Insulin/IGF signaling (IIS) inhibits the nuclear localization of the DAF-16/FOXO transcription factor to regulate longevity and stress resistance in C. elegans. In the intestine, IIS promotes DAF-16 localization to endosomes and loss of TBC-2, a RAB-5 GAP, results in increased endomembrane localization of DAF-16 at the expense of nuclear localization, decreased DAF-16 target gene expression, longevity and stress resistance. Here we found that TBC-2 differentially regulates the localization of the IIS-regulated transcription factors PQM-1 and HLH-30/TFEB. Our results suggest a broader role for TBC-2 in regulating IIS and that TBC-2 likely functions at an upstream point in the IIS pathway.
","acknowledgements":"We would like to thank Jung Hwa Seo for technical assistance. We thank Kerry Kornfeld and Abhinav Diwan (Washington University) and Jeremy Van Raamsdonk (McGill University) for sharing strains and RNAi clones. Wormbase (wormbase.org) and Alliance of Genome Resources (alliancegenome.org) were critical knowledgebases for project conception and experimental design. Some strains were provided by the Caenorhabditis Genetics Center (CGC), which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
","authors":[{"affiliations":["McGill University, Montreal, QC, Canada"],"departments":["Department of Anatomy and Cell Biology"],"credit":["conceptualization","formalAnalysis","writing_originalDraft","investigation","writing_reviewEditing"],"email":"soumyendu.saha@mail.mcgill.ca","firstName":"Soumyendu","lastName":"Saha","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["McGill University, Montreal, QC, Canada"],"departments":["Department of Anatomy and Cell Biology"],"credit":["conceptualization","investigation"],"email":"icten.meras@mail.mcgill.ca","firstName":"Icten","lastName":"Meras","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["McGill University, Montreal, QC, Canada","RI-MUHC, Montreal, QC, CA","McGill University, Montreal, QC, Canada"],"departments":["Division of Endocrinology and Metabolism, Department of Medicine","Metabolic Disorders and Complications Program","Department of Anatomy and Cell Biology"],"credit":["conceptualization","fundingAcquisition","supervision","writing_reviewEditing"],"email":"christian.rocheleau@mcgill.ca","firstName":"Christian E.","lastName":"Rocheleau","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-6738-5636"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work was funded by a Canadian Institutes of Health Research (CIHR) Project Grants PJT-159725 and PTJ-191910 to CER. SS was funded by a studentship from the Division of Endocrinology and Metabolism and the MUHC Metabolic Centre of Excellence Grants Program.
","image":{"url":"https://portal.micropublication.org/uploads/776764b202c40bf3b73fdab4f4707606.png"},"imageCaption":"(A - A') Representative confocal images of PQM-1::GFP in the intestine of wild type and tbc-2(tm2241) mutants showing nuclear (n) and endomembrane localization (yellow arrow). ^ denotes autofluorescent gut granules. (B, C) Bar graphs showing the percent animals with PQM-1::GFP localization to endomembranes (B) and the nucleus (C). Experimental triplicates with 30-50 animals per replicate. (D) Box and scatter graph representing the ratio of nuclear to cytosolic fluorescence intensity of PQM-1::GFP in wild type (n=26) and tbc-2(tm2241) mutants (n =29), each data point is an individual intestinal cell. (E-E') Representative confocal images of HLH-30::GFP in the intestine of wild type and tbc-2(tm2241). Nuclear (n) and endomembrane localization (yellow arrows). (F, G) Bar graphs showing the percent animals with endomembrane localization of HLH-30::GFP (F), and HLH-30::RFP (G) in wild type and tbc-2(tm2241) mutants. Experimental replicates with 30-60 animals per replicate. (H, I) Box and scatter graphs representing the ratio of nuclear to cytosolic fluorescence intensity of HLH-30::GFP (H) and HLH-30::RFP (I) in wild type and tbc-2(tm2241) mutants, n > 20 for each condition. (J) Bar graph showing the fold change in lgg-1 mRNA expression levels between wild type and tbc-2(tm2241) mutant, in 3 biological replicates. (K-K”) Representative confocal images DAF-16::GFP and HLH-30::RFP colocalization in tbc-2(tm2241) as shown by the yellow arrow. ^ marks the auto fluorescent gut granules and n denotes nuclei. (L) Bar graph showing the percent animals with endosomal HLH-30::GFP in the tbc-2(tm2241) background, fed control (ev, empty vector) RNAi or RNAi targeting components of the IIS pathway. Each replicate represents >25 worms per condition. Paired Student T-test was used to analyse data in (B, C, F, G, J, and L) and unpaired Student T-test was used to analyse data in (D, H, and I). Scale bar, 10 mm. *P < 0.05, **P<0.01 and ****P<0.0001.
","imageTitle":"TBC-2 regulates the localization of PQM-1 and HLH-30
","methods":"Worms were maintained at 20°C on NGM plates as described in WormBook (www.wormbook.org). The strains were fed HB101 E. coli as a food source.
For RNAi feeding experiments fourth larval stage (L4) worms were placed on RNAi plates and transferred to fresh plates each day for 3 days. L4 progeny from the day 3 plates were scored for the experiment. RNAi feeding clones were obtained from the Ahringer RNAi library (Kamath et al., 2001). pdk-1 RNAi clone (pQcSS01) was generated by PCR of worm lysates using primers SSA38 5' -CAACTAAGATCTATTTCGTGATCGGACTTGTTG – 3' and SSA395' – GTCATACTCGAGGCTAGCATCATTTCCCAAATTCATC -3' and ligated to the L4440 vector from Addgene (https://www.addgene.org/1654/).
Live imaging of the L4 hermaphrodite worms was done at room temperature. The worms were transferred to a 2% agarose pad and immobilized with 10 mM levamisole. They were scored for nuclear or endosome localization of PQM-1, DAF-16 and HLH-30 under the fluorescent ZeissA1 axio Imager. To measure the fluorescence intensity of nuclear PQM-1 and HLH-30 L4 worms were imaged using a Zeiss Axio Observer Z1 LSM780 laser scanning confocal microscope in the Molecular Imaging Platform of the RI-MUHC. Image analysis was performed using Fiji (ImageJ).
For qualitative RT PCR, RNA was extracted from young adult C. elegans using TRIZOL as explained in (Meras et al., 2022). LGG-1 was amplified using forward primer 5' – ACCCAGACCGTATTCCAGTG -3' and reverse primer 5' – ACGAAGTTGGATGCGTTTTC -3'.
","reagents":"Strain | Genotype | Source |
Wild type Bristol Strain | CGC | |
(Chotard et al., 2010) | ||
unc-119(tm4063) III; wgIs201[pqm-1::TY1::EGFP::3xFLAG(92C12) +unc-119(+)] | CGC | |
tbc-2(tm2241) II; wgIs201[pqm-1::TY1::EGFP::3xFLAG(92C12 + unc-119(+)] | This study | |
CGC | ||
| tbc-2(tm2241) II; jinEx10 [hlh-30p::hlh-30::GFP + rol-6(su1006)] | This study |
(Murphy et al., 2019) | ||
This study | ||
daf-16(hq23[DAF-16::GFP]) I; tbc-2(tm2241) II;;hlh-30p::HLH-30::RFP+ rol-6(su1006) | This study |
RNAi clone | Gene | Source |
L4440 | Empty vector control | (Timmons & Fire, 1998) |
III-7G12 | (Kamath et al., 2003) | |
II-7J02 | (Kamath et al., 2003) | |
V-7I17 | (Kamath et al., 2003) | |
I-5M24 | (Fraser et al., 2000) | |
pQcSS01 | This study |
Insulin/Insulin-like Growth Factor (IGF) signaling (IIS) is an evolutionarily conserved regulator of metabolism (Barbieri et al., 2003; Murphy & Hu, 2013). In C. elegans, the IIS pathway regulates lifespan, fat storage and resistance to various stresses (Friedman & Johnson, 1988; Kenyon et al., 1993; Kimura et al., 1997; Lithgow et al., 1994; Murphy & Hu, 2013; Ogg et al., 1997). The core pathway is defined by the DAF-2 insulin/IGF receptor, the AGE-1 class I PI3 kinase which generates PI(3,4,5)P which in turn recruits PDK-1 and AKT-1/2 kinases to the plasma membrane where PDK-1 phosphorylates and activates AKT-1/2. A major target of C. elegans IIS is the inhibition of the DAF-16/FOXO transcription (Kimura et al., 1997; Lin et al., 1997; Morris et al., 1996; Ogg et al., 1997; Paradis et al., 1999; Paradis & Ruvkun, 1998). Phosphorylation of FOXO transcription factors by AKT kinases results in cytoplasmic sequestration (Brunet et al., 1999).
The C. elegans intestine, while only 20 cells, is a major metabolic organ and site of many IIS-mediated functions (McGhee, 2007; Murphy & Hu, 2013; Zhang et al., 2022). We previously demonstrated that DAF-16 localizes to endosomes in the intestinal cells (Meras et al., 2022). Interestingly, DAF-16 positive endosomes are not present in every cell or every animal and can vary from just a few to hundreds. We found that TBC-2 regulates DAF-16 localization. TBC-2 is a RAB-5 GTPase Activating Protein (GAP) that regulates early to late endosome maturation (Chotard et al., 2010). In tbc-2(tm2241) deletion mutants, DAF-16 localizes to irregularly shaped endomembranes to a greater extent than wild type and at the expense of nuclear localization (Meras et al., 2022). As such, TBC-2 antagonizes IIS-mediated gene expression, longevity, fat storage and resistance to several stresses (Meras et al., 2022; Traa et al., 2023). To determine if this localization was specific to DAF-16 we looked at two additional transcription factors that are differentially regulated by IIS, PQM-1 and HLH-30.
PQM-1 is a zinc finger transcription factor required for the long lifespan of daf-2 mutants (Tepper et al., 2013). Localization of PQM-1 is opposite that of DAF-16 whereby IIS promotes nuclear localization of PQM-1 while it antagonizes DAF-16 (Tepper et al., 2013). In tbc-2(-) animals, PQM-1::GFP showed some localization to endomembranes (Figure 1A-A', B). Despite the endomembrane localization of PQM-1, there was a significant increase in the number of animals with nuclear localized PQM-1 and an increase in the nuclear to cytosolic fluorescence intensity ratio of PQM-1 in tbc-2(-) mutants as compared to wild type (Figure 1C, D). This corroborates with the antagonistic genetic relation between PQM-1 with DAF-16 localization (Tepper et al., 2013) and is consistent with our previous finding that tbc-2 mutants had increased expression of vha-6, a PQM-1 target (Meras et al., 2022).
HLH-30 or TFEB (Transcription factor EB) is a transcription factor involved in lysosomal biogenesis and acts in a combinatorial manner with DAF-16 in response to the starvation stress (Lapierre et al., 2013; Lin et al., 2018; O'Rourke & Ruvkun, 2013). In wild type we observed HLH-30::GFP was mostly nuclear with some cytoplasmic and endomembrane localization. In tbc-2(-) mutants, using both GFP and RFP tagged HLH-30 we observed an increase in the number of animals with HLH-30 localized to endomembranes (Figure 1E-E', F, G). Like DAF-16, HLH-30 showed reduced nuclear to cytosolic fluorescence intensity in tbc-2 mutant animals (Figure 1H,I). To test if the reduced nuclear localization of HLH-30 affected downstream HLH-30 dependent gene expression, we analysed the mRNA expression of lgg-1. LGG-1 is ATG8 in yeast and LC3 in mammals and is responsible for autophagosome formation (Melendez et al., 2003). LGG-1 expression is dependent on HLH-30, such that lgg-1 mRNA levels are suppressed in hlh-30(RNAi) (Lapierre et al., 2013). There was a significant decrease in the lgg-1 mRNA levels in tbc-2(tm2241) mutants consistent with the reduced nuclear localization of HLH-30 (Figure 1J).
We observed both DAF-16 and HLH-30 co-localized on endomembranes in tbc-2(-) mutants indicating that TBC-2 might regulate these transcription factors by a common underlying mechanism (Figure 1 K-K”). To test if IIS regulates HLH-30 localization on endosomes as seen with DAF-16 (Meras et al., 2022), we use RNAi to systematically knock down components of the IIS pathway- DAF-2, AGE-1, PDK-1, AKT-1 and DAF-16 in tbc-2(-); HLH-30::GFP animals. Compared to empty vector control, RNAi mediated knock-down of daf-2, age-1 and akt-1 significantly decreased the number of tbc-2(-) mutant animals with HLH-30 on endomembranes (Figure 1L). pdk-1(RNAi) significantly suppressed HLH-30 endomembrane localization in three of four experiments (Figure 1L). daf-16 RNAi did not decrease the endomembrane localization of HLH-30 (Figure 1J). Thus, IIS signaling promotes the localization of HLH-30 to endomembrane compartments as it does with DAF-16.
Here we found that TBC-2 regulates the localization of HLH-30 and PQM-1 transcription factors. HLH-30 and DAF-16 are negatively regulated by phosphorylation and binding of 14-3-3 proteins that sequester them in the cytoplasm. The increased nuclear localization of PQM-1 in tbc-2(tm2241) mutant background could be a secondary effect of TBC-2 negatively affecting the DAF-16 localization (Tepper et al., 2013). The fact that TBC-2 regulates HLH-30 and PQM-1 in addition to DAF-16 suggests that TBC-2 antagonizes IIS at a point upstream of HLH-30, DAF-16 and PQM-1.
","references":[{"reference":"Barbieri M, Bonafè M, Franceschi C, Paolisso G. 2003. Insulin/IGF-I-signaling pathway: an evolutionarily conserved mechanism of longevity from yeast to humans. American Journal of Physiology-Endocrinology and Metabolism 285: E1064-E1071.
","pubmedId":"","doi":"10.1152/ajpendo.00296.2003"},{"reference":"Brunet A, Bonni A, Zigmond MJ, Lin MZ, Juo P, Hu LS, et al., Greenberg. 1999. Akt Promotes Cell Survival by Phosphorylating and Inhibiting a Forkhead Transcription Factor. Cell 96: 857-868.
","pubmedId":"","doi":"10.1016/s0092-8674(00)80595-4"},{"reference":"Chotard L, Mishra AK, Sylvain MA, Tuck S, Lambright DG, Rocheleau CE. 2010. TBC-2 Regulates RAB-5/RAB-7-mediated Endosomal Trafficking in Caenorhabditis elegans. Molecular Biology of the Cell 21: 2285-2296.
","pubmedId":"","doi":"10.1091/mbc.E09-11-0947"},{"reference":"Fraser AG, Kamath RS, Zipperlen P, Martinez-Campos M, Sohrmann M, Ahringer J. 2000. Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature 408: 325-330.
","pubmedId":"","doi":"10.1038/35042517"},{"reference":"Friedman DB, Johnson TE. 1988. A mutation in the age-1 gene in Caenorhabditis elegans lengthens life and reduces hermaphrodite fertility.. Genetics 118: 75-86.
","pubmedId":"","doi":"10.1093/genetics/118.1.75"},{"reference":"Kamath RS, Fraser AG, Dong Y, Poulin G, Durbin R, Gotta M, et al., Ahringer. 2003. Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421: 231-237.
","pubmedId":"","doi":"10.1038/nature01278"},{"reference":"Kamath RS, Martinez-Campos M, Zipperlen P, Fraser AG, Ahringer J. 2000. Effectiveness of specific RNA-mediated interference through ingested double-stranded RNA in Caenorhabditis elegans. Genome Biology 2: 10.1186/gb-2000-2-1-research0002.
","pubmedId":"","doi":"10.1186/gb-2000-2-1-research0002"},{"reference":"Kenyon C, Chang J, Gensch E, Rudner A, Tabtiang R. 1993. A C. elegans mutant that lives twice as long as wild type. Nature 366: 461-464.
","pubmedId":"","doi":"10.1038/366461a0"},{"reference":"Kimura KD, Tissenbaum HA, Liu Y, Ruvkun G. 1997. daf-2\n , an Insulin Receptor-Like Gene That Regulates Longevity and Diapause in\n Caenorhabditis elegans. Science 277: 942-946.
","pubmedId":"","doi":"10.1126/science.277.5328.942"},{"reference":"Lapierre LR, De Magalhaes Filho CD, McQuary PR, Chu CC, Visvikis O, Chang JT, et al., Hansen. 2013. The TFEB orthologue HLH-30 regulates autophagy and modulates longevity in Caenorhabditis elegans. Nature Communications 4: 10.1038/ncomms3267.
","pubmedId":"","doi":"10.1038/ncomms3267"},{"reference":"Lin K, Dorman JB, Rodan A, Kenyon C. 1997. daf-16\n : An HNF-3/forkhead Family Member That Can Function to Double the Life-Span of\n Caenorhabditis elegans. Science 278: 1319-1322.
","pubmedId":"","doi":"10.1126/science.278.5341.1319"},{"reference":"Lin XX, Sen I, Janssens GE, Zhou X, Fonslow BR, Edgar D, et al., Riedel. 2018. DAF-16/FOXO and HLH-30/TFEB function as combinatorial transcription factors to promote stress resistance and longevity. Nature Communications 9: 10.1038/s41467-018-06624-0.
","pubmedId":"","doi":"10.1038/s41467-018-06624-0"},{"reference":"Lithgow GJ, White TM, Hinerfeld DA, Johnson TE. 1994. Thermotolerance of a Long-lived Mutant of Caenorhabditis elegans. Journal of Gerontology 49: B270-B276.
","pubmedId":"","doi":"10.1093/geronj/49.6.b270"},{"reference":"McGhee J. 2007. The C. elegans intestine. WormBook : 10.1895/wormbook.1.133.1.
","pubmedId":"","doi":"10.1895/wormbook.1.133.1"},{"reference":"Meléndez A, Tallóczy Z, Seaman M, Eskelinen EL, Hall DH, Levine B. 2003. Autophagy Genes Are Essential for Dauer Development and Life-Span Extension in\n C. elegans. Science 301: 1387-1391.
","pubmedId":"","doi":"10.1126/science.1087782"},{"reference":"Meraş I, Chotard L, Liontis T, Ratemi Z, Wiles B, Seo JH, Van Raamsdonk JM, Rocheleau CE. 2022. The Rab GTPase activating protein TBC-2 regulates endosomal localization of DAF-16 FOXO and lifespan. PLOS Genetics 18: e1010328.
","pubmedId":"","doi":"10.1371/journal.pgen.1010328"},{"reference":"Morris JZ, Tissenbaum HA, Ruvkun G. 1996. A phosphatidylinositol-3-OH kinase family member regulating longevity and diapause in Caenorhabditis elegans. Nature 382: 536-539.
","pubmedId":"","doi":"10.1038/382536a0"},{"reference":"Murphy CT. 2013. Insulin/insulin-like growth factor signaling in C. elegans. WormBook : 1-43.
","pubmedId":"","doi":"10.1895/wormbook.1.164.1"},{"reference":"Murphy JT, Liu H, Ma X, Shaver A, Egan BM, Oh C, et al., Diwan. 2019. Simple nutrients bypass the requirement for HLH-30 in coupling lysosomal nutrient sensing to survival. PLOS Biology 17: e3000245.
","pubmedId":"","doi":"10.1371/journal.pbio.3000245"},{"reference":"O’Rourke EJ, Ruvkun G. 2013. MXL-3 and HLH-30 transcriptionally link lipolysis and autophagy to nutrient availability. Nature Cell Biology 15: 668-676.
","pubmedId":"","doi":"10.1038/ncb2741"},{"reference":"Ogg S, Paradis S, Gottlieb S, Patterson GI, Lee L, Tissenbaum HA, Ruvkun G. 1997. The Fork head transcription factor DAF-16 transduces insulin-like metabolic and longevity signals in C. elegans. Nature 389: 994-999.
","pubmedId":"","doi":"10.1038/40194"},{"reference":"Paradis S, Ailion M, Toker A, Thomas JH, Ruvkun G. 1999. A PDK1 homolog is necessary and sufficient to transduce AGE-1 PI3 kinase signals that regulate diapause in Caenorhabditis elegans. Genes & Development 13: 1438-1452.
","pubmedId":"","doi":"10.1101/gad.13.11.1438"},{"reference":"Paradis S, Ruvkun G. 1998. Caenorhabditis elegans Akt/PKB transduces insulin receptor-like signals from AGE-1 PI3 kinase to the DAF-16 transcription factor. Genes & Development 12: 2488-2498.
","pubmedId":"","doi":"10.1101/gad.12.16.2488"},{"reference":"Tepper RG, Ashraf J, Kaletsky R, Kleemann G, Murphy CT, Bussemaker HJ. 2013. PQM-1 Complements DAF-16 as a Key Transcriptional Regulator of DAF-2-Mediated Development and Longevity. Cell 154: 676-690.
","pubmedId":"","doi":"10.1016/j.cell.2013.07.006"},{"reference":"Timmons L, Fire A. 1998. Specific interference by ingested dsRNA. Nature 395: 854-854.
","pubmedId":"","doi":"10.1038/27579"},{"reference":"Traa A, Soo SK, AlOkda A, Ko B, Rocheleau CE, Van Raamsdonk JM. 2023. Endosomal trafficking protein
Zhang YP, Zhang WH, Zhang P, Li Q, Sun Y, Wang JW, et al., Dong. 2022. Intestine-specific removal of DAF-2 nearly doubles lifespan in Caenorhabditis elegans with little fitness cost. Nature Communications 13: 10.1038/s41467-022-33850-4.
","pubmedId":"","doi":"10.1038/s41467-022-33850-4"}],"title":"TBC-2, a Rab GTPase activating protein, regulates the localization of the HLH-30/TFEB and PQM-1 transcription factors in the C. elegans intestine
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null}]},{"id":"f9828d5e-26bc-4789-b963-00328259da45","decision":"revise","abstract":"Insulin/IGF signaling (IIS) inhibits the nuclear localization of the DAF-16/FOXO transcription factor to regulate longevity and stress resistance in C. elegans. In the intestine, IIS promotes DAF-16 localization to endosomes and loss of TBC-2, a RAB-5 GAP, results in increased endomembrane localization of DAF-16 at the expense of nuclear localization, decreased DAF-16 target gene expression, longevity and stress resistance. Here we found that TBC-2 differentially regulates the localization of the IIS-regulated transcription factors PQM-1 and HLH-30/TFEB. Our results suggest a broader role for TBC-2 in regulating IIS and that TBC-2 likely functions at an upstream point in the IIS pathway.
","acknowledgements":"We would like to thank Jung Hwa Seo for technical assistance. We thank Kerry Kornfeld and Abhinav Diwan (Washington University) and Jeremy Van Raamsdonk (McGill University) for sharing strains and RNAi clones. Wormbase (wormbase.org) and Alliance of Genome Resources (alliancegenome.org) were critical knowledgebases for project conception and experimental design. Some strains were provided by the Caenorhabditis Genetics Center (CGC), which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
","authors":[{"affiliations":["McGill University, Montreal, QC, Canada"],"departments":["Department of Anatomy and Cell Biology"],"credit":["conceptualization","formalAnalysis","writing_originalDraft","investigation","writing_reviewEditing"],"email":"soumyendu.saha@mail.mcgill.ca","firstName":"Soumyendu","lastName":"Saha","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["McGill University, Montreal, QC, Canada"],"departments":["Department of Anatomy and Cell Biology"],"credit":["conceptualization","investigation"],"email":"icten.meras@mail.mcgill.ca","firstName":"Icten","lastName":"Meras","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["McGill University, Montreal, QC, Canada","RI-MUHC, Montreal, QC, CA","McGill University, Montreal, QC, Canada"],"departments":["Division of Endocrinology and Metabolism, Department of Medicine","Metabolic Disorders and Complications Program","Department of Anatomy and Cell Biology"],"credit":["conceptualization","fundingAcquisition","supervision","writing_reviewEditing"],"email":"christian.rocheleau@mcgill.ca","firstName":"Christian E.","lastName":"Rocheleau","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-6738-5636"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work was funded by a Canadian Institutes of Health Research (CIHR) Project Grants PJT-159725 and PTJ-191910 to CER. SS was funded by a studentship from the Division of Endocrinology and Metabolism and the MUHC Metabolic Centre of Excellence Grants Program.
","image":{"url":"https://portal.micropublication.org/uploads/776764b202c40bf3b73fdab4f4707606.png"},"imageCaption":"(A - A') Representative confocal images of PQM-1::GFP in the intestine of wild type and tbc-2(tm2241) mutants showing nuclear (n) and endomembrane localization (yellow arrow). ^ denotes autofluorescent gut granules. (B, C) Bar graphs showing the percent animals with PQM-1::GFP localization to endomembranes (B) and the nucleus (C). Experimental triplicates with 30-50 animals per replicate. (D) Box and scatter graph representing the ratio of nuclear to cytosolic fluorescence intensity of PQM-1::GFP in wild type (n=26) and tbc-2(tm2241) mutants (n =29), each data point is an individual intestinal cell. (E-E') Representative confocal images of HLH-30::GFP in the intestine of wild type and tbc-2(tm2241). Nuclear (n) and endomembrane localization (yellow arrows). (F, G) Bar graphs showing the percent animals with endomembrane localization of HLH-30::GFP (F), and HLH-30::RFP (G) in wild type and tbc-2(tm2241) mutants. Experimental replicates with 30-60 animals per replicate. (H, I) Box and scatter graphs representing the ratio of nuclear to cytosolic fluorescence intensity of HLH-30::GFP (H) and HLH-30::RFP (I) in wild type and tbc-2(tm2241) mutants, n > 20 for each condition. (J) Bar graph showing the fold change in lgg-1 mRNA expression levels between wild type and tbc-2(tm2241) mutant, in 3 biological replicates. (K-K”) Representative confocal images DAF-16::GFP and HLH-30::RFP colocalization in tbc-2(tm2241) as shown by the yellow arrow. ^ marks the auto fluorescent gut granules and n denotes nuclei. (L) Bar graph showing the percent animals with endosomal HLH-30::GFP in the tbc-2(tm2241) background, fed control (ev, empty vector) RNAi or RNAi targeting components of the IIS pathway. Each replicate represents >25 worms per condition. Paired Student T-test was used to analyse data in (B, C, F, G, J, and L) and unpaired Student T-test was used to analyse data in (D, H, and I). Scale bar, 10 mm. *P < 0.05, **P<0.01 and ****P<0.0001.
","imageTitle":"TBC-2 regulates the localization of PQM-1 and HLH-30
","methods":"Worms were maintained at 20°C on NGM plates as described in WormBook (www.wormbook.org). The strains were fed HB101 E. coli as a food source.
For RNAi feeding experiments fourth larval stage (L4) worms were placed on RNAi plates and transferred to fresh plates each day for 3 days. L4 progeny from the day 3 plates were scored for the experiment. RNAi feeding clones were obtained from the Ahringer RNAi library (Kamath et al., 2001). pdk-1 RNAi clone (pQcSS01) was generated by PCR of worm lysates using primers SSA38 5' -CAACTAAGATCTATTTCGTGATCGGACTTGTTG – 3' and SSA395' – GTCATACTCGAGGCTAGCATCATTTCCCAAATTCATC -3' and ligated to the L4440 vector from Addgene (https://www.addgene.org/1654/).
Live imaging of the L4 hermaphrodite worms was done at room temperature. The worms were transferred to a 2% agarose pad and immobilized with 10 mM levamisole. They were scored for nuclear or endosome localization of PQM-1, DAF-16 and HLH-30 under the fluorescent ZeissA1 axio Imager. To measure the fluorescence intensity of nuclear PQM-1 and HLH-30 L4 worms were imaged using a Zeiss Axio Observer Z1 LSM780 laser scanning confocal microscope in the Molecular Imaging Platform of the RI-MUHC. Image analysis was performed using Fiji (ImageJ).
For qualitative RT PCR, RNA was extracted from young adult C. elegans using TRIZOL as explained in (Meras et al., 2022). LGG-1 was amplified using forward primer 5' – ACCCAGACCGTATTCCAGTG -3' and reverse primer 5' – ACGAAGTTGGATGCGTTTTC -3'.
","reagents":"Strain | Genotype | Source |
Wild type Bristol Strain | CGC | |
(Chotard et al., 2010) | ||
unc-119(tm4063) III; wgIs201[pqm-1::TY1::EGFP::3xFLAG(92C12) +unc-119(+)] | CGC | |
tbc-2(tm2241) II; wgIs201[pqm-1::TY1::EGFP::3xFLAG(92C12 + unc-119(+)] | This study | |
CGC | ||
| tbc-2(tm2241) II; jinEx10 [hlh-30p::hlh-30::GFP + rol-6(su1006)] | This study |
(Murphy et al., 2019) | ||
This study | ||
daf-16(hq23[DAF-16::GFP]) I; tbc-2(tm2241) II;;hlh-30p::HLH-30::RFP+ rol-6(su1006) | This study |
RNAi clone | Gene | Source |
L4440 | Empty vector control | (Timmons & Fire, 1998) |
III-7G12 | (Kamath et al., 2003) | |
II-7J02 | (Kamath et al., 2003) | |
V-7I17 | (Kamath et al., 2003) | |
I-5M24 | (Fraser et al., 2000) | |
pQcSS01 | This study |
Insulin/Insulin-like Growth Factor (IGF) signaling (IIS) is an evolutionarily conserved regulator of metabolism (Barbieri et al., 2003; Murphy & Hu, 2013). In C. elegans, the IIS pathway regulates lifespan, fat storage and resistance to various stresses (Friedman & Johnson, 1988; Kenyon et al., 1993; Kimura et al., 1997; Lithgow et al., 1994; Murphy & Hu, 2013; Ogg et al., 1997). The core pathway is defined by the DAF-2 insulin/IGF receptor, the AGE-1 class I PI3 kinase which generates PI(3,4,5)P which in turn recruits PDK-1 and AKT-1/2 kinases to the plasma membrane where PDK-1 phosphorylates and activates AKT-1/2. A major target of C. elegans IIS is the inhibition of the DAF-16/FOXO transcription (Kimura et al., 1997; Lin et al., 1997; Morris et al., 1996; Ogg et al., 1997; Paradis et al., 1999; Paradis & Ruvkun, 1998). Phosphorylation of FOXO transcription factors by AKT kinases results in cytoplasmic sequestration (Brunet et al., 1999).
The C. elegans intestine, while only 20 cells, is a major metabolic organ and site of many IIS-mediated functions (McGhee, 2007; Murphy & Hu, 2013; Zhang et al., 2022). We previously demonstrated that DAF-16 localizes to endosomes in the intestinal cells (Meras et al., 2022). Interestingly, DAF-16 positive endosomes are not present in every cell or every animal and can vary from just a few to hundreds. We found that TBC-2 regulates DAF-16 localization. TBC-2 is a RAB-5 GTPase Activating Protein (GAP) that regulates early to late endosome maturation (Chotard et al., 2010). In tbc-2(tm2241) deletion mutants, DAF-16 localizes to irregularly shaped endomembranes to a greater extent than wild type and at the expense of nuclear localization (Meras et al., 2022). As such, TBC-2 antagonizes IIS-mediated gene expression, longevity, fat storage and resistance to several stresses (Meras et al., 2022; Traa et al., 2023). To determine if this localization was specific to DAF-16 we looked at two additional transcription factors that are differentially regulated by IIS, PQM-1 and HLH-30.
PQM-1 is a zinc finger transcription factor required for the long lifespan of daf-2 mutants (Tepper et al., 2013). Localization of PQM-1 is opposite that of DAF-16 whereby IIS promotes nuclear localization of PQM-1 while it antagonizes DAF-16 (Tepper et al., 2013). In tbc-2(-) animals, PQM-1::GFP showed some localization to endomembranes (Figure 1A-A’, B). Despite the endomembrane localization of PQM-1, there was a significant increase in the number of animals with nuclear localized PQM-1 and an increase in the nuclear to cytosolic fluorescence intensity ratio of PQM-1 in tbc-2(-) mutants as compared to wild type (Figure 1C, D). This corroborates with the antagonistic genetic relation between PQM-1 with DAF-16 localization (Tepper et al., 2013).
HLH-30 or TFEB (Transcription factor EB) is a transcription factor involved in lysosomal biogenesis and acts in a combinatorial manner with DAF-16 in response to the starvation stress (Lapierre et al., 2013; Lin et al., 2018; O'Rourke & Ruvkun, 2013). In wild type we observed HLH-30::GFP was mostly nuclear with some cytoplasmic and endomembrane localization. In tbc-2(-) mutants, using both GFP and RFP tagged HLH-30 we observed an increase in the number of animals with HLH-30 localized to endomembranes (Figure 1E-E’, F, G). Like DAF-16, HLH-30 showed reduced nuclear to cytosolic fluorescence intensity in tbc-2 mutant animals (Figure 1H,I). To test if the reduced nuclear localization of HLH-30 affected downstream HLH-30 dependent gene expression, we analysed the mRNA expression of lgg-1. LGG-1 is ATG8 in yeast and LC3 in mammals and is responsible for autophagosome formation (Melendez et al., 2003). LGG-1 expression is dependent on HLH-30, such that lgg-1 mRNA levels are suppressed in hlh-30(RNAi) (Lapierre et al., 2013). There was a significant decrease in the lgg-1 mRNA levels in tbc-2(tm2241) mutants consistent with the reduced nuclear localization of HLH-30 (Figure 1J).
We observed both DAF-16 and HLH-30 co-localized on endomembranes in tbc-2(-) mutants indicating that TBC-2 might regulate these transcription factors by a common underlying mechanism (Figure 1 K-K”). To test if IIS regulates HLH-30 localization on endosomes as seen with DAF-16 (Meras et al., 2022), we use RNAi to systematically knock down components of the IIS pathway- DAF-2, AGE-1, PDK-1, AKT-1 and DAF-16 in tbc-2(-); HLH-30::GFP animals. Compared to empty vector control, RNAi mediated knock-down of daf-2, age-1 and akt-1 significantly decreased the number of tbc-2(-) mutant animals with HLH-30 on endomembranes (Figure 1L). pdk-1(RNAi) significantly suppressed HLH-30 endomembrane localization in three of four experiments (Figure 1L). daf-16 RNAi did not decrease the endomembrane localization of HLH-30 (Figure 1J). Thus, IIS signaling promotes the localization of HLH-30 to endomembrane compartments as it does with DAF-16.
In conclusion, this study builds upon our previous findings that TBC-2 regulates DAF-16 localization to endomembranes (Meras et al., 2022). We demonstrated that TBC-2 regulates the localization of two additional IIS regulated transcription factors, HLH-30 and PQM-1, further supporting a role for TBC-2 in antagonizing IIS in the intestine. Similar to DAF-16, we found that HLH-30 localizes to uncharacterized endomembrane compartments in tbc-2 mutants at the expense of its nuclear localization. The reduced expression of the HLH-30 target, lgg-1, in tbc-2 mutants suggests that this impacts HLH-30 transcriptional activity.
We found that HLH-30 colocalizes with DAF-16 on the same endomembranes in tbc-2 mutants suggesting a similar mode of regulation. HLH-30/TFEB and DAF-16/FOXO are inhibited by phosphorylation and binding with 14-3-3 proteins that sequester them in the cytoplasm (Brunet et al., 1999; Colino-Lage et al., 2024; Li et al., 2007; Lin et al., 2018; Martina et al., 2012; Roczniak-Ferguson et al., 2012). We previously demonstrated that FTT-2/14-3-3 and DAF-16 phosphorylation regulate DAF-16 localization to endomembranes (Meras et al., 2022). We anticipate that HLH-30 is also sequestered in a similar manner. However, we don’t know whether 14-3-3 mediates HLH-30 and DAF-16 binding to these endomembrane structures or if there are additional factors involved.
DAF-16 and HLH-30 forms a complex and regulates overlapping stress response genes (Lin et al., 2018). Whether they form a complex on endomembranes remains unclear. RNAi of daf-16 did not affect the localization of HLH-30 to endomembranes suggesting that there may not be a codependence for endomembrane localization. However, this should be further tested with null alleles.
Like DAF-16, we also found that IIS partially regulates the localization of HLH-30 to endomembranes. Thus, it is possible that other metabolic or stress response pathways such as AMPK, Tor, or JNK could be involved (El-Houjeiri et al., 2019; Greer et al., 2007; Lapierre et al., 2013; Martina et al., 2012; Oh et al., 2005; Roczniak-Ferguson et al., 2012; Settembre et al., 2012). Unlike DAF-16 and HLH-30, IIS promotes nuclear localization of PQM-1 (Tepper et al., 2013). Although we detected some endomembrane localization of PQM-1 in tbc-2 mutants, we found that the nuclear localization of PQM-1 was increased. This is consistent with our previous finding that tbc-2 mutants had increased expression of vha-6, a top PQM-1 target (Meras et al., 2022; Tepper et al., 2013). Taken together these results suggest that TBC-2 antagonizes IIS at a common point upstream of the DAF-16, HLH-30 and PQM-1 transcription factors.
","references":[{"reference":"Barbieri M, Bonafè M, Franceschi C, Paolisso G. 2003. Insulin/IGF-I-signaling pathway: an evolutionarily conserved mechanism of longevity from yeast to humans. American Journal of Physiology-Endocrinology and Metabolism 285: E1064-E1071.
","pubmedId":"","doi":"10.1152/ajpendo.00296.2003"},{"reference":"Brunet A, Bonni A, Zigmond MJ, Lin MZ, Juo P, Hu LS, et al., Greenberg. 1999. Akt Promotes Cell Survival by Phosphorylating and Inhibiting a Forkhead Transcription Factor. Cell 96: 857-868.
","pubmedId":"","doi":"10.1016/s0092-8674(00)80595-4"},{"reference":"Chotard L, Mishra AK, Sylvain MA, Tuck S, Lambright DG, Rocheleau CE. 2010. TBC-2 Regulates RAB-5/RAB-7-mediated Endosomal Trafficking in Caenorhabditis elegans. Molecular Biology of the Cell 21: 2285-2296.
","pubmedId":"","doi":"10.1091/mbc.E09-11-0947"},{"reference":"Colino-Lage H, Guerrero-Gómez D, Gómez-Orte E, González X, Martina JA, Dansen TB, et al., Miranda-Vizuete. 2024. Regulation of Caenorhabditis elegans HLH-30 subcellular localization dynamics: Evidence for a redox-dependent mechanism. Free Radical Biology and Medicine 223: 369-383.
","pubmedId":"","doi":"doi.org/10.1016/j.freeradbiomed.2024.07.027"},{"reference":"El-Houjeiri L, Possik E, Vijayaraghavan T, Paquette M, Martina JA, Kazan JM, et al., Pause. 2019. The Transcription Factors TFEB and TFE3 Link the FLCN-AMPK Signaling Axis to Innate Immune Response and Pathogen Resistance. Cell Reports 26: 3613-3628.e6.
","pubmedId":"","doi":"doi.org/10.1016/j.celrep.2019.02.102"},{"reference":"Fraser AG, Kamath RS, Zipperlen P, Martinez-Campos M, Sohrmann M, Ahringer J. 2000. Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature 408: 325-330.
","pubmedId":"","doi":"10.1038/35042517"},{"reference":"Friedman DB, Johnson TE. 1988. A mutation in the age-1 gene in Caenorhabditis elegans lengthens life and reduces hermaphrodite fertility.. Genetics 118: 75-86.
","pubmedId":"","doi":"10.1093/genetics/118.1.75"},{"reference":"Greer EL, Dowlatshahi D, Banko MR, Villen J, Hoang K, Blanchard D, Gygi SP, Brunet A. 2007. An AMPK-FOXO Pathway Mediates Longevity Induced by a Novel Method of Dietary Restriction in C. elegans. Current Biology 17: 1646-1656.
","pubmedId":"","doi":"10.1016/j.cub.2007.08.047"},{"reference":"Kamath RS, Fraser AG, Dong Y, Poulin G, Durbin R, Gotta M, et al., Ahringer. 2003. Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421: 231-237.
","pubmedId":"","doi":"10.1038/nature01278"},{"reference":"Kamath RS, Martinez-Campos M, Zipperlen P, Fraser AG, Ahringer J. 2000. Effectiveness of specific RNA-mediated interference through ingested double-stranded RNA in Caenorhabditis elegans. Genome Biology 2: 10.1186/gb-2000-2-1-research0002.
","pubmedId":"","doi":"10.1186/gb-2000-2-1-research0002"},{"reference":"Kenyon C, Chang J, Gensch E, Rudner A, Tabtiang R. 1993. A C. elegans mutant that lives twice as long as wild type. Nature 366: 461-464.
","pubmedId":"","doi":"10.1038/366461a0"},{"reference":"Kimura KD, Tissenbaum HA, Liu Y, Ruvkun G. 1997. daf-2\n , an Insulin Receptor-Like Gene That Regulates Longevity and Diapause in\n Caenorhabditis elegans. Science 277: 942-946.
","pubmedId":"","doi":"10.1126/science.277.5328.942"},{"reference":"Lapierre LR, De Magalhaes Filho CD, McQuary PR, Chu CC, Visvikis O, Chang JT, et al., Hansen. 2013. The TFEB orthologue HLH-30 regulates autophagy and modulates longevity in Caenorhabditis elegans. Nature Communications 4: 10.1038/ncomms3267.
","pubmedId":"","doi":"10.1038/ncomms3267"},{"reference":"Li J, Tewari M, Vidal M, Sylvia Lee S. 2007. The 14-3-3 protein FTT-2 regulates DAF-16 in Caenorhabditis elegans. Developmental Biology 301: 82-91.
","pubmedId":"","doi":"10.1016/j.ydbio.2006.10.013"},{"reference":"Lin K, Dorman JB, Rodan A, Kenyon C. 1997. daf-16\n : An HNF-3/forkhead Family Member That Can Function to Double the Life-Span of\n Caenorhabditis elegans. Science 278: 1319-1322.
","pubmedId":"","doi":"10.1126/science.278.5341.1319"},{"reference":"Lin XX, Sen I, Janssens GE, Zhou X, Fonslow BR, Edgar D, et al., Riedel. 2018. DAF-16/FOXO and HLH-30/TFEB function as combinatorial transcription factors to promote stress resistance and longevity. Nature Communications 9: 10.1038/s41467-018-06624-0.
","pubmedId":"","doi":"10.1038/s41467-018-06624-0"},{"reference":"Lithgow GJ, White TM, Hinerfeld DA, Johnson TE. 1994. Thermotolerance of a Long-lived Mutant of Caenorhabditis elegans. Journal of Gerontology 49: B270-B276.
","pubmedId":"","doi":"10.1093/geronj/49.6.b270"},{"reference":"Martina JA, Chen Y, Gucek M, Puertollano R. 2012. MTORC1 functions as a transcriptional regulator of autophagy by preventing nuclear transport of TFEB. Autophagy 8: 903-914.
","pubmedId":"","doi":"doi.org/10.4161/auto.19653"},{"reference":"McGhee J. 2007. The C. elegans intestine. WormBook : 10.1895/wormbook.1.133.1.
","pubmedId":"","doi":"10.1895/wormbook.1.133.1"},{"reference":"Meléndez A, Tallóczy Z, Seaman M, Eskelinen EL, Hall DH, Levine B. 2003. Autophagy Genes Are Essential for Dauer Development and Life-Span Extension in\n C. elegans. Science 301: 1387-1391.
","pubmedId":"","doi":"10.1126/science.1087782"},{"reference":"Meraş I, Chotard L, Liontis T, Ratemi Z, Wiles B, Seo JH, Van Raamsdonk JM, Rocheleau CE. 2022. The Rab GTPase activating protein TBC-2 regulates endosomal localization of DAF-16 FOXO and lifespan. PLOS Genetics 18: e1010328.
","pubmedId":"","doi":"10.1371/journal.pgen.1010328"},{"reference":"Morris JZ, Tissenbaum HA, Ruvkun G. 1996. A phosphatidylinositol-3-OH kinase family member regulating longevity and diapause in Caenorhabditis elegans. Nature 382: 536-539.
","pubmedId":"","doi":"10.1038/382536a0"},{"reference":"Murphy CT. 2013. Insulin/insulin-like growth factor signaling in C. elegans. WormBook : 1-43.
","pubmedId":"","doi":"10.1895/wormbook.1.164.1"},{"reference":"Murphy JT, Liu H, Ma X, Shaver A, Egan BM, Oh C, et al., Diwan. 2019. Simple nutrients bypass the requirement for HLH-30 in coupling lysosomal nutrient sensing to survival. PLOS Biology 17: e3000245.
","pubmedId":"","doi":"10.1371/journal.pbio.3000245"},{"reference":"O’Rourke EJ, Ruvkun G. 2013. MXL-3 and HLH-30 transcriptionally link lipolysis and autophagy to nutrient availability. Nature Cell Biology 15: 668-676.
","pubmedId":"","doi":"10.1038/ncb2741"},{"reference":"Ogg S, Paradis S, Gottlieb S, Patterson GI, Lee L, Tissenbaum HA, Ruvkun G. 1997. The Fork head transcription factor DAF-16 transduces insulin-like metabolic and longevity signals in C. elegans. Nature 389: 994-999.
","pubmedId":"","doi":"10.1038/40194"},{"reference":"Oh SW, Mukhopadhyay A, Svrzikapa N, Jiang F, Davis RJ, Tissenbaum HA. 2005. JNK regulates lifespan in\n Caenorhabditis elegans\n by modulating nuclear translocation of forkhead transcription factor/DAF-16. Proceedings of the National Academy of Sciences 102: 4494-4499.
","pubmedId":"","doi":"10.1073/pnas.0500749102"},{"reference":"Paradis S, Ailion M, Toker A, Thomas JH, Ruvkun G. 1999. A PDK1 homolog is necessary and sufficient to transduce AGE-1 PI3 kinase signals that regulate diapause in Caenorhabditis elegans. Genes & Development 13: 1438-1452.
","pubmedId":"","doi":"10.1101/gad.13.11.1438"},{"reference":"Paradis S, Ruvkun G. 1998. Caenorhabditis elegans Akt/PKB transduces insulin receptor-like signals from AGE-1 PI3 kinase to the DAF-16 transcription factor. Genes & Development 12: 2488-2498.
","pubmedId":"","doi":"10.1101/gad.12.16.2488"},{"reference":"Roczniak-Ferguson A, Petit CS, Froehlich F, Qian S, Ky J, Angarola B, Walther TC, Ferguson SM. 2012. The Transcription Factor TFEB Links mTORC1 Signaling to Transcriptional Control of Lysosome Homeostasis. Science Signaling 5: 10.1126/scisignal.2002790.
","pubmedId":"","doi":"10.1126/scisignal.2002790"},{"reference":"Settembre C, Zoncu R, Medina DL, Vetrini F, Erdin S, Erdin S, et al., Ballabio. 2012. A lysosome‐to‐nucleus signalling mechanism senses and regulates the lysosome via mTOR and TFEB. The EMBO Journal 31: 1095-1108.
","pubmedId":"","doi":"10.1038/emboj.2012.32"},{"reference":"Tepper RG, Ashraf J, Kaletsky R, Kleemann G, Murphy CT, Bussemaker HJ. 2013. PQM-1 Complements DAF-16 as a Key Transcriptional Regulator of DAF-2-Mediated Development and Longevity. Cell 154: 676-690.
","pubmedId":"","doi":"10.1016/j.cell.2013.07.006"},{"reference":"Timmons L, Fire A. 1998. Specific interference by ingested dsRNA. Nature 395: 854-854.
","pubmedId":"","doi":"10.1038/27579"},{"reference":"Traa A, Soo SK, AlOkda A, Ko B, Rocheleau CE, Van Raamsdonk JM. 2023. Endosomal trafficking protein
Zhang YP, Zhang WH, Zhang P, Li Q, Sun Y, Wang JW, et al., Dong. 2022. Intestine-specific removal of DAF-2 nearly doubles lifespan in Caenorhabditis elegans with little fitness cost. Nature Communications 13: 10.1038/s41467-022-33850-4.
","pubmedId":"","doi":"10.1038/s41467-022-33850-4"}],"title":"TBC-2, a Rab GTPase activating protein, regulates the localization of the HLH-30/TFEB and PQM-1 transcription factors in the C. elegans intestine
","reviews":[{"reviewer":{"displayName":"Barth Grant"},"openAcknowledgement":false,"status":{"submitted":true}}],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null}]},{"id":"855ecdb5-bf13-47e9-b97c-33aaacf236ac","decision":"revise","abstract":"Insulin/IGF signaling (IIS) inhibits the nuclear localization of the DAF-16/FOXO transcription factor to regulate longevity and stress resistance in C. elegans. In the intestine, IIS promotes DAF-16 localization to endosomes and loss of TBC-2, a RAB-5 GAP, results in increased endomembrane localization of DAF-16 at the expense of nuclear localization, decreased DAF-16 target gene expression, longevity and stress resistance. Here we found that TBC-2 differentially regulates the localization of the IIS-regulated transcription factors PQM-1 and HLH-30/TFEB. Our results suggest a broader role for TBC-2 in regulating IIS and that TBC-2 likely functions at an upstream point in the IIS pathway.
","acknowledgements":"We would like to thank Jung Hwa Seo for technical assistance. We thank Kerry Kornfeld and Abhinav Diwan (Washington University) and Jeremy Van Raamsdonk (McGill University) for sharing strains and RNAi clones. Wormbase (wormbase.org) and Alliance of Genome Resources (alliancegenome.org) were critical knowledgebases for project conception and experimental design. Some strains were provided by the Caenorhabditis Genetics Center (CGC), which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
","authors":[{"affiliations":["McGill University, Montreal, QC, Canada"],"departments":["Department of Anatomy and Cell Biology"],"credit":["conceptualization","formalAnalysis","writing_originalDraft","investigation","writing_reviewEditing"],"email":"soumyendu.saha@mail.mcgill.ca","firstName":"Soumyendu","lastName":"Saha","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["McGill University, Montreal, QC, Canada"],"departments":["Department of Anatomy and Cell Biology"],"credit":["conceptualization","investigation"],"email":"icten.meras@mail.mcgill.ca","firstName":"Icten","lastName":"Meras","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["McGill University, Montreal, QC, Canada","RI-MUHC, Montreal, QC, CA","McGill University, Montreal, QC, Canada"],"departments":["Division of Endocrinology and Metabolism, Department of Medicine","Metabolic Disorders and Complications Program","Department of Anatomy and Cell Biology"],"credit":["conceptualization","fundingAcquisition","supervision","writing_reviewEditing"],"email":"christian.rocheleau@mcgill.ca","firstName":"Christian E.","lastName":"Rocheleau","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-6738-5636"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work was funded by a Canadian Institutes of Health Research (CIHR) Project Grants PJT-159725 and PTJ-191910 to CER. SS was funded by a studentship from the Division of Endocrinology and Metabolism and the MUHC Metabolic Centre of Excellence Grants Program.
","image":{"url":"https://portal.micropublication.org/uploads/d6361a8cfe307746cff1989634735f2e.png"},"imageCaption":"(A-A') Representative confocal images of PQM-1::GFP in the intestine of wild type and tbc-2(tm2241) mutants showing nuclear (n) and endomembrane localization (yellow arrow). ^ denotes autofluorescent gut granules. (B, C) Bar graphs showing the percent animals with PQM-1::GFP localization to endomembranes (B) and the nucleus (C). Experimental triplicates with 30-50 animals per replicate. (D) Box and scatter graph representing the ratio of nuclear to cytosolic fluorescence intensity of PQM-1::GFP in wild type (n=26) and tbc-2(tm2241) mutants (n =29), each data point is an individual intestinal cell. (E-E') Representative confocal images of HLH-30::GFP in the intestine of wild type and tbc-2(tm2241). Nuclear (n) and endomembrane localization (yellow arrows). (E'') Confocal image of endogenously tagged HLH-30::3xFlag::eGFP endomembrane localization in tbc-2(tm2241). (F, G) Bar graphs showing the percent animals with endomembrane localization of HLH-30::GFP (F), and HLH-30::RFP (G) in wild type and tbc-2(tm2241) mutants. Experimental replicates with 30-60 animals per replicate. (H, I) Box and scatter graphs representing the ratio of nuclear to cytosolic fluorescence intensity of HLH-30::GFP (H) and HLH-30::RFP (I) in wild type and tbc-2(tm2241) mutants, n > 20 for each condition. (J) Bar graph showing the fold change in lgg-1 mRNA expression levels between wild type and tbc-2(tm2241) mutant, in 3 biological replicates. (K-K'') Representative confocal images DAF-16::GFP and HLH-30::RFP colocalization in tbc-2(tm2241) as shown by the yellow arrow. ^ marks the auto fluorescent gut granules and n denotes nuclei. (L) Bar graph showing the percent animals with endosomal HLH-30::GFP in the tbc-2(tm2241) background, fed control (ev, empty vector) RNAi or RNAi targeting components of the IIS pathway. Each replicate represents >25 worms per condition. Paired Student T-test was used to analyse data in (B, C, F, G, J, and L) and unpaired Student T-test was used to analyse data in (D, H, and I). Scale bar, 10 mm. *P < 0.05, **P<0.01 and ****P<0.0001.
","imageTitle":"TBC-2 regulates the localization of PQM-1 and HLH-30
","methods":"Worms were maintained at 20°C on NGM plates as described in WormBook (www.wormbook.org). The strains were fed HB101 E. coli as a food source.
For RNAi feeding experiments fourth larval stage (L4) worms were placed on RNAi plates and transferred to fresh plates each day for 3 days. L4 progeny from the day 3 plates were scored for the experiment. RNAi feeding clones were obtained from the Ahringer RNAi library (Kamath et al., 2001). pdk-1 RNAi clone (pQcSS01) was generated by PCR of worm lysates using primers SSA38 5' -CAACTAAGATCTATTTCGTGATCGGACTTGTTG – 3' and SSA395' – GTCATACTCGAGGCTAGCATCATTTCCCAAATTCATC -3' and ligated to the L4440 vector from Addgene (https://www.addgene.org/1654/).
Live imaging of the L4 hermaphrodite worms was done at room temperature. The worms were transferred to a 2% agarose pad and immobilized with 10 mM levamisole. They were scored for nuclear or endosome localization of PQM-1, DAF-16 and HLH-30 under the fluorescent ZeissA1 axio Imager. To measure the fluorescence intensity of nuclear PQM-1 and HLH-30 L4 worms were imaged using a Zeiss Axio Observer Z1 LSM780 laser scanning confocal microscope in the Molecular Imaging Platform of the RI-MUHC. Image analysis was performed using Fiji (ImageJ).
For qualitative RT PCR, RNA was extracted from young adult C. elegans using TRIZOL as explained in (Meras et al., 2022). LGG-1 was amplified using forward primer 5' – ACCCAGACCGTATTCCAGTG -3' and reverse primer 5' – ACGAAGTTGGATGCGTTTTC -3'.
","reagents":"Strain | Genotype | Source |
Wild type Bristol Strain | CGC | |
(Chotard et al., 2010) | ||
unc-119(tm4063) III; wgIs201[pqm-1::TY1::EGFP::3xFLAG(92C12) +unc-119(+)] | CGC | |
tbc-2(tm2241) II; wgIs201[pqm-1::TY1::EGFP::3xFLAG(92C12 + unc-119(+)] | This study | |
CGC | ||
| tbc-2(tm2241) II; jinEx10 [hlh-30p::hlh-30::GFP + rol-6(su1006)] | This study |
(Murphy et al., 2019) | ||
This study | ||
daf-16(hq23[DAF-16::GFP]) I; tbc-2(tm2241) II;;hlh-30p::HLH-30::RFP+ rol-6(su1006) | This study | |
QR1138 | tbc-2(tm2241) II; hlh-30(syb1452[hlh-30::3xFlag::eGFP]) IV | This study |
RNAi clone | Gene | Source |
L4440 | Empty vector control | (Timmons & Fire, 1998) |
III-7G12 | (Kamath et al., 2003) | |
II-7J02 | (Kamath et al., 2003) | |
V-7I17 | (Kamath et al., 2003) | |
I-5M24 | (Fraser et al., 2000) | |
pQcSS01 | This study |
Insulin/Insulin-like Growth Factor (IGF) signaling (IIS) is an evolutionarily conserved regulator of metabolism (Barbieri et al., 2003; Murphy & Hu, 2013). In C. elegans, the IIS pathway regulates lifespan, fat storage and resistance to various stresses (Friedman & Johnson, 1988; Kenyon et al., 1993; Kimura et al., 1997; Lithgow et al., 1994; Murphy & Hu, 2013; Ogg et al., 1997). The core pathway is defined by the DAF-2 insulin/IGF receptor, the AGE-1 class I PI3 kinase which generates PI(3,4,5)P which in turn recruits PDK-1 and AKT-1/2 kinases to the plasma membrane where PDK-1 phosphorylates and activates AKT-1/2. A major target of C. elegans IIS is the inhibition of the DAF-16/FOXO transcription (Kimura et al., 1997; Lin et al., 1997; Morris et al., 1996; Ogg et al., 1997; Paradis et al., 1999; Paradis & Ruvkun, 1998). Phosphorylation of FOXO transcription factors by AKT kinases results in cytoplasmic sequestration (Brunet et al., 1999).
The C. elegans intestine, while only 20 cells, is a major metabolic organ and site of many IIS-mediated functions (McGhee, 2007; Murphy & Hu, 2013; Zhang et al., 2022). We previously demonstrated that DAF-16 localizes to endosomes in the intestinal cells (Meras et al., 2022). Interestingly, DAF-16 positive endosomes are not present in every cell or every animal and can vary from just a few to hundreds. We found that TBC-2 regulates DAF-16 localization. TBC-2 is a RAB-5 GTPase Activating Protein (GAP) that regulates early to late endosome maturation (Chotard et al., 2010). In tbc-2(tm2241) deletion mutants, DAF-16 localizes to irregularly shaped endomembranes to a greater extent than wild type and at the expense of nuclear localization (Meras et al., 2022). As such, TBC-2 antagonizes IIS-mediated gene expression, longevity, fat storage and resistance to several stresses (Meras et al., 2022; Traa et al., 2023). To determine if this localization was specific to DAF-16 we looked at two additional transcription factors that are differentially regulated by IIS, PQM-1 and HLH-30.
PQM-1 is a zinc finger transcription factor required for the long lifespan of daf-2 mutants (Tepper et al., 2013). Localization of PQM-1 is opposite that of DAF-16 whereby IIS promotes nuclear localization of PQM-1 while it antagonizes DAF-16 (Tepper et al., 2013). In tbc-2(-) animals, PQM-1::GFP showed some localization to endomembranes (Figure 1A-A', B). Despite the endomembrane localization of PQM-1, there was a significant increase in the number of animals with nuclear localized PQM-1 and an increase in the nuclear to cytosolic fluorescence intensity ratio of PQM-1 in tbc-2(-) mutants as compared to wild type (Figure 1C, D). This is consistent with the antagonistic genetic relation between PQM-1 with DAF-16 localization (Tepper et al., 2013).
HLH-30 or TFEB (Transcription factor EB) is a transcription factor involved in lysosomal biogenesis and acts in a combinatorial manner with DAF-16 in response to the starvation stress (Lapierre et al., 2013; Lin et al., 2018; O'Rourke & Ruvkun, 2013). In wild type we observed HLH-30::GFP was mostly nuclear with some cytoplasmic and endomembrane localization. In tbc-2(-) mutants, using both GFP and RFP tagged HLH-30 we observed an increase in the number of animals with HLH-30 localized to endomembranes (Figure 1E-E', F, G). Although fainter, endomembrane localization in tbc-2(-) mutants were visible with an endogenously tagged HLH-30::3xFlag::eGFP (Figure 1E''). Like DAF-16, HLH-30 showed reduced nuclear to cytosolic fluorescence intensity in tbc-2 mutant animals (Figure 1H, I). To test if the reduced nuclear localization of HLH-30 affected downstream HLH-30 dependent gene expression, we analysed the mRNA expression of lgg-1. LGG-1 is ATG8 in yeast and LC3 in mammals and is responsible for autophagosome formation (Melendez et al., 2003). LGG-1 expression is dependent on HLH-30, such that lgg-1 mRNA levels are suppressed in hlh-30(RNAi) (Lapierre et al., 2013). There was a significant decrease in the lgg-1 mRNA levels in tbc-2(tm2241) mutants consistent with the reduced nuclear localization of HLH-30 (Figure 1J).
We observed that DAF-16 and HLH-30 co-localized on endomembranes in tbc-2(-) mutants indicating that TBC-2 might regulate these transcription factors by a common underlying mechanism (Figure 1 K-K''). To test if IIS regulates HLH-30 localization on endosomes as seen with DAF-16 (Meras et al., 2022), we use RNAi to systematically knock down components of the IIS pathway- DAF-2, AGE-1, PDK-1, AKT-1 and DAF-16 in tbc-2(-); HLH-30::GFP animals. Compared to empty vector control, RNAi mediated knock-down of daf-2, age-1 and akt-1 significantly decreased the number of tbc-2(-) mutant animals with HLH-30 on endomembranes (Figure 1L). pdk-1(RNAi) significantly suppressed HLH-30 endomembrane localization in three of four experiments (Figure 1L). daf-16 RNAi did not decrease the endomembrane localization of HLH-30 (Figure 1J). Thus, IIS signaling promotes the localization of HLH-30 to endomembrane compartments as it does with DAF-16.
In conclusion, this study builds upon our previous findings that TBC-2 regulates DAF-16 localization to endomembranes (Meras et al., 2022). We demonstrated that TBC-2 regulates the localization of two additional IIS regulated transcription factors, HLH-30 and PQM-1, further supporting a role for TBC-2 in antagonizing IIS in the intestine. Similar to DAF-16, we found that HLH-30 localizes to uncharacterized endomembrane compartments in tbc-2 mutants at the expense of its nuclear localization. The reduced expression of the HLH-30 target, lgg-1, in tbc-2 mutants suggests that this impacts HLH-30 transcriptional activity.
We found that HLH-30 colocalizes with DAF-16 on the same endomembranes in tbc-2 mutants suggesting a similar mode of regulation. HLH-30/TFEB and DAF-16/FOXO are inhibited by phosphorylation and binding with 14-3-3 proteins that sequester them in the cytoplasm (Brunet et al., 1999; Colino-Lage et al., 2024; Li et al., 2007; Lin et al., 2018; Martina et al., 2012; Roczniak-Ferguson et al., 2012). We previously demonstrated that FTT-2/14-3-3 and DAF-16 phosphorylation regulate DAF-16 localization to endomembranes (Meras et al., 2022). We anticipate that HLH-30 is also sequestered in a similar manner. However, we don’t know whether 14-3-3 mediates HLH-30 and DAF-16 binding to these endomembrane structures or if there are additional factors involved.
DAF-16 and HLH-30 forms a complex and regulates overlapping stress response genes (Lin et al., 2018). Whether they form a complex on endomembranes remains unclear. RNAi of daf-16 did not affect the localization of HLH-30 to endomembranes suggesting that there may not be a codependence for endomembrane localization. However, this should be further tested with null alleles.
Like DAF-16, we also found that IIS partially regulates the localization of HLH-30 to endomembranes. Thus, it is possible that other metabolic or stress response pathways such as AMPK, Tor, or JNK could be involved (El-Houjeiri et al., 2019; Greer et al., 2007; Lapierre et al., 2013; Martina et al., 2012; Oh et al., 2005; Roczniak-Ferguson et al., 2012; Settembre et al., 2012). Unlike DAF-16 and HLH-30, IIS promotes nuclear localization of PQM-1 (Tepper et al., 2013). Although we detected some endomembrane localization of PQM-1 in tbc-2 mutants, we found that the nuclear versus cytoplasmic localization of PQM-1 was increased suggesting increased nuclear import or increased possibly an increase in PQM-1 levels. This is consistent with our previous finding that tbc-2 mutants had increased expression of vha-6, a top PQM-1 target (Meras et al., 2022; Tepper et al., 2013). Taken together these results suggest that TBC-2 antagonizes IIS at a common point upstream of the DAF-16, HLH-30 and PQM-1 transcription factors.
","references":[{"reference":"Barbieri M, Bonafè M, Franceschi C, Paolisso G. 2003. Insulin/IGF-I-signaling pathway: an evolutionarily conserved mechanism of longevity from yeast to humans. American Journal of Physiology-Endocrinology and Metabolism 285: E1064-E1071.
","pubmedId":"","doi":"10.1152/ajpendo.00296.2003"},{"reference":"Brunet A, Bonni A, Zigmond MJ, Lin MZ, Juo P, Hu LS, et al., Greenberg. 1999. Akt Promotes Cell Survival by Phosphorylating and Inhibiting a Forkhead Transcription Factor. Cell 96: 857-868.
","pubmedId":"","doi":"10.1016/s0092-8674(00)80595-4"},{"reference":"Chotard L, Mishra AK, Sylvain MA, Tuck S, Lambright DG, Rocheleau CE. 2010. TBC-2 Regulates RAB-5/RAB-7-mediated Endosomal Trafficking in Caenorhabditis elegans. Molecular Biology of the Cell 21: 2285-2296.
","pubmedId":"","doi":"10.1091/mbc.E09-11-0947"},{"reference":"Colino-Lage H, Guerrero-Gómez D, Gómez-Orte E, González X, Martina JA, Dansen TB, et al., Miranda-Vizuete. 2024. Regulation of Caenorhabditis elegans HLH-30 subcellular localization dynamics: Evidence for a redox-dependent mechanism. Free Radical Biology and Medicine 223: 369-383.
","pubmedId":"","doi":"doi.org/10.1016/j.freeradbiomed.2024.07.027"},{"reference":"El-Houjeiri L, Possik E, Vijayaraghavan T, Paquette M, Martina JA, Kazan JM, et al., Pause. 2019. The Transcription Factors TFEB and TFE3 Link the FLCN-AMPK Signaling Axis to Innate Immune Response and Pathogen Resistance. Cell Reports 26: 3613-3628.e6.
","pubmedId":"","doi":"doi.org/10.1016/j.celrep.2019.02.102"},{"reference":"Fraser AG, Kamath RS, Zipperlen P, Martinez-Campos M, Sohrmann M, Ahringer J. 2000. Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature 408: 325-330.
","pubmedId":"","doi":"10.1038/35042517"},{"reference":"Friedman DB, Johnson TE. 1988. A mutation in the age-1 gene in Caenorhabditis elegans lengthens life and reduces hermaphrodite fertility.. Genetics 118: 75-86.
","pubmedId":"","doi":"10.1093/genetics/118.1.75"},{"reference":"Greer EL, Dowlatshahi D, Banko MR, Villen J, Hoang K, Blanchard D, Gygi SP, Brunet A. 2007. An AMPK-FOXO Pathway Mediates Longevity Induced by a Novel Method of Dietary Restriction in C. elegans. Current Biology 17: 1646-1656.
","pubmedId":"","doi":"10.1016/j.cub.2007.08.047"},{"reference":"Kamath RS, Fraser AG, Dong Y, Poulin G, Durbin R, Gotta M, et al., Ahringer. 2003. Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421: 231-237.
","pubmedId":"","doi":"10.1038/nature01278"},{"reference":"Kamath RS, Martinez-Campos M, Zipperlen P, Fraser AG, Ahringer J. 2000. Effectiveness of specific RNA-mediated interference through ingested double-stranded RNA in Caenorhabditis elegans. Genome Biology 2: 10.1186/gb-2000-2-1-research0002.
","pubmedId":"","doi":"10.1186/gb-2000-2-1-research0002"},{"reference":"Kenyon C, Chang J, Gensch E, Rudner A, Tabtiang R. 1993. A C. elegans mutant that lives twice as long as wild type. Nature 366: 461-464.
","pubmedId":"","doi":"10.1038/366461a0"},{"reference":"Kimura KD, Tissenbaum HA, Liu Y, Ruvkun G. 1997. daf-2\n , an Insulin Receptor-Like Gene That Regulates Longevity and Diapause in\n Caenorhabditis elegans. Science 277: 942-946.
","pubmedId":"","doi":"10.1126/science.277.5328.942"},{"reference":"Lapierre LR, De Magalhaes Filho CD, McQuary PR, Chu CC, Visvikis O, Chang JT, et al., Hansen. 2013. The TFEB orthologue HLH-30 regulates autophagy and modulates longevity in Caenorhabditis elegans. Nature Communications 4: 10.1038/ncomms3267.
","pubmedId":"","doi":"10.1038/ncomms3267"},{"reference":"Li J, Tewari M, Vidal M, Sylvia Lee S. 2007. The 14-3-3 protein FTT-2 regulates DAF-16 in Caenorhabditis elegans. Developmental Biology 301: 82-91.
","pubmedId":"","doi":"10.1016/j.ydbio.2006.10.013"},{"reference":"Lin K, Dorman JB, Rodan A, Kenyon C. 1997. daf-16\n : An HNF-3/forkhead Family Member That Can Function to Double the Life-Span of\n Caenorhabditis elegans. Science 278: 1319-1322.
","pubmedId":"","doi":"10.1126/science.278.5341.1319"},{"reference":"Lin XX, Sen I, Janssens GE, Zhou X, Fonslow BR, Edgar D, et al., Riedel. 2018. DAF-16/FOXO and HLH-30/TFEB function as combinatorial transcription factors to promote stress resistance and longevity. Nature Communications 9: 10.1038/s41467-018-06624-0.
","pubmedId":"","doi":"10.1038/s41467-018-06624-0"},{"reference":"Lithgow GJ, White TM, Hinerfeld DA, Johnson TE. 1994. Thermotolerance of a Long-lived Mutant of Caenorhabditis elegans. Journal of Gerontology 49: B270-B276.
","pubmedId":"","doi":"10.1093/geronj/49.6.b270"},{"reference":"Martina JA, Chen Y, Gucek M, Puertollano R. 2012. MTORC1 functions as a transcriptional regulator of autophagy by preventing nuclear transport of TFEB. Autophagy 8: 903-914.
","pubmedId":"","doi":"doi.org/10.4161/auto.19653"},{"reference":"McGhee J. 2007. The C. elegans intestine. WormBook : 10.1895/wormbook.1.133.1.
","pubmedId":"","doi":"10.1895/wormbook.1.133.1"},{"reference":"Meléndez A, Tallóczy Z, Seaman M, Eskelinen EL, Hall DH, Levine B. 2003. Autophagy Genes Are Essential for Dauer Development and Life-Span Extension in\n C. elegans. Science 301: 1387-1391.
","pubmedId":"","doi":"10.1126/science.1087782"},{"reference":"Meraş I, Chotard L, Liontis T, Ratemi Z, Wiles B, Seo JH, Van Raamsdonk JM, Rocheleau CE. 2022. The Rab GTPase activating protein TBC-2 regulates endosomal localization of DAF-16 FOXO and lifespan. PLOS Genetics 18: e1010328.
","pubmedId":"","doi":"10.1371/journal.pgen.1010328"},{"reference":"Morris JZ, Tissenbaum HA, Ruvkun G. 1996. A phosphatidylinositol-3-OH kinase family member regulating longevity and diapause in Caenorhabditis elegans. Nature 382: 536-539.
","pubmedId":"","doi":"10.1038/382536a0"},{"reference":"Murphy CT. 2013. Insulin/insulin-like growth factor signaling in C. elegans. WormBook : 1-43.
","pubmedId":"","doi":"10.1895/wormbook.1.164.1"},{"reference":"Murphy JT, Liu H, Ma X, Shaver A, Egan BM, Oh C, et al., Diwan. 2019. Simple nutrients bypass the requirement for HLH-30 in coupling lysosomal nutrient sensing to survival. PLOS Biology 17: e3000245.
","pubmedId":"","doi":"10.1371/journal.pbio.3000245"},{"reference":"O’Rourke EJ, Ruvkun G. 2013. MXL-3 and HLH-30 transcriptionally link lipolysis and autophagy to nutrient availability. Nature Cell Biology 15: 668-676.
","pubmedId":"","doi":"10.1038/ncb2741"},{"reference":"Ogg S, Paradis S, Gottlieb S, Patterson GI, Lee L, Tissenbaum HA, Ruvkun G. 1997. The Fork head transcription factor DAF-16 transduces insulin-like metabolic and longevity signals in C. elegans. Nature 389: 994-999.
","pubmedId":"","doi":"10.1038/40194"},{"reference":"Oh SW, Mukhopadhyay A, Svrzikapa N, Jiang F, Davis RJ, Tissenbaum HA. 2005. JNK regulates lifespan in\n Caenorhabditis elegans\n by modulating nuclear translocation of forkhead transcription factor/DAF-16. Proceedings of the National Academy of Sciences 102: 4494-4499.
","pubmedId":"","doi":"10.1073/pnas.0500749102"},{"reference":"Paradis S, Ailion M, Toker A, Thomas JH, Ruvkun G. 1999. A PDK1 homolog is necessary and sufficient to transduce AGE-1 PI3 kinase signals that regulate diapause in Caenorhabditis elegans. Genes & Development 13: 1438-1452.
","pubmedId":"","doi":"10.1101/gad.13.11.1438"},{"reference":"Paradis S, Ruvkun G. 1998. Caenorhabditis elegans Akt/PKB transduces insulin receptor-like signals from AGE-1 PI3 kinase to the DAF-16 transcription factor. Genes & Development 12: 2488-2498.
","pubmedId":"","doi":"10.1101/gad.12.16.2488"},{"reference":"Roczniak-Ferguson A, Petit CS, Froehlich F, Qian S, Ky J, Angarola B, Walther TC, Ferguson SM. 2012. The Transcription Factor TFEB Links mTORC1 Signaling to Transcriptional Control of Lysosome Homeostasis. Science Signaling 5: 10.1126/scisignal.2002790.
","pubmedId":"","doi":"10.1126/scisignal.2002790"},{"reference":"Settembre C, Zoncu R, Medina DL, Vetrini F, Erdin S, Erdin S, et al., Ballabio. 2012. A lysosome‐to‐nucleus signalling mechanism senses and regulates the lysosome via mTOR and TFEB. The EMBO Journal 31: 1095-1108.
","pubmedId":"","doi":"10.1038/emboj.2012.32"},{"reference":"Tepper RG, Ashraf J, Kaletsky R, Kleemann G, Murphy CT, Bussemaker HJ. 2013. PQM-1 Complements DAF-16 as a Key Transcriptional Regulator of DAF-2-Mediated Development and Longevity. Cell 154: 676-690.
","pubmedId":"","doi":"10.1016/j.cell.2013.07.006"},{"reference":"Timmons L, Fire A. 1998. Specific interference by ingested dsRNA. Nature 395: 854-854.
","pubmedId":"","doi":"10.1038/27579"},{"reference":"Traa A, Soo SK, AlOkda A, Ko B, Rocheleau CE, Van Raamsdonk JM. 2023. Endosomal trafficking protein
Zhang YP, Zhang WH, Zhang P, Li Q, Sun Y, Wang JW, et al., Dong. 2022. Intestine-specific removal of DAF-2 nearly doubles lifespan in Caenorhabditis elegans with little fitness cost. Nature Communications 13: 10.1038/s41467-022-33850-4.
","pubmedId":"","doi":"10.1038/s41467-022-33850-4"}],"title":"TBC-2, a Rab GTPase activating protein, regulates the localization of the HLH-30/TFEB and PQM-1 transcription factors in the C. elegans intestine
","reviews":[{"reviewer":{"displayName":"Barth Grant"},"openAcknowledgement":false,"status":{"submitted":true}}],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null}]},{"id":"63fa41f0-02ee-41e4-a3c0-f0b643378cbd","decision":"accept","abstract":"Insulin/IGF signaling (IIS) inhibits the nuclear localization of the DAF-16/FOXO transcription factor to regulate longevity and stress resistance in C. elegans. In the intestine, IIS promotes DAF-16 localization to endosomes and loss of TBC-2, a RAB-5 GAP, results in increased endomembrane localization of DAF-16 at the expense of nuclear localization, decreased DAF-16 target gene expression, longevity and stress resistance. Here we found that TBC-2 differentially regulates the localization of the IIS-regulated transcription factors PQM-1 and HLH-30/TFEB. Our results suggest a broader role for TBC-2 in regulating IIS and that TBC-2 likely functions at an upstream point in the IIS pathway.
","acknowledgements":"We would like to thank Jung Hwa Seo for technical assistance. We thank Kerry Kornfeld and Abhinav Diwan (Washington University) and Jeremy Van Raamsdonk (McGill University) for sharing strains and RNAi clones. Wormbase (wormbase.org) and Alliance of Genome Resources (alliancegenome.org) were critical knowledgebases for project conception and experimental design. Some strains were provided by the Caenorhabditis Genetics Center (CGC), which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
","authors":[{"affiliations":["McGill University, Montreal, QC, Canada"],"departments":["Department of Anatomy and Cell Biology"],"credit":["conceptualization","formalAnalysis","writing_originalDraft","investigation","writing_reviewEditing"],"email":"soumyendu.saha@mail.mcgill.ca","firstName":"Soumyendu","lastName":"Saha","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["McGill University, Montreal, QC, Canada"],"departments":["Department of Anatomy and Cell Biology"],"credit":["conceptualization","investigation"],"email":"icten.meras@mail.mcgill.ca","firstName":"Icten","lastName":"Meras","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["McGill University, Montreal, QC, Canada","RI-MUHC, Montreal, QC, CA","McGill University, Montreal, QC, Canada"],"departments":["Division of Endocrinology and Metabolism, Department of Medicine","Metabolic Disorders and Complications Program","Department of Anatomy and Cell Biology"],"credit":["conceptualization","fundingAcquisition","supervision","writing_reviewEditing"],"email":"christian.rocheleau@mcgill.ca","firstName":"Christian E.","lastName":"Rocheleau","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-6738-5636"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work was funded by a Canadian Institutes of Health Research (CIHR) Project Grants PJT-159725 and PTJ-191910 to CER. SS was funded by a studentship from the Division of Endocrinology and Metabolism and the MUHC Metabolic Centre of Excellence Grants Program.
","image":{"url":"https://portal.micropublication.org/uploads/a3e880693d69069891c8425c30f65e3b.png"},"imageCaption":"(A-A') Representative confocal images of PQM-1::GFP in the intestine of wild type and tbc-2(tm2241) mutants showing nuclear (n) and endomembrane localization (yellow arrow). ^ denotes autofluorescent gut granules. (B, C) Bar graphs showing the percent animals with PQM-1::GFP localization to endomembranes (B) and the nucleus (C). Experimental triplicates with 30-50 animals per replicate. (D) Box and scatter graph representing the ratio of nuclear to cytosolic fluorescence intensity of PQM-1::GFP in wild type (n=26) and tbc-2(tm2241) mutants (n=29), each data point is an individual intestinal cell. (E-E'') Confocal images of endogenously tagged HLH-30::3xFlag::eGFP in the intestine of wild type with and without endomembrane localization (E-E') and in tbc-2(tm2241) (E''). Nuclear (n) and endomembrane localization (yellow arrows). (F) Bar graph showing the percent animals with endomembrane localization of HLH-30::3xFlag::eGFP, HLH-30::GFP, and HLH-30::RFP in wild type and tbc-2(tm2241) mutants. Experimental replicates with 19-36 HLH-30::3xFlag::eGFP animals per replicate and 30-60 animals per replicate for HLH-30::GFP and HLH-30::RFP. (G) Box and scatter graphs representing the ratio of nuclear to cytosolic fluorescence intensity of HLH-30::3xFlag::eGFP, HLH-30::GFP, and HLH-30::RFP in wild type and tbc-2(tm2241) mutants, n > 18 for each condition. (H) Bar graph showing the fold change in lgg-1 mRNA expression levels between wild type and tbc-2(tm2241) mutant, in 3 biological replicates. (I-I'') Representative confocal images DAF-16::GFP and HLH-30::RFP colocalization in tbc-2(tm2241) as shown by the yellow arrow. ^ marks the auto fluorescent gut granules and n denotes nuclei. (J) Bar graph showing the percent animals with endosomal HLH-30::GFP in the tbc-2(tm2241) background, fed control (ev, empty vector) RNAi or RNAi targeting components of the IIS pathway. Each replicate represents >25 worms per condition. Paired Student T-test was used to analyse data in (B, C, F, H and J) and unpaired Student T-test was used to analyse data in (D and G). Scale bar, 10 mm. ns, not significant, *P < 0.05, **P<0.01 and ****P<0.0001.
","imageTitle":"TBC-2 regulates the localization of PQM-1 and HLH-30
","methods":"All strains were derived from the wild type N2 strain. Worms were maintained at 20°C on NGM plates as described in WormBook (www.wormbook.org). The strains were fed HB101 E. coli as a food source.
For RNAi feeding experiments fourth larval stage (L4) worms were placed on RNAi plates and transferred to fresh plates each day for 3 days. L4 progeny from the day 3 plates were scored for the experiment. RNAi feeding clones were obtained from the Ahringer RNAi library (Kamath et al., 2001). pdk-1 RNAi clone (pQcSS01) was generated by PCR of worm lysates using primers SSA38 5' - CAACTAAGATCTATTTCGTGATCGGACTTGTTG – 3' and SSA39 5' – GTCATACTCGAGGCTAGCATCATTTCCCAAATTCATC -3' and ligated to the L4440 vector from Addgene (https://www.addgene.org/1654/).
Live imaging of the L4 hermaphrodite worms was done at room temperature. The worms were transferred to a 2% agarose pad and immobilized with 10 mM levamisole. They were scored for nuclear or endosome localization of PQM-1, DAF-16 and HLH-30 under the fluorescent ZeissA1 axio Imager. To measure the fluorescence intensity of nuclear PQM-1 and HLH-30 L4 worms were imaged using a Zeiss Axio Observer Z1 LSM780 laser scanning confocal microscope in the Molecular Imaging Platform of the RI-MUHC. Image analysis was performed using Fiji (ImageJ).
For qualitative RT PCR, RNA was extracted from young adult C. elegans using TRIZOL as explained in (Meras et al., 2022). LGG-1 was amplified using forward primer 5' – ACCCAGACCGTATTCCAGTG -3' and reverse primer 5' – ACGAAGTTGGATGCGTTTTC -3'.
","reagents":"Strain | Genotype | Source |
unc-119(tm4063) III; wgIs201[pqm-1::TY1::EGFP::3xFLAG(92C12) +unc-119(+)] | CGC; (Sarov et al., 2006; Zhong et al., 2010) | |
tbc-2(tm2241) II; wgIs201[pqm-1::TY1::EGFP::3xFLAG(92C12 + unc-119(+)] | This study | |
CGC; (Martina et al., 2021) | ||
This study | ||
CGC; (Lapierre et al., 2013) | ||
| tbc-2(tm2241) II; jinEx10 [hlh-30p::hlh-30::GFP + rol-6(su1006)] | This study |
(Murphy et al., 2019) | ||
This study | ||
daf-16(hq23[DAF-16::GFP]) I; tbc-2(tm2241) II;;hlh-30p::HLH-30::RFP+ rol-6(su1006) | This study | |
RNAi clone | Gene | Source |
L4440 | Empty vector control | (Timmons & Fire, 1998) |
III-7G12 | (Kamath et al., 2003) | |
II-7J02 | (Kamath et al., 2003) | |
V-7I17 | (Kamath et al., 2003) | |
I-5M24 | (Fraser et al., 2000) | |
pQcSS01 | This study |
Insulin/Insulin-like Growth Factor (IGF) signaling (IIS) is an evolutionarily conserved regulator of metabolism (Barbieri et al., 2003; Murphy & Hu, 2013). In C. elegans, the IIS pathway regulates lifespan, fat storage and resistance to various stresses (Friedman & Johnson, 1988; Kenyon et al., 1993; Kimura et al., 1997; Lithgow et al., 1994; Murphy & Hu, 2013; Ogg et al., 1997). The core pathway is defined by the DAF-2 insulin/IGF receptor, the AGE-1 class I PI3 kinase which generates PI(3,4,5)P which in turn recruits PDK-1 and AKT-1/2 kinases to the plasma membrane where PDK-1 phosphorylates and activates AKT-1/2. A major target of C. elegans IIS is the inhibition of the DAF-16/FOXO transcription (Kimura et al., 1997; Lin et al., 1997; Morris et al., 1996; Ogg et al., 1997; Paradis et al., 1999; Paradis & Ruvkun, 1998). Phosphorylation of FOXO transcription factors by AKT kinases results in cytoplasmic sequestration (Brunet et al., 1999).
The C. elegans intestine, while only 20 cells, is a major metabolic organ and site of many IIS-mediated functions (McGhee, 2007; Murphy & Hu, 2013; Zhang et al., 2022). We previously demonstrated that DAF-16 localizes to endosomes in the intestinal cells (Meras et al., 2022). Interestingly, DAF-16 positive endosomes are not present in every cell or every animal and can vary from just a few to hundreds. We found that TBC-2 regulates DAF-16 localization. TBC-2 is a RAB-5 GTPase Activating Protein (GAP) that regulates early to late endosome maturation (Chotard et al., 2010). In tbc-2(tm2241) deletion mutants, DAF-16 localizes to irregularly shaped endomembranes to a greater extent than wild type and at the expense of nuclear localization (Meras et al., 2022). As such, TBC-2 antagonizes IIS-mediated gene expression, longevity, fat storage and resistance to several stresses (Meras et al., 2022; Traa et al., 2023). To determine if this localization was specific to DAF-16 we looked at two additional transcription factors that are differentially regulated by IIS, PQM-1 and HLH-30.
PQM-1 is a zinc finger transcription factor required for the long lifespan of daf-2 mutants (Tepper et al., 2013). Localization of PQM-1 is opposite that of DAF-16 whereby IIS promotes nuclear localization of PQM-1 while it antagonizes DAF-16 (Tepper et al., 2013). In tbc-2(-) animals, PQM-1::GFP showed some localization to endomembranes (Figure 1A-A', B). Despite the endomembrane localization of PQM-1, there was a significant increase in the number of animals with nuclear localized PQM-1 and an increase in the nuclear to cytosolic fluorescence intensity ratio of PQM-1 in tbc-2(-) mutants as compared to wild type (Figure 1C, D). This is consistent with the antagonistic genetic relation between PQM-1 with DAF-16 localization (Tepper et al., 2013).
HLH-30 or TFEB (Transcription factor EB) is a transcription factor involved in lysosomal biogenesis and acts in a combinatorial manner with DAF-16 in response to the starvation stress (Lapierre et al., 2013; Lin et al., 2018; O'Rourke & Ruvkun, 2013). In wild type we observed that endogenously tagged HLH-30:: 3xFlag::eGFP was mostly nuclear with some cytoplasmic and endomembrane localization (Figure 1E-E', F). In tbc-2(-) mutants, we observed an increase in the number of animals with HLH-30::3xFlag::eGFP localized to endomembranes (Figure 1E'', F). Similar results were seen with HLH-30::GFP and HLH-30::RFP transgenic animals (Figure 1F). Like DAF-16, HLH-30 showed reduced nuclear to cytosolic fluorescence intensity in tbc-2(-) mutant animals (Figure 1G). To test if the reduced nuclear localization of HLH-30 affected downstream HLH-30 dependent gene expression, we analysed the mRNA expression of lgg-1. LGG-1 is ATG8 in yeast and LC3 in mammals and is responsible for autophagosome formation (Melendez et al., 2003). LGG-1 expression is dependent on HLH-30, such that lgg-1 mRNA levels are suppressed in hlh-30(RNAi) (Lapierre et al., 2013). There was a significant decrease in the lgg-1 mRNA levels in tbc-2(-) mutants consistent with the reduced nuclear localization of HLH-30 (Figure 1H).
We observed that DAF-16 and HLH-30 co-localized on endomembranes in tbc-2(-) mutants indicating that TBC-2 might regulate these transcription factors by a common underlying mechanism (Figure 1 I-I''). To test if IIS regulates HLH-30 localization on endosomes as seen with DAF-16 (Meras et al., 2022), we use RNAi to systematically knock down components of the IIS pathway- DAF-2, AGE-1, PDK-1, AKT-1 and DAF-16 in tbc-2(-); HLH-30::GFP animals. Compared to empty vector control, RNAi mediated knock-down of daf-2, age-1 and akt-1 significantly decreased the number of tbc-2(-) mutant animals with HLH-30 on endomembranes (Figure 1J). pdk-1(RNAi) significantly suppressed HLH-30 endomembrane localization in three of four experiments (Figure 1J). daf-16 RNAi did not decrease the endomembrane localization of HLH-30 (Figure 1J). Thus, IIS signaling promotes the localization of HLH-30 to endomembrane compartments as it does with DAF-16.
In conclusion, this study builds upon our previous findings that TBC-2 regulates DAF-16 localization to endomembranes (Meras et al., 2022). We demonstrated that TBC-2 regulates the localization of two additional IIS regulated transcription factors, HLH-30 and PQM-1, further supporting a role for TBC-2 in antagonizing IIS in the intestine. Similar to DAF-16, we found that HLH-30 localizes to uncharacterized endomembrane compartments in tbc-2 mutants at the expense of its nuclear localization. The reduced expression of the HLH-30 target, lgg-1, in tbc-2(-) mutants suggests that this impacts HLH-30 transcriptional activity.
We found that HLH-30 colocalizes with DAF-16 on the same endomembranes in tbc-2(-) mutants suggesting a similar mode of regulation. HLH-30/TFEB and DAF-16/FOXO are inhibited by phosphorylation and binding with 14-3-3 proteins that sequester them in the cytoplasm (Brunet et al., 1999; Colino-Lage et al., 2024; Li et al., 2007; Lin et al., 2018; Martina et al., 2012; Roczniak-Ferguson et al., 2012). We previously demonstrated that FTT-2/14-3-3 and DAF-16 phosphorylation regulate DAF-16 localization to endomembranes (Meras et al., 2022). We anticipate that HLH-30 is also sequestered in a similar manner. However, we don't know whether 14-3-3 mediates HLH-30 and DAF-16 binding to these endomembrane structures or if there are additional factors involved.
DAF-16 and HLH-30 forms a complex and regulates overlapping stress response genes and lysosome morphology (Lin et al., 2018; Ricaurte-Perez et al., 2025). Whether they form a complex on endomembranes remains unclear. RNAi of daf-16 did not affect the localization of HLH-30 to endomembranes suggesting that there may not be a codependence for endomembrane localization. However, this should be further tested with null alleles.
Like DAF-16, we also found that IIS partially regulates the localization of HLH-30 to endomembranes. Thus, it is possible that other metabolic or stress response pathways such as AMPK, Tor, or JNK could be involved (El-Houjeiri et al., 2019; Greer et al., 2007; Lapierre et al., 2013; Martina et al., 2012; Oh et al., 2005; Roczniak-Ferguson et al., 2012; Settembre et al., 2012). Unlike DAF-16 and HLH-30, IIS promotes nuclear localization of PQM-1 (Tepper et al., 2013). Although we detected some endomembrane localization of PQM-1 in tbc-2 mutants, we found that the nuclear versus cytoplasmic localization of PQM-1 was increased suggesting increased nuclear import or possibly an increase in PQM-1 levels. This is consistent with our previous finding that tbc-2 mutants had increased expression of vha-6, a top PQM-1 target (Meras et al., 2022; Tepper et al., 2013). Taken together these results suggest that TBC-2 antagonizes IIS at a common point upstream of the DAF-16, HLH-30 and PQM-1 transcription factors.
","references":[{"reference":"Barbieri M, Bonafè M, Franceschi C, Paolisso G. 2003. Insulin/IGF-I-signaling pathway: an evolutionarily conserved mechanism of longevity from yeast to humans. American Journal of Physiology-Endocrinology and Metabolism 285: E1064-E1071.
","pubmedId":"","doi":"10.1152/ajpendo.00296.2003"},{"reference":"Brunet A, Bonni A, Zigmond MJ, Lin MZ, Juo P, Hu LS, et al., Greenberg. 1999. Akt Promotes Cell Survival by Phosphorylating and Inhibiting a Forkhead Transcription Factor. Cell 96: 857-868.
","pubmedId":"","doi":"10.1016/s0092-8674(00)80595-4"},{"reference":"Chotard L, Mishra AK, Sylvain MA, Tuck S, Lambright DG, Rocheleau CE. 2010. TBC-2 Regulates RAB-5/RAB-7-mediated Endosomal Trafficking in Caenorhabditis elegans. Molecular Biology of the Cell 21: 2285-2296.
","pubmedId":"","doi":"10.1091/mbc.E09-11-0947"},{"reference":"Colino-Lage H, Guerrero-Gómez D, Gómez-Orte E, González X, Martina JA, Dansen TB, et al., Miranda-Vizuete. 2024. Regulation of Caenorhabditis elegans HLH-30 subcellular localization dynamics: Evidence for a redox-dependent mechanism. Free Radical Biology and Medicine 223: 369-383.
","pubmedId":"","doi":"doi.org/10.1016/j.freeradbiomed.2024.07.027"},{"reference":"El-Houjeiri L, Possik E, Vijayaraghavan T, Paquette M, Martina JA, Kazan JM, et al., Pause. 2019. The Transcription Factors TFEB and TFE3 Link the FLCN-AMPK Signaling Axis to Innate Immune Response and Pathogen Resistance. Cell Reports 26: 3613-3628.e6.
","pubmedId":"","doi":"doi.org/10.1016/j.celrep.2019.02.102"},{"reference":"Fraser AG, Kamath RS, Zipperlen P, Martinez-Campos M, Sohrmann M, Ahringer J. 2000. Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature 408: 325-330.
","pubmedId":"","doi":"10.1038/35042517"},{"reference":"Friedman DB, Johnson TE. 1988. A mutation in the age-1 gene in Caenorhabditis elegans lengthens life and reduces hermaphrodite fertility.. Genetics 118: 75-86.
","pubmedId":"","doi":"10.1093/genetics/118.1.75"},{"reference":"Greer EL, Dowlatshahi D, Banko MR, Villen J, Hoang K, Blanchard D, Gygi SP, Brunet A. 2007. An AMPK-FOXO Pathway Mediates Longevity Induced by a Novel Method of Dietary Restriction in C. elegans. Current Biology 17: 1646-1656.
","pubmedId":"","doi":"10.1016/j.cub.2007.08.047"},{"reference":"Kamath RS, Fraser AG, Dong Y, Poulin G, Durbin R, Gotta M, et al., Ahringer. 2003. Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421: 231-237.
","pubmedId":"","doi":"10.1038/nature01278"},{"reference":"Kamath RS, Martinez-Campos M, Zipperlen P, Fraser AG, Ahringer J. 2000. Effectiveness of specific RNA-mediated interference through ingested double-stranded RNA in Caenorhabditis elegans. Genome Biology 2: 10.1186/gb-2000-2-1-research0002.
","pubmedId":"","doi":"10.1186/gb-2000-2-1-research0002"},{"reference":"Kenyon C, Chang J, Gensch E, Rudner A, Tabtiang R. 1993. A C. elegans mutant that lives twice as long as wild type. Nature 366: 461-464.
","pubmedId":"","doi":"10.1038/366461a0"},{"reference":"Kimura KD, Tissenbaum HA, Liu Y, Ruvkun G. 1997. daf-2\n , an Insulin Receptor-Like Gene That Regulates Longevity and Diapause in\n Caenorhabditis elegans. Science 277: 942-946.
","pubmedId":"","doi":"10.1126/science.277.5328.942"},{"reference":"Lapierre LR, De Magalhaes Filho CD, McQuary PR, Chu CC, Visvikis O, Chang JT, et al., Hansen. 2013. The TFEB orthologue HLH-30 regulates autophagy and modulates longevity in Caenorhabditis elegans. Nature Communications 4: 10.1038/ncomms3267.
","pubmedId":"","doi":"10.1038/ncomms3267"},{"reference":"Li J, Tewari M, Vidal M, Sylvia Lee S. 2007. The 14-3-3 protein FTT-2 regulates DAF-16 in Caenorhabditis elegans. Developmental Biology 301: 82-91.
","pubmedId":"","doi":"10.1016/j.ydbio.2006.10.013"},{"reference":"Lin K, Dorman JB, Rodan A, Kenyon C. 1997. daf-16\n : An HNF-3/forkhead Family Member That Can Function to Double the Life-Span of\n Caenorhabditis elegans. Science 278: 1319-1322.
","pubmedId":"","doi":"10.1126/science.278.5341.1319"},{"reference":"Lin XX, Sen I, Janssens GE, Zhou X, Fonslow BR, Edgar D, et al., Riedel. 2018. DAF-16/FOXO and HLH-30/TFEB function as combinatorial transcription factors to promote stress resistance and longevity. Nature Communications 9: 10.1038/s41467-018-06624-0.
","pubmedId":"","doi":"10.1038/s41467-018-06624-0"},{"reference":"Lithgow GJ, White TM, Hinerfeld DA, Johnson TE. 1994. Thermotolerance of a Long-lived Mutant of Caenorhabditis elegans. Journal of Gerontology 49: B270-B276.
","pubmedId":"","doi":"10.1093/geronj/49.6.b270"},{"reference":"Martina JA, Chen Y, Gucek M, Puertollano R. 2012. MTORC1 functions as a transcriptional regulator of autophagy by preventing nuclear transport of TFEB. Autophagy 8: 903-914.
","pubmedId":"","doi":"doi.org/10.4161/auto.19653"},{"reference":"Martina JA, Guerrero-Gómez D, Gómez-Orte E, Antonio Bárcena J, Cabello J, Miranda-Vizuete A, Puertollano R. 2021. A conserved cysteine-based redox mechanism sustains TFEB/HLH-30 activity under persistent stress. EMBO J 40(3): e105793.
","pubmedId":"33314217","doi":""},{"reference":"McGhee J. 2007. The C. elegans intestine. WormBook : 10.1895/wormbook.1.133.1.
","pubmedId":"","doi":"10.1895/wormbook.1.133.1"},{"reference":"Meléndez A, Tallóczy Z, Seaman M, Eskelinen EL, Hall DH, Levine B. 2003. Autophagy Genes Are Essential for Dauer Development and Life-Span Extension in\n C. elegans. Science 301: 1387-1391.
","pubmedId":"","doi":"10.1126/science.1087782"},{"reference":"Meraş I, Chotard L, Liontis T, Ratemi Z, Wiles B, Seo JH, Van Raamsdonk JM, Rocheleau CE. 2022. The Rab GTPase activating protein TBC-2 regulates endosomal localization of DAF-16 FOXO and lifespan. PLOS Genetics 18: e1010328.
","pubmedId":"","doi":"10.1371/journal.pgen.1010328"},{"reference":"Morris JZ, Tissenbaum HA, Ruvkun G. 1996. A phosphatidylinositol-3-OH kinase family member regulating longevity and diapause in Caenorhabditis elegans. Nature 382: 536-539.
","pubmedId":"","doi":"10.1038/382536a0"},{"reference":"Murphy CT. 2013. Insulin/insulin-like growth factor signaling in C. elegans. WormBook : 1-43.
","pubmedId":"","doi":"10.1895/wormbook.1.164.1"},{"reference":"Murphy JT, Liu H, Ma X, Shaver A, Egan BM, Oh C, et al., Diwan. 2019. Simple nutrients bypass the requirement for HLH-30 in coupling lysosomal nutrient sensing to survival. PLOS Biology 17: e3000245.
","pubmedId":"","doi":"10.1371/journal.pbio.3000245"},{"reference":"O’Rourke EJ, Ruvkun G. 2013. MXL-3 and HLH-30 transcriptionally link lipolysis and autophagy to nutrient availability. Nature Cell Biology 15: 668-676.
","pubmedId":"","doi":"10.1038/ncb2741"},{"reference":"Ogg S, Paradis S, Gottlieb S, Patterson GI, Lee L, Tissenbaum HA, Ruvkun G. 1997. The Fork head transcription factor DAF-16 transduces insulin-like metabolic and longevity signals in C. elegans. Nature 389: 994-999.
","pubmedId":"","doi":"10.1038/40194"},{"reference":"Oh SW, Mukhopadhyay A, Svrzikapa N, Jiang F, Davis RJ, Tissenbaum HA. 2005. JNK regulates lifespan in\n Caenorhabditis elegans\n by modulating nuclear translocation of forkhead transcription factor/DAF-16. Proceedings of the National Academy of Sciences 102: 4494-4499.
","pubmedId":"","doi":"10.1073/pnas.0500749102"},{"reference":"Paradis S, Ailion M, Toker A, Thomas JH, Ruvkun G. 1999. A PDK1 homolog is necessary and sufficient to transduce AGE-1 PI3 kinase signals that regulate diapause in Caenorhabditis elegans. Genes & Development 13: 1438-1452.
","pubmedId":"","doi":"10.1101/gad.13.11.1438"},{"reference":"Paradis S, Ruvkun G. 1998. Caenorhabditis elegans Akt/PKB transduces insulin receptor-like signals from AGE-1 PI3 kinase to the DAF-16 transcription factor. Genes & Development 12: 2488-2498.
","pubmedId":"","doi":"10.1101/gad.12.16.2488"},{"reference":"Ricaurte-Perez C, Gill JP, Wall PK, Dubuisson O, DeLeo KR, Bohnert KA, Johnson AE. 2025. DAF-16/FOXO and HLH-30/TFEB comprise a cooperative regulatory axis controlling tubular lysosome induction in C. elegans. Nature Communications 16: 10.1038/s41467-025-64832-x.
","pubmedId":"","doi":"doi.org/10.1038/s41467-025-64832-x"},{"reference":"Roczniak-Ferguson A, Petit CS, Froehlich F, Qian S, Ky J, Angarola B, Walther TC, Ferguson SM. 2012. The Transcription Factor TFEB Links mTORC1 Signaling to Transcriptional Control of Lysosome Homeostasis. Science Signaling 5: 10.1126/scisignal.2002790.
","pubmedId":"","doi":"10.1126/scisignal.2002790"},{"reference":"Sarov M, Schneider S, Pozniakovski A, Roguev A, Ernst S, Zhang Y, Hyman AA, Stewart AF. 2006. A recombineering pipeline for functional genomics applied to Caenorhabditis elegans. Nature Methods 3: 839-844.
","pubmedId":"","doi":"doi.org/10.1038/nmeth933"},{"reference":"Settembre C, Zoncu R, Medina DL, Vetrini F, Erdin S, Erdin S, et al., Ballabio. 2012. A lysosome‐to‐nucleus signalling mechanism senses and regulates the lysosome via mTOR and TFEB. The EMBO Journal 31: 1095-1108.
","pubmedId":"","doi":"10.1038/emboj.2012.32"},{"reference":"Tepper RG, Ashraf J, Kaletsky R, Kleemann G, Murphy CT, Bussemaker HJ. 2013. PQM-1 Complements DAF-16 as a Key Transcriptional Regulator of DAF-2-Mediated Development and Longevity. Cell 154: 676-690.
","pubmedId":"","doi":"10.1016/j.cell.2013.07.006"},{"reference":"Timmons L, Fire A. 1998. Specific interference by ingested dsRNA. Nature 395: 854-854.
","pubmedId":"","doi":"10.1038/27579"},{"reference":"Traa A, Soo SK, AlOkda A, Ko B, Rocheleau CE, Van Raamsdonk JM. 2023. Endosomal trafficking protein
Zhang YP, Zhang WH, Zhang P, Li Q, Sun Y, Wang JW, et al., Dong. 2022. Intestine-specific removal of DAF-2 nearly doubles lifespan in Caenorhabditis elegans with little fitness cost. Nature Communications 13: 10.1038/s41467-022-33850-4.
","pubmedId":"","doi":"10.1038/s41467-022-33850-4"},{"reference":"Zhong M, Niu W, Lu ZJ, Sarov M, Murray JI, Janette J, et al., Snyder. 2010. Genome-Wide Identification of Binding Sites Defines Distinct Functions for Caenorhabditis elegans PHA-4/FOXA in Development and Environmental Response. PLoS Genetics 6: e1000848.
","pubmedId":"","doi":"doi.org/10.1371/journal.pgen.1000848"}],"title":"TBC-2, a Rab GTPase activating protein, regulates the localization of the HLH-30/TFEB and PQM-1 transcription factors in the C. elegans intestine
","reviews":[],"curatorReviews":[{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":"1791856233412"},{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":"1791869858343"}]},{"id":"054cc822-9e8f-4174-9f52-4b934981d774","decision":"publish","abstract":"Insulin/IGF signaling (IIS) inhibits the nuclear localization of the DAF-16/FOXO transcription factor to regulate longevity and stress resistance in C. elegans. In the intestine, IIS promotes DAF-16 localization to endosomes and loss of TBC-2, a RAB-5 GAP, results in increased endomembrane localization of DAF-16 at the expense of nuclear localization, decreased DAF-16 target gene expression, longevity and stress resistance. Here we found that TBC-2 differentially regulates the localization of the IIS-regulated transcription factors PQM-1 and HLH-30/TFEB. Our results suggest a broader role for TBC-2 in regulating IIS and that TBC-2 likely functions at an upstream point in the IIS pathway.
","acknowledgements":"We would like to thank Jung Hwa Seo for technical assistance. We thank Kerry Kornfeld and Abhinav Diwan (Washington University) and Jeremy Van Raamsdonk (McGill University) for sharing strains and RNAi clones. Wormbase (wormbase.org) and Alliance of Genome Resources (alliancegenome.org) were critical knowledgebases for project conception and experimental design. Some strains were provided by the Caenorhabditis Genetics Center (CGC), which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
","authors":[{"affiliations":["McGill University, Montreal, QC, Canada"],"departments":["Department of Anatomy and Cell Biology"],"credit":["conceptualization","formalAnalysis","writing_originalDraft","investigation","writing_reviewEditing"],"email":"soumyendu.saha@mail.mcgill.ca","firstName":"Soumyendu","lastName":"Saha","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["McGill University, Montreal, QC, Canada"],"departments":["Department of Anatomy and Cell Biology"],"credit":["conceptualization","investigation"],"email":"icten.meras@mail.mcgill.ca","firstName":"Icten","lastName":"Meras","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["McGill University, Montreal, QC, Canada","RI-MUHC, Montreal, QC, CA","McGill University, Montreal, QC, Canada"],"departments":["Division of Endocrinology and Metabolism, Department of Medicine","Metabolic Disorders and Complications Program","Department of Anatomy and Cell Biology"],"credit":["conceptualization","fundingAcquisition","supervision","writing_reviewEditing"],"email":"christian.rocheleau@mcgill.ca","firstName":"Christian E.","lastName":"Rocheleau","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-6738-5636"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work was funded by a Canadian Institutes of Health Research (CIHR) Project Grants PJT-159725 and PTJ-191910 to CER. SS was funded by a studentship from the Division of Endocrinology and Metabolism and the MUHC Metabolic Centre of Excellence Grants Program.
","image":{"url":"https://portal.micropublication.org/uploads/a3e880693d69069891c8425c30f65e3b.png"},"imageCaption":"(A-A') Representative confocal images of PQM-1::GFP in the intestine of wild type and tbc-2(tm2241) mutants showing nuclear (n) and endomembrane localization (yellow arrow). ^ denotes autofluorescent gut granules. (B, C) Bar graphs showing the percent animals with PQM-1::GFP localization to endomembranes (B) and the nucleus (C). Experimental triplicates with 30-50 animals per replicate. (D) Box and scatter graph representing the ratio of nuclear to cytosolic fluorescence intensity of PQM-1::GFP in wild type (n=26) and tbc-2(tm2241) mutants (n=29), each data point is an individual intestinal cell. (E-E'') Confocal images of endogenously tagged HLH-30::3xFlag::eGFP in the intestine of wild type with and without endomembrane localization (E-E') and in tbc-2(tm2241) (E''). Nuclear (n) and endomembrane localization (yellow arrows). (F) Bar graph showing the percent animals with endomembrane localization of HLH-30::3xFlag::eGFP, HLH-30::GFP, and HLH-30::RFP in wild type and tbc-2(tm2241) mutants. Experimental replicates with 19-36 HLH-30::3xFlag::eGFP animals per replicate and 30-60 animals per replicate for HLH-30::GFP and HLH-30::RFP. (G) Box and scatter graphs representing the ratio of nuclear to cytosolic fluorescence intensity of HLH-30::3xFlag::eGFP, HLH-30::GFP, and HLH-30::RFP in wild type and tbc-2(tm2241) mutants, n > 18 for each condition. (H) Bar graph showing the fold change in lgg-1 mRNA expression levels between wild type and tbc-2(tm2241) mutant, in 3 biological replicates. (I-I'') Representative confocal images DAF-16::GFP and HLH-30::RFP colocalization in tbc-2(tm2241) as shown by the yellow arrow. ^ marks the auto fluorescent gut granules and n denotes nuclei. (J) Bar graph showing the percent animals with endosomal HLH-30::GFP in the tbc-2(tm2241) background, fed control (ev, empty vector) RNAi or RNAi targeting components of the IIS pathway. Each replicate represents >25 worms per condition. Paired Student T-test was used to analyse data in (B, C, F, H and J) and unpaired Student T-test was used to analyse data in (D and G). Scale bar, 10 μm. ns, not significant, *P < 0.05, **P<0.01 and ****P<0.0001.
","imageTitle":"TBC-2 regulates the localization of PQM-1 and HLH-30
","methods":"All strains were derived from the wild type N2 strain. Worms were maintained at 20°C on NGM plates as described in WormBook (www.wormbook.org). The strains were fed HB101 E. coli as a food source.
For RNAi feeding experiments fourth larval stage (L4) worms were placed on RNAi plates and transferred to fresh plates each day for 3 days. L4 progeny from the day 3 plates were scored for the experiment. RNAi feeding clones, except pdk-1, were obtained from the Ahringer RNAi library (Fraser et al., 2000; Kamath et al., 2000; Kamath et al. 2003). pdk-1 RNAi clone (pQcSS01) was generated by PCR of worm lysates using primers SSA38 5' - CAACTAAGATCTATTTCGTGATCGGACTTGTTG – 3' and SSA39 5' – GTCATACTCGAGGCTAGCATCATTTCCCAAATTCATC -3' and ligated to the L4440 vector from Addgene (https://www.addgene.org/1654/).
Live imaging of the L4 hermaphrodite worms was done at room temperature. The worms were transferred to a 2% agarose pad and immobilized with 10 mM levamisole. They were scored for nuclear or endosome localization of PQM-1, DAF-16 and HLH-30 under the fluorescent ZeissA1 axio Imager. To measure the fluorescence intensity of nuclear PQM-1 and HLH-30 L4 worms were imaged using a Zeiss Axio Observer Z1 LSM780 laser scanning confocal microscope in the Molecular Imaging Platform of the RI-MUHC. Image analysis was performed using Fiji (ImageJ).
For quantitative RT-PCR, RNA was extracted from young adult C. elegans using TRIZOL as explained in (Meras et al., 2022). LGG-1 was amplified using forward primer 5' – ACCCAGACCGTATTCCAGTG -3' and reverse primer 5' – ACGAAGTTGGATGCGTTTTC -3'.
","reagents":"Strain | Genotype | Source |
unc-119(tm4063) III; wgIs201[pqm-1::TY1::EGFP::3xFLAG(92C12) +unc-119(+)] | CGC; (Sarov et al., 2006; Zhong et al., 2010) | |
tbc-2(tm2241) II; wgIs201[pqm-1::TY1::EGFP::3xFLAG(92C12 + unc-119(+)] | This study | |
CGC; (Martina et al., 2021) | ||
This study | ||
CGC; (Lapierre et al., 2013) | ||
| tbc-2(tm2241) II; jinEx10 [hlh-30p::hlh-30::GFP + rol-6(su1006)] | This study |
(Murphy et al., 2019) | ||
This study | ||
daf-16(hq23[DAF-16::GFP]) I; tbc-2(tm2241) II;;hlh-30p::HLH-30::RFP+ rol-6(su1006) | This study | |
RNAi clone | Gene | Source |
L4440 | Empty vector control | (Timmons & Fire, 1998) |
III-7G12 | (Kamath et al., 2003) | |
II-7J02 | (Kamath et al., 2003) | |
V-7I17 | (Kamath et al., 2003) | |
I-5M24 | (Fraser et al., 2000) | |
pQcSS01 | This study |
Insulin/Insulin-like Growth Factor (IGF) signaling (IIS) is an evolutionarily conserved regulator of metabolism (Barbieri et al., 2003; Murphy & Hu, 2013). In C. elegans, the IIS pathway regulates lifespan, fat storage and resistance to various stresses (Friedman & Johnson, 1988; Kenyon et al., 1993; Kimura et al., 1997; Lithgow et al., 1994; Murphy & Hu, 2013; Ogg et al., 1997). The core pathway is defined by the DAF-2 insulin/IGF receptor, the AGE-1 class I PI3 kinase which generates PI(3,4,5)P which in turn recruits PDK-1 and AKT-1/2 kinases to the plasma membrane where PDK-1 phosphorylates and activates AKT-1/2. A major target of C. elegans IIS is the inhibition of the DAF-16/FOXO transcription (Kimura et al., 1997; Lin et al., 1997; Morris et al., 1996; Ogg et al., 1997; Paradis et al., 1999; Paradis & Ruvkun, 1998). Phosphorylation of FOXO transcription factors by AKT kinases results in cytoplasmic sequestration (Brunet et al., 1999).
The C. elegans intestine, while only 20 cells, is a major metabolic organ and site of many IIS-mediated functions (McGhee, 2007; Murphy & Hu, 2013; Zhang et al., 2022). We previously demonstrated that DAF-16 localizes to endosomes in the intestinal cells (Meras et al., 2022). Interestingly, DAF-16 positive endosomes are not present in every cell or every animal and can vary from just a few to hundreds. We found that TBC-2 regulates DAF-16 localization. TBC-2 is a RAB-5 GTPase Activating Protein (GAP) that regulates early to late endosome maturation (Chotard et al., 2010). In tbc-2(tm2241) deletion mutants, DAF-16 localizes to irregularly shaped endomembranes to a greater extent than wild type and at the expense of nuclear localization (Meras et al., 2022). As such, TBC-2 antagonizes IIS-mediated gene expression, longevity, fat storage and resistance to several stresses (Meras et al., 2022; Traa et al., 2023). To determine if this localization was specific to DAF-16 we looked at two additional transcription factors that are differentially regulated by IIS, PQM-1 and HLH-30.
PQM-1 is a zinc finger transcription factor required for the long lifespan of daf-2(-) mutants (Tepper et al., 2013). Localization of PQM-1 is opposite that of DAF-16 whereby IIS promotes nuclear localization of PQM-1 while it antagonizes DAF-16 (Tepper et al., 2013). In tbc-2(-) animals, PQM-1::GFP showed some localization to endomembranes (Figure 1A-A', B). Despite the endomembrane localization of PQM-1, there was a significant increase in the number of animals with nuclear localized PQM-1 and an increase in the nuclear to cytosolic fluorescence intensity ratio of PQM-1 in tbc-2(-) mutants as compared to wild type (Figure 1C, D). This is consistent with the antagonistic genetic relation between PQM-1 with DAF-16 localization (Tepper et al., 2013).
HLH-30 or TFEB (Transcription factor EB) is a transcription factor involved in lysosomal biogenesis and acts in a combinatorial manner with DAF-16 in response to the starvation stress (Lapierre et al., 2013; Lin et al., 2018; O'Rourke & Ruvkun, 2013). In wild type we observed that endogenously tagged HLH-30::3xFlag::eGFP was mostly nuclear with some cytoplasmic and endomembrane localization (Figure 1E-E', F). In tbc-2(-) mutants, we observed an increase in the number of animals with HLH-30::3xFlag::eGFP localized to endomembranes (Figure 1E'', F). Similar results were seen with HLH-30::GFP and HLH-30::RFP transgenic animals (Figure 1F). Like DAF-16, HLH-30 showed reduced nuclear to cytosolic fluorescence intensity in tbc-2(-) mutant animals (Figure 1G). To test if the reduced nuclear localization of HLH-30 affected downstream HLH-30 dependent gene expression, we analysed the mRNA expression of lgg-1. LGG-1 is ATG8 in yeast and LC3 in mammals and is responsible for autophagosome formation (Melendez et al., 2003). LGG-1 expression is dependent on HLH-30, such that lgg-1 mRNA levels are suppressed in hlh-30(RNAi) (Lapierre et al., 2013). There was a significant decrease in the lgg-1 mRNA levels in tbc-2(-) mutants consistent with the reduced nuclear localization of HLH-30 (Figure 1H).
We observed that DAF-16 and HLH-30 co-localized on endomembranes in tbc-2(-) mutants indicating that TBC-2 might regulate these transcription factors by a common underlying mechanism (Figure 1 I-I''). To test if IIS regulates HLH-30 localization on endosomes as seen with DAF-16 (Meras et al., 2022), we use RNAi to systematically knock down components of the IIS pathway- DAF-2, AGE-1, PDK-1, AKT-1 and DAF-16 in tbc-2(-); HLH-30::GFP animals. Compared to empty vector control, RNAi mediated knock-down of daf-2, age-1 and akt-1 significantly decreased the number of tbc-2(-) mutant animals with HLH-30 on endomembranes (Figure 1J). pdk-1(RNAi) significantly suppressed HLH-30 endomembrane localization in three of four experiments (Figure 1J). daf-16 RNAi did not decrease the endomembrane localization of HLH-30 (Figure 1J). Thus, IIS signaling promotes the localization of HLH-30 to endomembrane compartments as it does with DAF-16.
In conclusion, this study builds upon our previous findings that TBC-2 regulates DAF-16 localization to endomembranes (Meras et al., 2022). We demonstrated that TBC-2 regulates the localization of two additional IIS regulated transcription factors, HLH-30 and PQM-1, further supporting a role for TBC-2 in antagonizing IIS in the intestine. Similar to DAF-16, we found that HLH-30 localizes to uncharacterized endomembrane compartments in tbc-2(-) mutants at the expense of its nuclear localization. The reduced expression of the HLH-30 target, lgg-1, in tbc-2(-) mutants suggests that this impacts HLH-30 transcriptional activity.
We found that HLH-30 colocalizes with DAF-16 on the same endomembranes in tbc-2(-) mutants suggesting a similar mode of regulation. HLH-30/TFEB and DAF-16/FOXO are inhibited by phosphorylation and binding with 14-3-3 proteins that sequester them in the cytoplasm (Brunet et al., 1999; Colino-Lage et al., 2024; Li et al., 2007; Lin et al., 2018; Martina et al., 2012; Roczniak-Ferguson et al., 2012). We previously demonstrated that FTT-2/14-3-3 and DAF-16 phosphorylation regulate DAF-16 localization to endomembranes (Meras et al., 2022). We anticipate that HLH-30 is also sequestered in a similar manner. However, we don't know whether 14-3-3 mediates HLH-30 and DAF-16 binding to these endomembrane structures or if there are additional factors involved.
DAF-16 and HLH-30 forms a complex and regulates overlapping stress response genes and lysosome morphology (Lin et al., 2018; Ricaurte-Perez et al., 2025). Whether they form a complex on endomembranes remains unclear. RNAi of daf-16 did not affect the localization of HLH-30 to endomembranes suggesting that there may not be a codependence for endomembrane localization. However, this should be further tested with null alleles.
Like DAF-16, we also found that IIS partially regulates the localization of HLH-30 to endomembranes. Thus, it is possible that other metabolic or stress response pathways such as AMPK, Tor, or JNK could be involved (El-Houjeiri et al., 2019; Greer et al., 2007; Lapierre et al., 2013; Martina et al., 2012; Oh et al., 2005; Roczniak-Ferguson et al., 2012; Settembre et al., 2012). Unlike DAF-16 and HLH-30, IIS promotes nuclear localization of PQM-1 (Tepper et al., 2013). Although we detected some endomembrane localization of PQM-1 in tbc-2(-) mutants, we found that the nuclear versus cytoplasmic localization of PQM-1 was increased suggesting increased nuclear import or possibly an increase in PQM-1 levels. This is consistent with our previous finding that tbc-2(-) mutants had increased expression of vha-6, a top PQM-1 target (Meras et al., 2022; Tepper et al., 2013). Taken together these results suggest that TBC-2 antagonizes IIS at a common point upstream of the DAF-16, HLH-30 and PQM-1 transcription factors.
","references":[{"reference":"Barbieri M, Bonafè M, Franceschi C, Paolisso G. 2003. Insulin/IGF-I-signaling pathway: an evolutionarily conserved mechanism of longevity from yeast to humans. American Journal of Physiology-Endocrinology and Metabolism 285: E1064-E1071.
","pubmedId":"","doi":"10.1152/ajpendo.00296.2003"},{"reference":"Brunet A, Bonni A, Zigmond MJ, Lin MZ, Juo P, Hu LS, et al., Greenberg. 1999. Akt Promotes Cell Survival by Phosphorylating and Inhibiting a Forkhead Transcription Factor. Cell 96: 857-868.
","pubmedId":"","doi":"10.1016/s0092-8674(00)80595-4"},{"reference":"Chotard L, Mishra AK, Sylvain MA, Tuck S, Lambright DG, Rocheleau CE. 2010. TBC-2 Regulates RAB-5/RAB-7-mediated Endosomal Trafficking in Caenorhabditis elegans. Molecular Biology of the Cell 21: 2285-2296.
","pubmedId":"","doi":"10.1091/mbc.E09-11-0947"},{"reference":"Colino-Lage H, Guerrero-Gómez D, Gómez-Orte E, González X, Martina JA, Dansen TB, et al., Miranda-Vizuete. 2024. Regulation of Caenorhabditis elegans HLH-30 subcellular localization dynamics: Evidence for a redox-dependent mechanism. Free Radical Biology and Medicine 223: 369-383.
","pubmedId":"","doi":"doi.org/10.1016/j.freeradbiomed.2024.07.027"},{"reference":"El-Houjeiri L, Possik E, Vijayaraghavan T, Paquette M, Martina JA, Kazan JM, et al., Pause. 2019. The Transcription Factors TFEB and TFE3 Link the FLCN-AMPK Signaling Axis to Innate Immune Response and Pathogen Resistance. Cell Reports 26: 3613-3628.e6.
","pubmedId":"","doi":"doi.org/10.1016/j.celrep.2019.02.102"},{"reference":"Fraser AG, Kamath RS, Zipperlen P, Martinez-Campos M, Sohrmann M, Ahringer J. 2000. Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature 408: 325-330.
","pubmedId":"","doi":"10.1038/35042517"},{"reference":"Friedman DB, Johnson TE. 1988. A mutation in the age-1 gene in Caenorhabditis elegans lengthens life and reduces hermaphrodite fertility.. Genetics 118: 75-86.
","pubmedId":"","doi":"10.1093/genetics/118.1.75"},{"reference":"Greer EL, Dowlatshahi D, Banko MR, Villen J, Hoang K, Blanchard D, Gygi SP, Brunet A. 2007. An AMPK-FOXO Pathway Mediates Longevity Induced by a Novel Method of Dietary Restriction in C. elegans. Current Biology 17: 1646-1656.
","pubmedId":"","doi":"10.1016/j.cub.2007.08.047"},{"reference":"Kamath RS, Fraser AG, Dong Y, Poulin G, Durbin R, Gotta M, et al., Ahringer. 2003. Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421: 231-237.
","pubmedId":"","doi":"10.1038/nature01278"},{"reference":"Kamath RS, Martinez-Campos M, Zipperlen P, Fraser AG, Ahringer J. 2000. Effectiveness of specific RNA-mediated interference through ingested double-stranded RNA in Caenorhabditis elegans. Genome Biology 2: 10.1186/gb-2000-2-1-research0002.
","pubmedId":"","doi":"10.1186/gb-2000-2-1-research0002"},{"reference":"Kenyon C, Chang J, Gensch E, Rudner A, Tabtiang R. 1993. A C. elegans mutant that lives twice as long as wild type. Nature 366: 461-464.
","pubmedId":"","doi":"10.1038/366461a0"},{"reference":"Kimura KD, Tissenbaum HA, Liu Y, Ruvkun G. 1997. daf-2\n , an Insulin Receptor-Like Gene That Regulates Longevity and Diapause in\n Caenorhabditis elegans. Science 277: 942-946.
","pubmedId":"","doi":"10.1126/science.277.5328.942"},{"reference":"Lapierre LR, De Magalhaes Filho CD, McQuary PR, Chu CC, Visvikis O, Chang JT, et al., Hansen. 2013. The TFEB orthologue HLH-30 regulates autophagy and modulates longevity in Caenorhabditis elegans. Nature Communications 4: 10.1038/ncomms3267.
","pubmedId":"","doi":"10.1038/ncomms3267"},{"reference":"Li J, Tewari M, Vidal M, Sylvia Lee S. 2007. The 14-3-3 protein FTT-2 regulates DAF-16 in Caenorhabditis elegans. Developmental Biology 301: 82-91.
","pubmedId":"","doi":"10.1016/j.ydbio.2006.10.013"},{"reference":"Lin K, Dorman JB, Rodan A, Kenyon C. 1997. daf-16\n : An HNF-3/forkhead Family Member That Can Function to Double the Life-Span of\n Caenorhabditis elegans. Science 278: 1319-1322.
","pubmedId":"","doi":"10.1126/science.278.5341.1319"},{"reference":"Lin XX, Sen I, Janssens GE, Zhou X, Fonslow BR, Edgar D, et al., Riedel. 2018. DAF-16/FOXO and HLH-30/TFEB function as combinatorial transcription factors to promote stress resistance and longevity. Nature Communications 9: 10.1038/s41467-018-06624-0.
","pubmedId":"","doi":"10.1038/s41467-018-06624-0"},{"reference":"Lithgow GJ, White TM, Hinerfeld DA, Johnson TE. 1994. Thermotolerance of a Long-lived Mutant of Caenorhabditis elegans. Journal of Gerontology 49: B270-B276.
","pubmedId":"","doi":"10.1093/geronj/49.6.b270"},{"reference":"Martina JA, Chen Y, Gucek M, Puertollano R. 2012. MTORC1 functions as a transcriptional regulator of autophagy by preventing nuclear transport of TFEB. Autophagy 8: 903-914.
","pubmedId":"","doi":"doi.org/10.4161/auto.19653"},{"reference":"Martina JA, Guerrero-Gómez D, Gómez-Orte E, Antonio Bárcena J, Cabello J, Miranda-Vizuete A, Puertollano R. 2021. A conserved cysteine-based redox mechanism sustains TFEB/HLH-30 activity under persistent stress. EMBO J 40(3): e105793.
","pubmedId":"33314217","doi":""},{"reference":"McGhee J. 2007. The C. elegans intestine. WormBook : 10.1895/wormbook.1.133.1.
","pubmedId":"","doi":"10.1895/wormbook.1.133.1"},{"reference":"Meléndez A, Tallóczy Z, Seaman M, Eskelinen EL, Hall DH, Levine B. 2003. Autophagy Genes Are Essential for Dauer Development and Life-Span Extension in\n C. elegans. Science 301: 1387-1391.
","pubmedId":"","doi":"10.1126/science.1087782"},{"reference":"Meraş I, Chotard L, Liontis T, Ratemi Z, Wiles B, Seo JH, Van Raamsdonk JM, Rocheleau CE. 2022. The Rab GTPase activating protein TBC-2 regulates endosomal localization of DAF-16 FOXO and lifespan. PLOS Genetics 18: e1010328.
","pubmedId":"","doi":"10.1371/journal.pgen.1010328"},{"reference":"Morris JZ, Tissenbaum HA, Ruvkun G. 1996. A phosphatidylinositol-3-OH kinase family member regulating longevity and diapause in Caenorhabditis elegans. Nature 382: 536-539.
","pubmedId":"","doi":"10.1038/382536a0"},{"reference":"Murphy CT. 2013. Insulin/insulin-like growth factor signaling in C. elegans. WormBook : 1-43.
","pubmedId":"","doi":"10.1895/wormbook.1.164.1"},{"reference":"Murphy JT, Liu H, Ma X, Shaver A, Egan BM, Oh C, et al., Diwan. 2019. Simple nutrients bypass the requirement for HLH-30 in coupling lysosomal nutrient sensing to survival. PLOS Biology 17: e3000245.
","pubmedId":"","doi":"10.1371/journal.pbio.3000245"},{"reference":"O’Rourke EJ, Ruvkun G. 2013. MXL-3 and HLH-30 transcriptionally link lipolysis and autophagy to nutrient availability. Nature Cell Biology 15: 668-676.
","pubmedId":"","doi":"10.1038/ncb2741"},{"reference":"Ogg S, Paradis S, Gottlieb S, Patterson GI, Lee L, Tissenbaum HA, Ruvkun G. 1997. The Fork head transcription factor DAF-16 transduces insulin-like metabolic and longevity signals in C. elegans. Nature 389: 994-999.
","pubmedId":"","doi":"10.1038/40194"},{"reference":"Oh SW, Mukhopadhyay A, Svrzikapa N, Jiang F, Davis RJ, Tissenbaum HA. 2005. JNK regulates lifespan in\n Caenorhabditis elegans\n by modulating nuclear translocation of forkhead transcription factor/DAF-16. Proceedings of the National Academy of Sciences 102: 4494-4499.
","pubmedId":"","doi":"10.1073/pnas.0500749102"},{"reference":"Paradis S, Ailion M, Toker A, Thomas JH, Ruvkun G. 1999. A PDK1 homolog is necessary and sufficient to transduce AGE-1 PI3 kinase signals that regulate diapause in Caenorhabditis elegans. Genes & Development 13: 1438-1452.
","pubmedId":"","doi":"10.1101/gad.13.11.1438"},{"reference":"Paradis S, Ruvkun G. 1998. Caenorhabditis elegans Akt/PKB transduces insulin receptor-like signals from AGE-1 PI3 kinase to the DAF-16 transcription factor. Genes & Development 12: 2488-2498.
","pubmedId":"","doi":"10.1101/gad.12.16.2488"},{"reference":"Ricaurte-Perez C, Gill JP, Wall PK, Dubuisson O, DeLeo KR, Bohnert KA, Johnson AE. 2025. DAF-16/FOXO and HLH-30/TFEB comprise a cooperative regulatory axis controlling tubular lysosome induction in C. elegans. Nature Communications 16: 10.1038/s41467-025-64832-x.
","pubmedId":"","doi":"doi.org/10.1038/s41467-025-64832-x"},{"reference":"Roczniak-Ferguson A, Petit CS, Froehlich F, Qian S, Ky J, Angarola B, Walther TC, Ferguson SM. 2012. The Transcription Factor TFEB Links mTORC1 Signaling to Transcriptional Control of Lysosome Homeostasis. Science Signaling 5: 10.1126/scisignal.2002790.
","pubmedId":"","doi":"10.1126/scisignal.2002790"},{"reference":"Sarov M, Schneider S, Pozniakovski A, Roguev A, Ernst S, Zhang Y, Hyman AA, Stewart AF. 2006. A recombineering pipeline for functional genomics applied to Caenorhabditis elegans. Nature Methods 3: 839-844.
","pubmedId":"","doi":"doi.org/10.1038/nmeth933"},{"reference":"Settembre C, Zoncu R, Medina DL, Vetrini F, Erdin S, Erdin S, et al., Ballabio. 2012. A lysosome‐to‐nucleus signalling mechanism senses and regulates the lysosome via mTOR and TFEB. The EMBO Journal 31: 1095-1108.
","pubmedId":"","doi":"10.1038/emboj.2012.32"},{"reference":"Tepper RG, Ashraf J, Kaletsky R, Kleemann G, Murphy CT, Bussemaker HJ. 2013. PQM-1 Complements DAF-16 as a Key Transcriptional Regulator of DAF-2-Mediated Development and Longevity. Cell 154: 676-690.
","pubmedId":"","doi":"10.1016/j.cell.2013.07.006"},{"reference":"Timmons L, Fire A. 1998. Specific interference by ingested dsRNA. Nature 395: 854-854.
","pubmedId":"","doi":"10.1038/27579"},{"reference":"Traa A, Soo SK, AlOkda A, Ko B, Rocheleau CE, Van Raamsdonk JM. 2023. Endosomal trafficking protein
Zhang YP, Zhang WH, Zhang P, Li Q, Sun Y, Wang JW, et al., Dong. 2022. Intestine-specific removal of DAF-2 nearly doubles lifespan in Caenorhabditis elegans with little fitness cost. Nature Communications 13: 10.1038/s41467-022-33850-4.
","pubmedId":"","doi":"10.1038/s41467-022-33850-4"},{"reference":"Zhong M, Niu W, Lu ZJ, Sarov M, Murray JI, Janette J, et al., Snyder. 2010. Genome-Wide Identification of Binding Sites Defines Distinct Functions for Caenorhabditis elegans PHA-4/FOXA in Development and Environmental Response. PLoS Genetics 6: e1000848.
","pubmedId":"","doi":"doi.org/10.1371/journal.pgen.1000848"}],"title":"TBC-2, a Rab GTPase activating protein, regulates the localization of the HLH-30/TFEB and PQM-1 transcription factors in the C. elegans intestine
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null}]}]}},"species":{"species":[{"value":"acer saccharum","label":"Acer saccharum","imageSrc":"","imageAlt":"","mod":"TreeGenes","modLink":"https://treegenesdb.org","linkVariable":""},{"value":"achillea millefolium","label":"Achillea millefolium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"acinetobacter baylyi","label":"Acinetobacter baylyi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"actinobacteria bacterium","label":"Actinobacteria bacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adelges tsugae","label":"Adelges tsugae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adenocaulon chilense","label":"Adenocaulon chilense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aedes japonicus","label":"Aedes japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aegorhinus vitulus","label":"Aegorhinus vitulus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aerococcus","label":"Aerococcus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alaimidae","label":"Alaimidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"allobates femoralis","label":"Allobates femoralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alnus glutinosa","label":"Alnus glutinosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa aestivalis","label":"Alosa aestivalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa pseudoharengus","label":"Alosa pseudoharengus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alternaria alternata","label":"Alternaria alternata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"amynthas agrestis","label":"Amynthas Agrestis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma caninum","label":"Ancylostoma caninum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma ceylanicum","label":"Ancylostoma ceylanicum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anemone multifida","label":"Anemone multifida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anguilla rostrata","label":"Anguilla rostrata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anisakis simplex","label":"Anisakis simplex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anomala albopilosa","label":"Anomala albopilosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arabidopsis","label":"Arabidopsis","imageSrc":"arabidopsis.png","imageAlt":"Arabidopsis graphic by Zoe Zorn CC BY 4.0","mod":"TAIR","modLink":"https://arabidopsis.org","linkVariable":""},{"value":"architeuthis dux","label":"Architeuthis dux","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arion vulgaris","label":"Arion vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"armeria","label":"Armeria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"artemia","label":"Artemia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arthrobacter sp.","label":"Arthrobacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia","label":"Ascaridia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia galli","label":"Ascaridia galli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"asparagopsis taxiformis","label":"Asparagopsis taxiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"astatotilapia burtoni","label":"Astatotilapia burtoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"avena sativa","label":"Avena sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aves","label":"Aves","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus","label":"Bacillus (firmicutes)","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus cereus","label":"Bacillus cereus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus mycoides","label":"Bacillus mycoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus subtilis","label":"Bacillus subtilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus thuringiensis","label":"Bacillus thuringiensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus toyonensis","label":"Bacillus toyonensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus wiedmannii","label":"Bacillus wiedmannii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteria","label":"Bacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteriophage","label":"Bacteriophage","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bactrocera","label":"Bactrocera sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"batrachospermum gelatinosum","label":"Batrachospermum gelatinosum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula lenta","label":"Betula lenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula nigra","label":"Betula nigra","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus dahlbohmii","label":"Bombus dahlbohmii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus terrestris","label":"Bombus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombyx mori","label":"Bombyx mori","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bos taurus","label":"Bos Taurus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brachygobius doriae","label":"Brachygobius doriae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica oleracea","label":"Brassica oleracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica rapa","label":"Brassica rapa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brugia malayi","label":"Brugia malayi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"burkholderia thailandensis","label":"Burkholderia thailandensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"buttiauxella","label":"Buttiauxella","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis brenneri","label":"Caenorhabditis brenneri","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis briggsae","label":"Caenorhabditis briggsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"c. elegans","label":"Caenorhabditis elegans","imageSrc":"c-elegans.jpg","imageAlt":"C. elegans graphic by Zoe Zorn CC BY 4.0","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"caenorhabditis inopinata","label":"Caenorhabditis inopinata","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis japonica","label":"Caenorhabditis japonica","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis nigoni","label":"Caenorhabditis nigoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis remanei","label":"Caenorhabditis remanei","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis tropicalis","label":"Caenorhabditis tropicalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus","label":"Calidifontibacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus erzuremensis","label":"Calidifontibacillus erzuremensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calliphora sp","label":"Calliphora sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caltha sagittata","label":"Caltha sagittata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cambarus latimanus","label":"Cambarus latimanus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"candida albicans","label":"Candida albicans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"canis familiaris","label":"Canis familiaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cannabis sativa","label":"Cannabis sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caretta caretta","label":"Caretta caretta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cassiopea xamachana","label":"Cassiopea xamachana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caulobacter vibrioides","label":"Caulobacter vibrioides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cephalopods","label":"Cephalopoda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cerastium arvense","label":"Cerastium arvense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceriodaphnia","label":"Ceriodaphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceroglossus suturalis","label":"Ceroglossus suturalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chaetoceros","label":"Chaetoceros","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chamaecrista fasciculata","label":"Chamaecrista fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chilicola chalcidiformis","label":"Chilicola chalcidiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chitinimonas","label":"Chitinimonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chlamydomonas reinhardtii","label":"Chlamydomonas reinhardtii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chromobacterium","label":"Chromobacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysemys picta","label":"Chrysemys picta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysoperla rufilabris","label":"Chrysoperla rufilabris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"citrus","label":"Citrus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"clavibacter sp.","label":"Clavibacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"colinus virginianus","label":"Colinus virginianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crassostrea virginica","label":"Crassostrea virginica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crithidia fasciculata","label":"Crithidia fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cutibacterium acnes","label":"Cutibacterium acnes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cyanobacteria","label":"Cyanobacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia","label":"Daphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia pulex","label":"Daphnia pulex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dermacoccus nishinomiyaensis","label":"Dermacoccus nishinomiyaensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera","label":"Diabrotica virgifera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera virgifera virus 1","label":"Diabrotica virgifera virgifera virus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"d. discoideum","label":"Dictyostelium discoideum","imageSrc":"dicty.png","imageAlt":"D. discoideum","mod":"dictyBase","modLink":"http://dictybase.org","linkVariable":""},{"value":"diptera","label":"Diptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dotocryptus bellicosus","label":"Dotocryptus bellicosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drechmeria coniospora","label":"Drechmeria coniospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drosophila","label":"Drosophila","imageSrc":"drosophila.png","imageAlt":"Drosophila graphic by Zoe Zorn CC BY 4.0","mod":"FlyBase","modLink":"https://flybase.org/doi/","linkVariable":"doi"},{"value":"dryopteris campyloptera","label":"Dryopteris campyloptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris expansa","label":"Dryopteris expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris intermedia","label":"Dryopteris intermedia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dugesia dorotocephala","label":"Dugesia dorotocephala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"elasmobranchii","label":"Elasmobranchii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"embryophyta","label":"Embryophyta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enoploteuthis chunii","label":"Enoploteuthis chunii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterobacter aerogenes","label":"Enterobacter aerogenes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterococcus raffinosus","label":"Enterococcus raffinosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"epichloë coenophiala","label":"Epichloë coenophiala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"equus caballus","label":"Equus caballus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erigeron sp","label":"Erigeron sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eristalis","label":"Eristalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eruca vesicaria","label":"Eruca vesicaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erwinia carotovora","label":"Erwinia carotovora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erythronium americanum","label":"Erythronium americanum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"escherichia coli","label":"Escherichia coli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eukaryota","label":"Eukaryotes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"felis catus","label":"Felis catus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella novicida","label":"Francisella novicida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella tularensis","label":"Francisella tularensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fraxinus americana","label":"Fraxinus americana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fucus distichus","label":"Fucus distichus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fungi","label":"Fungi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gasteropelecus sp.","label":"Gasteropelecus sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"geranium sp","label":"Geranium sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"girardia","label":"Girardia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glaucomys volans","label":"Glaucomys volans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glycine max","label":"Glycine max","imageSrc":"","imageAlt":"","mod":"Soybase","modLink":"https://soybase.org","linkVariable":""},{"value":"glyptemys insculpta","label":"Glyptemys insculpta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gossypium hirsutum","label":"Gossypium hirsutum","imageSrc":"","imageAlt":"","mod":"CottonGen","modLink":"https://www.cottongen.org/","linkVariable":""},{"value":"gromphadorhina portentosa","label":"Gromphadorhina portentosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gryllodes sigillatus","label":"Gryllodes sigillatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"haliotis rufescens","label":"Haliotis rufescens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hepacivirus hominis","label":"Hepatitis C Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"herpes simplex virus type 1","label":"Herpes simplex virus type 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human","label":"Human","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human coronavirus oc43","label":"Human coronavirus OC43","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydra vulgaris","label":"Hydra vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydropsyche sp","label":"Hydropsyche sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hymenoptera","label":"Hymenoptera","imageSrc":"","imageAlt":"","mod":"Hymenoptera Genome Database","modLink":"https://hymenoptera.elsiklab.missouri.edu/","linkVariable":""},{"value":"hypochaeris radicata","label":"Hypochaeris radicata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hypodynerus vespiformis","label":"Hypodynerus vespiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflaviridae","label":"Iflaviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflavuris","label":"Iflavirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ipomoea hederacea","label":"Ipomoea hederacea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera","label":"Ischnomera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera ruficollis","label":"Ischnomera ruficollis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"julidochromis marlieri","label":"Julidochromis marlieri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"juniperus virginiana","label":"Juniperus virginiana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"kluyveromyces marxianus","label":"Kluyveromyces marxianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"l. casei","label":"L. casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lacticaseibacillus casei","label":"Lacticaseibacillus casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lactobacillus","label":"Lactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"larentiinae sp","label":"Larentiinae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"laurus nobilis","label":"Laurus nobilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lepidoptera","label":"Lepidoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"leucanthemum vulgare","label":"Leucanthemum vulgare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ligilactobacillus","label":"Ligilactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ligilactobacillus salivarius","label":"Ligilactobacillus salivarius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"limosilactobacillus","label":"Limosilactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"linepithema humile","label":"Linepithema humile","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"liometopum occidentale","label":"Liometopum occidentale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lolium arundinaceum","label":"Lolium arundinaceum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lontra longicaudis","label":"Lontra longicaudis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbriculus variegatus","label":"Lumbriculus variegatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbricus terrestris","label":"Lumbricus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lupinus polyphyllus","label":"Lupinus polyphyllus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lycorma delicatula","label":"Lycorma delicatula","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lynx rufus","label":"Lynx rufus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"magnaporthe oryzae","label":"Magnaporthe oryzae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mammalia","label":"Mammalia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"manihot esculenta","label":"Manihot esculenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"medicago lupulina","label":"Medicago lupulina","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"meloidogyne","label":"Meloidogyne","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mimus polyglottos","label":"Mimus polyglottos","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bryophyta","label":"Mosses","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mouse","label":"Mouse","imageSrc":"","imageAlt":"","mod":"MGI","modLink":"https://informatics.jax.org","linkVariable":""},{"value":"m. minutoides","label":"Mus minutoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mycobacterium smegmatis","label":"Mycobacterium smegmatis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nakaseomyces glabratus","label":"Nakaseomyces glabratus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nauphoeta cinerea","label":"Nauphoeta cinerea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"neurospora","label":"Neurospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"n. benthamiana","label":"Nicotiana benthamiana","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/Nicotiana_benthamiana/genome","linkVariable":""},{"value":"nicotiana tabacum","label":"Nicotiana tabacum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae","label":"Noctuidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae sp","label":"Noctuidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nothobranchius furzeri","label":"Nothobranchius furzeri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"onchocerca volvulus","label":"Onchocerca volvulus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"orconectes virilis","label":"Orconectes virilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ormia ochracea","label":"Ormia ochracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"o. sativa","label":"Oryza sativa","imageSrc":"","imageAlt":"","mod":"Gramene","modLink":"https://www.gramene.org/","linkVariable":""},{"value":"other","label":"Other","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"oxalis enneaphylla","label":"Oxalis enneaphylla","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea","label":"Pantoea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea agglomerans","label":"Pantoea agglomerans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"papaver sp","label":"Papaver sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paramecium bursaria","label":"Paramecium bursaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"partitiviridae","label":"Partitiviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pelodiscus sinensis","label":"Pelodiscus sinensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"perezia recurvata","label":"Perezia recurvata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"petromyzon marinus","label":"Petromyzon marinus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis","label":"Photinus pyralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis associated partiti-like virus","label":"Photinus pyralis associated partiti-like virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis iflavirus 1","label":"Photinus pyralis iflavirus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"physcomitrium patens","label":"Physcomitrium patens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus strobus","label":"Pinus strobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus taeda","label":"Pinus taeda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"platycheirus","label":"Platycheirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"plectus sambesii","label":"Plectus sambesii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pogonomyrmex occidentalis","label":"Pogonomyrmex occidentalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"poncirus trifoliata","label":"Poncirus trifoliata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"populus deltoides","label":"Populus deltoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"potato virus y","label":"Potato virus Y","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"primula magellanica","label":"Primula magellanica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pristionchus pacificus","label":"Pristionchus pacificus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"prunus persica","label":"Prunus persica","imageSrc":"","imageAlt":"","mod":"Genome Database for Rosaceae","modLink":"https://www.rosaceae.org/","linkVariable":""},{"value":"psalmopoeus iriminia","label":"Psalmopoeus iriminia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudanabaena sp.","label":"Pseudanabaena sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas","label":"Pseudomonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas aeruginosa","label":"Pseudomonas aeruginosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas glycinae","label":"Pseudomonas glycinae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas putida","label":"Pseudomonas putida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas syringae","label":"Pseudomonas syringae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pterophyllum scalare","label":"Pterophyllum scalare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"python regius","label":"Python regius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"quercus macrocarpa","label":"Quercus macrocarpa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ralstonia solanacearum","label":"Ralstonia solanacearum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranitomeya imitator","label":"Ranitomeya imitator","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranunculus peduncularis","label":"Ranunculus peduncularis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"rat","label":"Rat","imageSrc":"","imageAlt":"","mod":"RGD","modLink":"https://rgd.mcw.edu","linkVariable":""},{"value":"rheinheimera","label":"Rheinheimera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ribes rubrum","label":"Ribes rubrum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"sars-cov-2","label":"SARS-CoV-2","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. cerevisiae","label":"Saccharomyces cerevisiae","imageSrc":"yeast.png","imageAlt":"Yeast graphic by Zoe Zorn CC BY 4.0","mod":"SGD","modLink":"https://yeastgenome.org","linkVariable":""},{"value":"saccharomyces paradoxus","label":"Saccharomyces paradoxus ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. uvarum","label":"Saccharomyces uvarum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schistosoma","label":"Schistosoma","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schizosaccharomyces japonicus","label":"Schizosaccharomyces japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. pombe","label":"Schizosaccharomyces pombe","imageSrc":"pombe.png","imageAlt":"Pombe graphic by Zoe Zorn © Caltech","mod":"PomBase","modLink":"https://www.pombase.org/reference/PMID:","linkVariable":"pmId"},{"value":"schmidtea mediterranea","label":"Schmidtea mediterranea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"senecio sp","label":"Senecio sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"simocephalus","label":"Simocephalus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"siraitia grosvenorii","label":"Siraitia grosvenorii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"solanum lycopersicum","label":"Solanum lycopersicum","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/1/view/","linkVariable":""},{"value":"sorghum","label":"Sorghum","imageSrc":"","imageAlt":"","mod":"SorghumBase","modLink":"https://www.sorghumbase.org","linkVariable":""},{"value":"spiroplasma eriocheiris","label":"Spiroplasma eriocheiris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus aureus","label":"Staphylococcus aureus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus epidermidis","label":"Staphylococcus epidermidis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"steinernema carpocapsae","label":"Steinernema carpocapsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"steinernema hermaphroditum","label":"Steinernema hermaphroditum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stenotrophomonas geniculata","label":"Stenotrophomonas geniculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stewartia floidana","label":"Stewartia floridana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus gordonii ","label":"Streptococcus gordonii ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus mutans","label":"Streptococcus mutans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":" streptococcus pneumoniae","label":"Streptococcus pneumoniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. purpuratus","label":"Strongylocentrotus purpuratus","imageSrc":"","imageAlt":"","mod":"Echinobase","modLink":"https://www.echinobase.org","linkVariable":""},{"value":"strongyloides ratti","label":"Strongyloides ratti","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"sulfolobus","label":"Sulfolobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"symphoricarpos albus","label":"Symphoricarpos albus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syncirsodes","label":"Syncirsodes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"synechococcus elongatus","label":"Synechococcus elongatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syrphidae","label":"Syrphidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tarantobelus jeffdanielsi","label":"Tarantobelus jeffdanielsi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"taraxacum officinale","label":"Taraxacum officinale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tatochila theodice","label":"Tatochila theodice","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetrahymena","label":"Tetrahymena","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetramorium immigrans","label":"Tetramorium immigrans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tomato brown rugose fruit virus","label":"ToBRFV","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trachemys scripta","label":"Trachemys scripta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tribolium castaneum","label":"Tribolium castaneum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichoptera","label":"Trichoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichuris muris","label":"Trichuris muris","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"trifolium repens","label":"Trifolium repens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trypoxylus dichotomus","label":"Trypoxylus dichotomus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tsuga canadensis","label":"Tsuga canadensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ulva expansa","label":"Ulva expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"universal","label":"Universal","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"vargula hilgendorfii","label":"Vargula hilgendorfii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"vespula vulgaris","label":"Vespula vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"virus","label":"Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"watasenia scintillans","label":"Watasenia scintillans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"wolbachia pipientis","label":"Wolbachia pipientis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"xenopus","label":"Xenopus","imageSrc":"xenopus.png","imageAlt":"Xenopus graphic by Zoe Zorn CC BY 4.0","mod":"XenBase","modLink":"https://xenbase.org","linkVariable":""},{"value":"xenorhabdus griffiniae","label":"Xenorhabdus griffiniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"yramea cytheris","label":"Yramea cytheris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zaprionus indianus","label":"Zaprionus indianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zea mays","label":"Zea mays","imageSrc":"","imageAlt":"","mod":"MaizeGDB","modLink":"https://www.maizegdb.org","linkVariable":""},{"value":"zebrafish","label":"Zebrafish","imageSrc":"zebrafish.png","imageAlt":"Zebrafish graphic by Zoe Zorn CC BY 4.0","mod":"ZFIN","modLink":"https://zfin.org","linkVariable":""}]}},"pageContext":{"id":"066d0e4a-9a01-4ef1-ad02-e700ca05c261","citedBy":[],"parsedCsv":{"csvHeader":[],"csvData":[]}}}, "staticQueryHashes": ["2114697108"]}