well cell culture plate (at a concentration ranging from 3x10
        <sup>5</sup>
         to 5x10
        <sup>5</sup>
         live cells/mL when counted by a DeNovix Cell Drop with the AO-PI Viability assay) and grown for ~24 hours at 37° C in 5% CO
        <sub>2</sub>
         until a confluency of ~90%. For infection, medium was aspirated, and wells were washed once with DMEM + 10% FBS 
        <bold>without</bold>
         antimycotic-antibiotic and then filled with 0.5 mL warmed DMEM + 10% FBS 
        <bold>without</bold>
         antimycotic-antibiotic. Yeast cell numbers were quantified by flow cytometry prior to infection. Twenty microliters of yeast culture (containing 100,000 yeast cells in sterile water) was added to each well and gently mixed by pipetting. The plate was centrifuged for 1 minute at 1000 rpm and placed at 37° C in 5% CO
        <sub>2</sub>
         for 1 hour. Medium was then aspirated and 0.5 mL of DMEM + 10% FBS 
        <bold>with</bold>
         antimycotic-antibiotic was added for 1 hour at 37° C in 5% CO
        <sub>2</sub>
        . Wells corresponding to 2 hours after infection were washed with DMEM + 10% FBS 
        <bold>without</bold>
         antimycotic-antibiotic and then macrophage cells were lysed with 0.1% Triton X-100 by scraping with a pipette tip. The lysate was transferred to a 1.5 mL tube and subjected to either flow cytometry to count fluorescent yeast cells or plating onto YEPD petri plates to count colonies. DMEM + 10% FBS 
        <bold>without</bold>
         antimycotic-antibiotic was added to wells corresponding to 24 hours after infection and the plate was incubated at 37° C in 5% CO
        <sub>2</sub>
         for an additional 22 hours. Wells were washed and lysed as described and subjected to either flow cytometry or plating onto YEPD petri plates.
      </p>
      <p>
        <bold>Yeast strains</bold>
      </p>
      <p>
        To tag yeast strains with YFP, 
        <italic>NgADH1</italic>
        pr-YFP was amplified by PCR and transformed into 
        <italic>N. glabratus</italic>
         stains by a standard lithium acetate protocol to integrate the 
        <italic>NgADH1</italic>
        pr-YFP into the 
        <italic>NgURA3</italic>
         locus 
        <xref ref-type="bibr" rid="R5">(Corrigan et al. 2013)</xref>
        . Strains defective in 
        <italic>URA3</italic>
         were selected on solid agar medium that contained 5-FOA (1 g/L). Appropriate integration of 
        <italic>NgADH1</italic>
        pr-YFP was confirmed by stable fluorescence and confirmatory PCR of the integration site (primers and plasmid in Reagents).
      </p>
      <p>
        For infection of macrophage cells, all yeast cultures (strains listed in Reagents) were grown to log phase (OD
        <sub>600</sub>
         between 0.2-0.8) at 30°C in YEPD medium. Cells were washed with sterile water and the cell count was obtained by flow cytometry. The yeast culture was diluted to 5,000 cells/µL in sterile water so each well of the 24 well plate could be infected with 100,000 yeast cells.
      </p>
      <p>
        <bold>Flow cytometry</bold>
      </p>
      <p>
        A flow cytometer with a 533/30 filter set (Accuri C6 Plus, BD Biosciences) was used to count fluorescent yeast cells. Yeast cells were diluted in sterile water and 50-100 µL was counted using fast fluidics. A vertical gate was used to separate fluorescent yeast cells from non-fluorescent debris found in the sample after lysis of macrophage cells. 
        <bold>
          <xref ref-type="fig" rid="f1">Figure 1B </xref>
          and 1D
        </bold>
         report the total cells recovered from the infection assay.
      </p>
      <p>
        <bold>Assaying the sensitivity of various yeast strains to the antimycotic-antibiotic</bold>
      </p>
      <p>
        100,000 yeast cells (in 20 µL sterile water) were incubated in 0.5 mL of DMEM + 10% FBS 
        <bold>with</bold>
         or 
        <bold>without</bold>
         antimycotic-antibiotic for 1 hour at 37° C in 5% CO
        <sub>2</sub>
        . Each sample was plated on YEPD petri plates and colonies were counted.
      </p>
    </sec>
    <sec>
      <title>Reagents</title>
      <table-wrap>
        <table>
          <tbody>
            <tr>
              <td>
                <p>
                  <bold>Macrophage Cell Line</bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>Genotype</bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>Reference</bold>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>J774.A1</p>
              </td>
              <td>
                <p>Murine macrophage cell line</p>
              </td>
              <td>
                <p>Ralph and Nakoinz 1975</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>
                  <bold>Yeast Strains</bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>Genotype</bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>Reference</bold>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>DC10</p>
              </td>
              <td>
                <p>
                  <italic>Scleu2</italic>
                  ::
                  <italic>ScURA3-</italic>
                  KANMX6-
                  <italic>ScADH1</italic>
                  pr-YFP
                </p>
              </td>
              <td>
                <p>Iosue et al. 2016</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>DG234</p>
              </td>
              <td>
                <p>
                  <italic>NgURA3</italic>
                  ::
                  <italic>NgADH1</italic>
                  pr-YFP
                </p>
              </td>
              <td>
                <p>Iosue et al. 2016</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>DG383</p>
              </td>
              <td>
                <p>
                  <italic>Ngyps1</italic>
                  ΔNATMX6
                </p>
              </td>
              <td>
                <p>This study</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>DG387</p>
              </td>
              <td>
                <p>
                  <italic>Ngyps1</italic>
                  ΔNATMX6, 
                  <italic>NgURA3</italic>
                  ::
                  <italic>NgADH1</italic>
                  pr-YFP
                </p>
              </td>
              <td>
                <p>This study</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>DG370</p>
              </td>
              <td>
                <p>
                  <italic>Ngtup11</italic>
                  ΔKANMX6
                </p>
              </td>
              <td>
                <p>Bui, Iosue, and Wykoff 2022</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>DG407</p>
              </td>
              <td>
                <p>
                  <italic>Ngtup11</italic>
                  ΔKANMX6, 
                  <italic>NgURA3</italic>
                  ::
                  <italic>NgADH1</italic>
                  pr-YFP
                </p>
              </td>
              <td>
                <p>This study</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>yHSLC38</p>
              </td>
              <td>
                <p>
                  <italic>N. glabratus</italic>
                   isolated from soil mixed with berries
                </p>
              </td>
              <td>
                <p>Opulente et al. 2019</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>yHKS744</p>
              </td>
              <td>
                <p>
                  <italic>N. glabratus</italic>
                   isolated from sand/soil sample
                </p>
              </td>
              <td>
                <p>Opulente et al. 2019; Spurley et al. 2022</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>yHRVM15</p>
              </td>
              <td>
                <p>
                  <italic>N. glabratus</italic>
                   isolated from a fungus
                </p>
              </td>
              <td>
                <p>Opulente et al. 2019; Spurley et al. 2022</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>DG531</p>
              </td>
              <td>
                <p>
                  yHKS744,
                  <italic> NgURA3</italic>
                  ::
                  <italic>NgADH1</italic>
                  pr-YFP
                </p>
              </td>
              <td>
                <p>This study</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>DG532</p>
              </td>
              <td>
                <p>
                  yHRVM15,
                  <italic> NgURA3</italic>
                  ::
                  <italic>NgADH1</italic>
                  pr-YFP
                </p>
              </td>
              <td>
                <p>This study</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>
                  <bold>Plasmids</bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>Genotype</bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>Reference</bold>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>DB345</p>
              </td>
              <td>
                <p>
                  <italic>NgADH1</italic>
                  pr-YFP-pRS313
                </p>
              </td>
              <td>
                <p>Iosue et al. 2016</p>
              </td>
            </tr>
          </tbody>
        </table>
      </table-wrap>
      <table-wrap>
        <table>
          <tbody>
            <tr>
              <td>
                <p>
                  <bold>Primers to make strains</bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>Primer number</bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>Sequence</bold>
                </p>
              </td>
            </tr>
            <tr>
              <td rowspan="2">
                <p>
                  Put 
                  <italic>NgADH1</italic>
                  pr-YFP into 
                  <italic>NgURA3</italic>
                   locus (amplified from 
                  <italic>NgADH1</italic>
                  pr-YFP-pRS313 plasmid)
                </p>
              </td>
              <td>
                <p>O1528</p>
              </td>
              <td>
                <p>ctttgggtccatacatttgcttgcttaagactcatgttgaCGGTCCTAGTGTTCATACTG</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>O1529</p>
              </td>
              <td>
                <p>tcagtttcctattcttttcaagtaagcatcccagccggctcgaggcaagctaaacagatc</p>
              </td>
            </tr>
            <tr>
              <td rowspan="2">
                <p>
                  Check for integration into 
                  <italic>NgURA3</italic>
                   locus
                </p>
              </td>
              <td>
                <p>O479</p>
              </td>
              <td>
                <p>CATCGCCAATATTAACTAACATG</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>O1530</p>
              </td>
              <td>
                <p>CATTGCCTCTCATATCCGTG</p>
              </td>
            </tr>
            <tr>
              <td rowspan="2">
                <p>
                  <italic>Ngyps1</italic>
                  ΔNATMX6
                </p>
              </td>
              <td>
                <p>O2510</p>
              </td>
              <td>
                <p>ATGAAGTTTAGTTCGCTATGTATGCTGGCGTCTGTTGCTGCGGATCCCCGGGTTAATTAA</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>O2511</p>
              </td>
              <td>
                <p>AGATAAATGAAACCAAAAGACCAGCGACGAATAGCAAAGTGAATTCGAGCTCGTTTAAAC</p>
              </td>
            </tr>
            <tr>
              <td rowspan="2">
                <p>
                  Check for deletion of 
                  <italic>NgYPS1</italic>
                </p>
              </td>
              <td>
                <p>O2512</p>
              </td>
              <td>
                <p>GGCTCCCCTGCAAGGCTTGG</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>O780</p>
              </td>
              <td>
                <p>TTAATTAACCCGGGGATCCG</p>
              </td>
            </tr>
            <tr>
              <td rowspan="2">
                <p>
                  Put 
                  <italic>NgADH1</italic>
                  pr-YFP into 
                  <italic>NgURA3</italic>
                   locus (amplified from 
                  <italic>Ngura3</italic>
                  ::
                  <italic>NgADH1</italic>
                  pr-YFP genomic DNA)
                </p>
              </td>
              <td>
                <p>O2583</p>
              </td>
              <td>
                <p>GCCTCATATTTACAAAGAGC</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>O2584</p>
              </td>
              <td>
                <p>ATTTACTAGATATTACATGC</p>
              </td>
            </tr>
            <tr>
              <td rowspan="2">
                <p>
                  Put 
                  <italic>NgADH1</italic>
                  pr-YFP into 
                  <italic>NgURA3</italic>
                   locus (amplified from 
                  <italic>Ngura3</italic>
                  ::
                  <italic>NgADH1</italic>
                  pr-YFP genomic DNA)
                </p>
              </td>
              <td>
                <p>O3883</p>
              </td>
              <td>
                <p>TACACTTACAATGTCCAGTG</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>O3884</p>
              </td>
              <td>
                <p>TCTGAGAATGTACAATTCGG</p>
              </td>
            </tr>
            <tr>
              <td rowspan="2">
                <p>
                  Check for integration into 
                  <italic>NgURA3</italic>
                   locus
                </p>
              </td>
              <td>
                <p>O2520</p>
              </td>
              <td>
                <p>CTAACATGTATATAAGGTTAC</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>O2521</p>
              </td>
              <td>
                <p>CAGTATGAACACTAGGACCG</p>
              </td>
            </tr>
          </tbody>
        </table>
      </table-wrap>
    </sec>
  </body>
  <back>
    <ack>
      <sec>
        <title>Acknowledgments</title>
        <p>
          We thank James W. Wilson for the macrophage cell line and substantial advice on the assay. We also thank Dana A. Opulente for advice with the non-clinical 
          <italic>Nakaseomyces glabratus </italic>
          strains. 
        </p>
      </sec>
    </ack>
    <ref-list>
      <ref id="R1">
        <mixed-citation>
          Angoulvant, A., J. Guitard, and C. Hennequin. 2015. “Old and New Pathogenic 
          <italic>Nakaseomyces</italic>
           Species: Epidemiology, Biology, Identification, Pathogenicity and Antifungal Resistance.” 
          <italic>FEMS Yeast Research</italic>
          , December, fov114. https://doi.org/10.1093/femsyr/fov114.
        </mixed-citation>
      </ref>
      <ref id="R2">
        <mixed-citation>
          Askari, Fizza, Mubashshir Rasheed, and Rupinder Kaur. 2022. “The Yapsin Family of Aspartyl Proteases Regulate Glucose Homeostasis in 
          <italic>Candida Glabrata</italic>
          .” 
          <italic>Journal of Biological Chemistry</italic>
           298 (2): 101593. https://doi.org/10.1016/j.jbc.2022.101593.
        </mixed-citation>
      </ref>
      <ref id="R3">
        <mixed-citation>
          Bui, Lilian N., Christine L. Iosue, and Dennis D. Wykoff. 2022. “Tup1 Paralog CgTUP11 Is a Stronger Repressor of Transcription than CgTUP1 in Candida Glabrata.” 
          <italic>mSphere</italic>
           7 (2): e0076521. https://doi.org/10.1128/msphere.00765-21.
        </mixed-citation>
      </ref>
      <ref id="R4">
        <mixed-citation>
          Cormack, Brendan P., and Stanley Falkow. 1999. “Efficient Homologous and Illegitimate Recombination in the Opportunistic Yeast Pathogen Candida Glabrata.” 
          <italic>Genetics</italic>
           151 (3): 979–87.
        </mixed-citation>
      </ref>
      <ref id="R5">
        <mixed-citation>
          Corrigan, Mary W., Christine L. Kerwin-Iosue, Alexander S. Kuczmarski, Kunj B. Amin, and Dennis D. Wykoff. 2013. “The Fate of Linear DNA in Saccharomyces Cerevisiae and Candida Glabrata: The Role of Homologous and Non-Homologous End Joining.” 
          <italic>PloS One</italic>
           8 (7): e69628. https://doi.org/10.1371/journal.pone.0069628.
        </mixed-citation>
      </ref>
      <ref id="R6">
        <mixed-citation>
          Domergue, R., I. Castano, A. De Las Penas, M. Zupancic, V. Lockatell, J. R. Hebel, D. Johnson, and B. P. Cormack. 2005. “Nicotinic Acid Limitation Regulates Silencing of Candida Adhesins during UTI.” 
          <italic>Science</italic>
           308 (5723): 866–70.
        </mixed-citation>
      </ref>
      <ref id="R7">
        <mixed-citation>Gabaldón Estevan, Juan Antonio, Tiphaine Martin, Marina Marcet Houben, Pascal Durrens, Monique Bolotin Fukuhara, Olivier Lespinet, Sylvie Arnaise, et al. 2013. “Comparative Genomics of Emerging Pathogens in the Candida Glabrata Clade.” https://doi.org/10.1186/1471-2164-14-623.</mixed-citation>
      </ref>
      <ref id="R8">
        <mixed-citation>
          Iosue, Christine L., Nicholas Attanasio, Noor F. Shaik, Erin M. Neal, Sarah G. Leone, Brian J. Cali, Michael T. Peel, Amanda M. Grannas, and Dennis D. Wykoff. 2016. “Partial Decay of Thiamine Signal Transduction Pathway Alters Growth Properties of Candida Glabrata.” Edited by Michael Polymenis. 
          <italic>PLOS ONE</italic>
           11 (3): e0152042. https://doi.org/10.1371/journal.pone.0152042.
        </mixed-citation>
      </ref>
      <ref id="R9">
        <mixed-citation>
          Katsipoulaki, Myrto, Mark H. T. Stappers, Dhara Malavia-Jones, Sascha Brunke, Bernhard Hube, and Neil A. R. Gow. 2024. “Candida Albicans and Candida Glabrata: Global Priority Pathogens.” 
          <italic>Microbiology and Molecular Biology Reviews</italic>
           0 (0): e00021-23. https://doi.org/10.1128/mmbr.00021-23.
        </mixed-citation>
      </ref>
      <ref id="R10">
        <mixed-citation>
          Kaur, Rupinder, Biao Ma, and Brendan P. Cormack. 2007. “A Family of Glycosylphosphatidylinositol-Linked Aspartyl Proteases Is Required for Virulence of Candida Glabrata.” 
          <italic>Proceedings of the National Academy of Sciences of the United States of America</italic>
           104 (18): 7628–33. https://doi.org/10.1073/pnas.0611195104.
        </mixed-citation>
      </ref>
      <ref id="R11">
        <mixed-citation>
          Kumar, Kundan, Fizza Askari, Mahima Sagar Sahu, and Rupinder Kaur. 2019. “Candida Glabrata: A Lot More Than Meets the Eye.” 
          <italic>Microorganisms</italic>
           7 (2): 39. https://doi.org/10.3390/microorganisms7020039.
        </mixed-citation>
      </ref>
      <ref id="R12">
        <mixed-citation>
          Opulente, Dana A., Quinn K. Langdon, Kelly V. Buh, Max A. B. Haase, Kayla Sylvester, Ryan V. Moriarty, Martin Jarzyna, Samantha L. Considine, Rachel M. Schneider, and Chris Todd Hittinger. 2019. “Pathogenic Budding Yeasts Isolated Outside of Clinical Settings.” 
          <italic>FEMS Yeast Research</italic>
           19 (3): foz032. https://doi.org/10.1093/femsyr/foz032.
        </mixed-citation>
      </ref>
      <ref id="R13">
        <mixed-citation>
          Ralph, P., and I. Nakoinz. 1975. “Phagocytosis and Cytolysis by a Macrophage Tumour and Its Cloned Cell Line.” 
          <italic>Nature</italic>
           257 (5525): 393–94. https://doi.org/10.1038/257393a0.
        </mixed-citation>
      </ref>
      <ref id="R14">
        <mixed-citation>
          Spurley, William J., Kaitlin J. Fisher, Quinn K. Langdon, Kelly V. Buh, Martin Jarzyna, Max A. B. Haase, Kayla Sylvester, et al. 2022. “Substrate, Temperature, and Geographical Patterns among Nearly 2,000 Natural Yeast Isolates.” 
          <italic>Yeast (Chichester, England)</italic>
           39 (1–2): 55–68. https://doi.org/10.1002/yea.3679.
        </mixed-citation>
      </ref>
    </ref-list>
  </back>
</article>