During embryonic elongation in C. elegans multiple actin-binding proteins cooperate to regulate cell shape changes. We investigated whether LIM-8, a LIM domain-containing protein expressed in the elongating epidermis, contributes to this process. We endogenously tagged all isoforms of LIM-8; LIM-8::mNeonGreen localizes to aligned actin filaments in the embryonic epidermis during elongation, in addition to several adult tissues. LIM-8 is not essential for embryonic elongation and we were unable to identify functional interactions with hmp-1/a-catenin, sma-1/bH-spectrin, or other LIM domain containing proteins, suggesting that, despite its striking localization, LIM-8 does not make major contributions to actin regulation during embryonic elongation.
","acknowledgements":"Some strains were provided by the C. elegans Genetics Center, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
","authors":[{"affiliations":["UW-Madison"],"departments":["Cellular and Molecular Biology Program"],"credit":["conceptualization","formalAnalysis","investigation","methodology","validation","visualization","writing_originalDraft","writing_reviewEditing"],"email":"amarkle@wisc.edu","firstName":"Adelle","lastName":"Markle","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0005-0114-1782"},{"affiliations":["UW–Madison, Madison, WI, United States","UW–Madison, Madison, WI, United States"],"departments":["Biology","Cellular and Molecular Biology Program"],"credit":["conceptualization","formalAnalysis","fundingAcquisition","supervision","writing_reviewEditing"],"email":"jdhardin@wisc.edu","firstName":"Jeff","lastName":"Hardin","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-7399-6580"}],"awards":[{"awardId":"R35 GM145312","funderName":"National Institutes of Health (United States)","awardRecipient":"J. Hardin"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"FASTA files for the lim-8 final exon and knock-in sequences
","doi":null,"resourceType":"Dataset","name":"lim-8 last exon and knock in.fa","url":"https://portal.micropublication.org/uploads/1349fe9a67dd0165913e70c0e3c582ae.fa"},{"description":"FASTA files for new alp-1 RNAi construct
","doi":null,"resourceType":"Dataset","name":"new alp-1 RNAi construct.fa","url":"https://portal.micropublication.org/uploads/7c0f882b454916728944e1a89be4717e.fa"}],"funding":"","image":{"url":"https://portal.micropublication.org/uploads/47d065df13b5a33e945c350af7274b77.jpg"},"imageCaption":"A: Schematic of the lim-8 locus showing tagging strategy. Black boxes: coding exons. White boxes: UTR. Green boxes: FLAG, linker, and mNeonGreen-encoding exons. B-D: Embryos showing LIM-8::mNG expression at comma stage, two-fold, and late elongation. Images are maximum-intensity Z projections of 0.9 µm stacks. Scale bars = 10 µm. E: LIM-8::mNG colocalizes with LifeAct on circumferential filament bundles (CFBs) and along adherens junctions. Images are maximum-intensity Z projections of 0.9 µm stacks. White arrow: CFBs. White arrowhead: seam cell actin mesh. Black arrow: Adherens junction at a seam-non-seam boundary. Scale bar = 10 µm. F: LIM-8::mNG expression in the pharynx of an adult worm. Image is a maximum intensity Z projection of a 4.5 µm stack. White arrow: anterior bulb. White arrowhead: terminal bulb. Scale bar = 10 µm. G: LIM-8::mNG expression in the uterus of an adult worm merged with the corresponding DIC image. Scale bar = 20 µm. H: LIM-8::mNG expression in the rectal and posterior phasmid systems. Image is a maximum-intensity Z projection of a 9.5 µm stack. Due to the strength of the signal in the phasmid cells, this image was acquired at lower laser power than other images. White arrows: phasmid system. White arrowhead: rectal system. Scale bar = 10 µm. I: LIM-8::mNG expression in an occupied spermatheca. LIM-8 signal is not specific to actin bundles but does accumulate at cell-cell junctions in a more apical view (I'). Images are maximum-intensity Z projections of 1.5 µm stacks, with I' immediately apical to I. Scale bar = 10 µm. J: Lethality counts do not reveal any role for lim-8 in sensitized backgrounds. N represents the number of adult worms whose progeny was scored. ns, not significant (P > 0.05 in all cases).
","imageTitle":"LIM-8 is expressed in the epidermis during embryonic elongation as well as other adult tissues but does not make major contributions to embryonic elongation
","methods":"Strains
Hermaphrodite C. elegans were maintained at 20°C on nematode growth media (NGM) plates seeded with E. coli strain OP50 according to standard protocols. N2 Bristol was used as wildtype (Brenner, 1974).
Strains used:
N2: Wildtype, from C. elegans Genetics Center (CGC)
SU1073: zyx-1(cp419)II; tes-1(ok1036)IV from (Lynch et al., 2022)
PS9957: lim-8(sy1989) III from CGC (Wang et al., 2018)
SU1164: zyx-1(cp419) II; lim-8(sy1989) III; tes-1(ok1036) IV from this study
SU1168: lim-8(jc116[lim-8::FLAG::mNG+LoxP]) III 2xOC from this study
AZ30: sma-1(ru18) V from (Praitis et al., 2005)
SU1170: sma-1(ru18) V 4xOC from this study
SU1349: curIs11[plin-26::LifeAct::mCherry]; lim-8(jc116[lim-8::FLAG::mNG+LoxP]) III from this study. Note: the LifeAct integrant likely resides on LG X
hmp-1(fe4) V isolated from balanced line SU287 (hmp-1(fe4)/lon-3(e2175) V) (Lynch et al., 2012) on 6/20/2026
Confocal imaging
Embryos were mounted on 10% agar pads in M9 buffer according to standard protocols (Hardin et al., 2022). Embryos were surrounded with OP50 during mounting to paralyze them by hypoxia (Gally et al., 2009). Confocal images were collected at 20°C using a Dragonfly 500 spinning disc confocal microscope (Oxford Instruments) mounted on a Leica DMi8 microscope equipped with a 63X glycerol immersion objective and a Zyla camera and controlled by Fusion software (Oxford Instruments) using a slice spacing of 0.3 μm. Adult worms were mounted on 9% agarose pads in M9 buffer and imaged using the same settings as for embryos, except that Z stacks were collected with a step size of 0.5 μm.
CRISPR/Cas9 genome editing
To endogenously tag the C. elegans lim-8 locus with FLAG and mNeonGreen, we used the self-excising selection cassette (SEC) method previously described by Dickinson et al. (Dickinson et al., 2015). The guide sequence was cloned into pJW1219 using blunt-end cloning to produce pARM1. A repair template for the C terminus of LIM-8 was generated using SapTrap cloning (Dickinson et al., 2018; Schwartz and Jorgensen, 2016) to assemble homology arms, linker, mNG, and self-excising cassette into the pMLS257 backbone to form pARM2. The forward primer for the 3' homology arm introduced a mutation to remove the PAM. pARM1 at 50 ng/µl and pARM2 at 15 ng/µl were injected into the gonads of adult C. elegans hermaphrodites along with coinjection markers pGH8 (4ng/µl), pCFJ90 (2ng/µl), and pCFJ104 (4ng/µl). Hygromycin selection for worms with the SEC, screening, and removal of SEC by heat shock were performed as described in Dickinson et al. (Dickinson et al., 2015). Oligonucleotides used for cloning, genotyping, and sequencing are as follows (Sequence complementary to C. elegans DNA indicated in ALL CAPS, mutation introduced to remove PAM in red):
pJW1219 F with guide sequence added: ACATTCTAGAAAGAACTTCTgtttaagagctatgctggaaacag
pJW1219 R: caagacatctcgcaataggag
pJW1219 gRNA sequencing: gtgtgaaataccgcacaga
5' homology arm forward: ggctgctcttcgtggGCTACGTCATCGTCGTTGAGG
5' homology arm reverse: gggtgctcttcgcgcGACTTTGCTCAATTGCACACGATC
3' homology arm forward: ggctgctcttcgggtTAAGCTCTAAATAGTCCAGTCgCAGAAGTTC
3' homology arm reverse: gggtgctcttcgtacGCGGTCGGTTTTGAGTTTCC
SEC sequencing reverse for repair template: ttaatgtgagttagctcactcattagg
lim-8 knock in genotyping forward: GCTACGTCATCGTCGTTGAGG
lim-8 knock in genotyping reverse: CCACCTCCGCCGTATAATGC
lim-8 knock in sequencing: GGACGTGGTGCTGCAATGAT
Cloning
Approximately 0.5kb of the alp-1 coding region, common to all known isoforms and not sharing sequences with any other known gene, was amplified from N2 worm cDNA and cloned into the L4440 feeding RNAi vector using standard restriction cloning techniques to produce pARM4. Oligonucleotides used for cloning are as follows (Sequence complementary to C. elegans DNA indicated in ALL CAPS):
Forward primer for alp-1 cDNA with HindIII restriction site added: gcaagcttGGAGTGATGGCTCGTGCAG
Reverse primer for alp-1 cDNA with NheI restriction site added: gcgctagcCATTTGAAGGTGGTGGATTTGACGG
RNAi and plate counts
dsRNA was generated using T7 transcription kit using a lim-8 cDNA clone (courtesy of G. Benian) and pARM4 as templates. dsRNA was injected into L4/young adult worms at 2 µg/µl for alp-1 and 3 µg/µl for lim-8. Uninjected young adults and injected worms 20-24 hours post-injection were singled and allowed to lay for 20-24 hours. For hmp-1(fe4) and sma-1(ru18) lines this time was extended up to 28 hours due to gonad defects in hmp-1(fe4) and body morphology defects in both lines, which slowed egg laying. Adult worms were then removed; 20-24 hours after removal of the adult worm, the number of hatchlings and dead eggs on each plate was counted. Each experiment was performed twice.
Statistical analysis
Percent lethality data, with the offspring of each worm considered as a biological replicate, were compared using Welch's t test (where two groups were to be compared), and one-way Brown-Forsythe and Welch ANOVA (where three groups were to be compared) to assess the significance of differences between groups using GraphPad Prism software. N values for each group are included in Figure 1J.
Results and Discussion
Embryonic elongation of the C. elegans embryo is a powerful system for exploring the actin regulatory mechanisms that facilitate coordinated cell shape change. During embryonic elongation, the C. elegans embryo increases in length four-fold while reducing its diameter three-fold; this dramatic morphological change is accomplished by actomyosin-mediated epidermal cell shape changes, without any contribution from cell division or migration (reviewed in (Labouesse et al., 2026)). Proteins containing LIM domains are known to bind actin filaments under tension and have been implicated in repair of strained actin bundles (Smith et al., 2010; Smith et al., 2014; Sun et al., 2020). In C. elegans, LIM domain proteins have been investigated in striated body wall muscle (Lecroisey et al., 2013; Lecroisey et al., 2008; Qadota et al., 2007), synapses (Luo et al., 2014), and gastrulation (Slabodnick et al., 2023). We recently showed that two LIM domain containing repeat (LCR) proteins, ZYX-1 and TES-1, play roles at cell-cell junctions in elongating C. elegans embryos (Lynch et al., 2022), and so we sought to examine other C. elegansLIM domain containing proteins in the context of embryonic elongation. One such protein that has not been characterized during elongation is LIM-8, despite available single cell RNAseq data indicating it is expressed in the epidermis during elongation (Packer et al., 2019).
We endogenously tagged all known LIM-8 isoforms with mNeonGreen using CRISPR/Cas9 genome editing technology (Fig. 1A). LIM-8::mNG signal is first visible during early elongation, though it remains dim until the two-fold stage (Fig. 1B, 1C). During the second, muscle contraction-dependent phase of elongation, LIM-8::mNG signal is bright and localized to circumferential F-actin filament bundles (CFBs;(Priess and Hirsh, 1986)) in dorsal and ventral epidermal cells, the mesh-like actin network in seam epidermal cells (Costa et al., 1997; Gally et al., 2009), and proximal actin networks associated with adherens junctions ((Costa et al., 1998); Fig. 1D, 1E). During this phase of elongation, the LIM-8::mNG knock-in may have utility as an endogenously encoded reporter of F-actin organization, particularly as an alternative to LifeAct (Havrylenko et al., 2015) or the F-actin-binding fragment of the spectraplakin VAB-10 (Gally et al., 2009) for assessing the organization and alignment of CFBs in the embryonic epidermis.
In adult worms, LIM-8::mNG signal is visible in the pharynx, as expected from previously reported promotor::GFP fusion experiments ((Qadota et al., 2007); Fig. 1F). LIM-8::mNG is also expressed in the uterus, the rectal and phasmid systems, and the spermatheca (Fig. 1G, 1H, 1I). Unlike in the epidermis of elongating embryos, LIM-8 in the spermatheca does not accumulate on aligned actin filaments but instead has a speckled appearance and localizes basal to adherens junctions (Fig. 1I). This localization pattern was observed in both occupied and unoccupied spermathecae, suggesting that the tension state of the actin filaments in the spermatheca does not determine whether LIM-8 is recruited. In the spermatheca, LIM-8 also localizes to apical adherens junctions (Fig. 1I'). While LIM-8 has been shown by antibody staining to localize to the M line in adult body wall muscle (Qadota et al., 2007), we were unable to detect LIM-8::mNG in body wall muscle under our imaging conditions.
While lim-8 loss of function alone is not associated with overt phenotypes (Qadota et al., 2007), the strong actin localization of LIM-8 during elongation, combined with previously identified roles for LIM-domain containing proteins TES-1 and ZYX-1 using sensitized backgrounds (Lynch et al., 2022), led us to consider whether LIM-8 might be functionally redundant with other actin-binding proteins during elongation. Since both tes-1 and zyx-1 loss of function enhance the lethality of the hypomorphic α-catenin mutant hmp-1(fe4), we tested whether lim-8 might also be a hmp-1(fe4) enhancer. We observed no significant difference in embryonic lethality between offspring of hmp-1(fe4) mothers and hmp-1(fe4) mothers injected with lim-8 dsRNA (Fig. 1J). We also tested whether a STOP-IN null allele (Wang et al., 2018) for lim-8 would synergize with mutant alleles for other genes involved in elongation. The βH-spectrin sma-1 is essential for efficient elongation, and loss of sma-1 function, while not lethal, results in hatchlings that reach just over two-fold, rather than complete four-fold elongation (McKeown et al., 1998; Praitis et al., 2005). A lim-8;sma-1 double null line did not show any embryonic lethality, and no obvious additional morphological defects were observed on plates (Fig. 1J). To ask whether loss of LIM-8 might synergize with other LIM domain-containing proteins during elongation, we crossed the lim-8 null allele with tes-1 and zyx-1 null alleles. Since the resulting line likewise did not display embryonic lethality, we considered whether another LIM domain containing protein, ALP-1, might be supporting elongation in this background through functional redundancy (Fig. 1J). As the existing Ahringer library clone targeted to alp-1covers sequence unique to the d isoform and the clone used to knock down alp-1 expression in previous studies is targeted to T11B7.5, a gene found in an intron of alp-1, and therefore is not specific to alp-1 (McKeown et al., 2006), we generated a new RNAi clone targeting all known isoforms of alp-1 but only sequences specific to that gene. Injection of alp-1 dsRNA generated using this clone into the lim-8(su1989); tes-1(ok1036); zyx-1(cp419) line did not result in any embryonic lethality (Fig. 1J).
From these results, we conclude that LIM-8 does not make major contributions to C. elegans embryonic elongation. Any role it may play is dispensable for proper elongation; it is possible that additional proteins act redundantly with LIM-8 that we did not address in this study. Nevertheless, the differences in LIM-8 localization between the epidermis and the spermatheca suggest that LIM-8 may be a useful probe for interrogating the mechanisms regulating the association of LIM domain-containing proteins with actin filaments, which may be of biological relevance in other contexts.
","references":[{"reference":"Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics. 77: 71-94. 6.","pubmedId":"4366476","doi":""},{"reference":"Costa M, Draper BW, Priess JR. 1997. The role of actin filaments in patterning the Caenorhabditis elegans cuticle. Dev Biol. 184: 373-84. 30.","pubmedId":"9133443","doi":"10.1006/dbio.1997.8530"},{"reference":"Costa M, Raich W, Agbunag C, Leung B, Hardin J, Priess JR. 1998. A putative catenin-cadherin system mediates morphogenesis of the Caenorhabditis elegans embryo. J Cell Biol. 141: 297-308. 29.","pubmedId":"9531567","doi":"10.1083/jcb.141.1.297"},{"reference":"Dickinson D, Slabodnick M, Chen A, Goldstein B. 2018. SapTrap assembly of repair templates for Cas9-triggered homologous recombination with a self-excising cassette. MicroPubl Biol. 2018 27.","pubmedId":"32550377","doi":"10.17912/W2KT0N"},{"reference":"Dickinson DJ, Pani AM, Heppert JK, Higgins CD, Goldstein B. 2015. Streamlined Genome Engineering with a Self-Excising Drug Selection Cassette. Genetics. 200: 1035-49. 26.","pubmedId":"26044593","doi":"10.1534/genetics.115.178335"},{"reference":"Gally C, Wissler F, Zahreddine H, Quintin S, Landmann F, Labouesse M. 2009. Myosin II regulation during C. elegans embryonic elongation: LET-502/ROCK, MRCK-1 and PAK-1, three kinases with different roles. Development. 136: 3109-19. 25.","pubmedId":"19675126","doi":"10.1242/dev.039412"},{"reference":"Hardin J, Serre J, King R, Walck Shannon E, Reiner D. 2022. Imaging Epidermal Cell Rearrangement in the C. elegans Embryo. Methods Mol Biol. 2438: 345-376. 24.","pubmedId":"35147953","doi":"10.1007/978-1-0716-2035-9_22"},{"reference":"Havrylenko S, Noguera P, Abou Ghali M, Manzi J, Faqir F, Lamora A, et al., Plastino J. 2015. WAVE binds Ena/VASP for enhanced Arp2/3 complex-based actin assembly. Mol Biol Cell. 26: 55-65. 32.","pubmedId":"25355952","doi":"10.1091/mbc.E14-07-1200"},{"reference":"Labouesse M, Ferraro T, Llense F, Heier J, Tesone Z, Hardin J. 2026. Cellular Processes and Forces Shaping the Embryo: Lessons from C. elegans. Cells. 15 7.","pubmedId":"41972734","doi":"10.3390/cells15070645"},{"reference":"Lecroisey C, Brouilly N, Qadota H, Mariol MC, Rochette NC, Martin E, et al., Gieseler K. 2013. ZYX-1, the unique zyxin protein of Caenorhabditis elegans, is involved in dystrophin-dependent muscle degeneration. Mol Biol Cell. 24: 1232-49. 1.","pubmedId":"23427270","doi":"10.1091/mbc.E12-09-0679"},{"reference":"Lecroisey C, Martin E, Mariol MC, Granger L, Schwab Y, Labouesse M, Segalat L, Gieseler K. 2008. DYC-1, a protein functionally linked to dystrophin in Caenorhabditis elegans is associated with the dense body, where it interacts with the muscle LIM domain protein ZYX-1. Mol Biol Cell. 19: 785-96. 2.","pubmedId":"18094057","doi":"10.1091/mbc.E07-05-0497"},{"reference":"Luo S, Schaefer AM, Dour S, Nonet ML. 2014. The conserved LIM domain-containing focal adhesion protein ZYX-1 regulates synapse maintenance in Caenorhabditis elegans. Development. 141: 3922-33. 14.","pubmedId":"25252943","doi":"10.1242/dev.108217"},{"reference":"Lynch AM, Grana T, Cox Paulson E, Couthier A, Cameron M, Chin Sang I, Pettitt J, Hardin J. 2012. A Genome-wide Functional Screen Shows MAGI-1 Is an L1CAM-Dependent Stabilizer of Apical Junctions in C. elegans. Curr Biol. 22: 1891-9. 4.","pubmedId":"22981773","doi":"10.1016/j.cub.2012.08.024"},{"reference":"Lynch AM, Zhu Y, Lucas BG, Winkelman JD, Bai K, Martin SCT, et al., Hardin J. 2022. TES-1/Tes and ZYX-1/Zyxin protect junctional actin networks under tension during epidermal morphogenesis in the C. elegans embryo. Curr Biol. 32: 5189-5199 e6. 18.","pubmedId":"36384139","doi":"10.1016/j.cub.2022.10.045"},{"reference":"Mc Keown C, Praitis V, Austin J. 1998. sma-1 encodes a betaH-spectrin homolog required for Caenorhabditis elegans morphogenesis. Development. 125: 2087-98. 20.","pubmedId":"9570773","doi":""},{"reference":"Mc Keown CR, Han HF, Beckerle MC. 2006. Molecular characterization of the Caenorhabditis elegans ALP/Enigma gene alp-1. Dev Dyn. 235: 530-8. 22.","pubmedId":"16278882","doi":"10.1002/dvdy.20633"},{"reference":"Packer JS, Zhu Q, Huynh C, Sivaramakrishnan P, Preston E, Dueck H, et al., Murray JI. 2019. A lineage-resolved molecular atlas of C. elegans embryogenesis at single-cell resolution. Science. 365 16.","pubmedId":"31488706","doi":"10.1126/science.aax1971"},{"reference":"Praitis V, Ciccone E, Austin J. 2005. SMA-1 spectrin has essential roles in epithelial cell sheet morphogenesis in C. elegans. Dev Biol. 283: 157-70. 21.","pubmedId":"15890334","doi":""},{"reference":"Priess JR, Hirsh DI. 1986. Caenorhabditis elegans morphogenesis: the role of the cytoskeleton in elongation of the embryo. Dev Biol. 117: 156-73. 5.","pubmedId":"3743895","doi":""},{"reference":"Qadota H, Mercer KB, Miller RK, Kaibuchi K, Benian GM. 2007. Two LIM domain proteins and UNC-96 link UNC-97/pinch to myosin thick filaments in Caenorhabditis elegans muscle. Mol Biol Cell. 18: 4317-26. 8.","pubmedId":"17761533","doi":"10.1091/mbc.e07-03-0278"},{"reference":"Schwartz ML, Jorgensen EM. 2016. SapTrap, a Toolkit for High-Throughput CRISPR/Cas9 Gene Modification in Caenorhabditis elegans. Genetics. 202: 1277-88. 28.","pubmedId":"26837755","doi":"10.1534/genetics.115.184275"},{"reference":"Slabodnick MM, Tintori SC, Prakash M, Zhang P, Higgins CD, Chen AH, et al., Goldstein B. 2023. Zyxin contributes to coupling between cell junctions and contractile actomyosin networks during apical constriction. PLoS Genet. 19: e1010319. 17.","pubmedId":"36976799","doi":"10.1371/journal.pgen.1010319"},{"reference":"Smith MA, Blankman E, Gardel ML, Luettjohann L, Waterman CM, Beckerle MC. 2010. A zyxin-mediated mechanism for actin stress fiber maintenance and repair. Dev Cell. 19: 365-76. 13.","pubmedId":"20833360","doi":"10.1016/j.devcel.2010.08.008"},{"reference":"Smith MA, Hoffman LM, Beckerle MC. 2014. LIM proteins in actin cytoskeleton mechanoresponse. Trends Cell Biol. 24: 575-83. 11.","pubmedId":"24933506","doi":"10.1016/j.tcb.2014.04.009"},{"reference":"Sun X, Phua DYZ, Axiotakis L, Smith MA, Blankman E, Gong R, et al., Alushin GM. 2020. Mechanosensing through Direct Binding of Tensed F-Actin by LIM Domains. Dev Cell. 55: 468-482 e7. 10.","pubmedId":"33058779","doi":"10.1016/j.devcel.2020.09.022"},{"reference":"Wang H, Park H, Liu J, Sternberg PW. 2018. An Efficient Genome Editing Strategy To Generate Putative Null Mutants in Caenorhabditis elegans Using CRISPR/Cas9. G3 (Bethesda). 8: 3607-3616. 19.","pubmedId":"30224336","doi":"10.1534/g3.118.200662"}],"title":"C. elegans LIM-8 localizes to aligned actin filaments in the embryonic epidermis but is not important during embryonic elongation
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Daniela Raciti"},"openAcknowledgement":false,"submitted":null}]},{"id":"0fa04cbb-4ac2-4ba1-a3a6-bb3d4daffa0c","decision":"revise","abstract":"During embryonic elongation in C. elegans multiple actin-binding proteins cooperate to regulate cell shape changes. We investigated whether LIM-8, a LIM domain-containing protein expressed in the elongating epidermis, contributes to this process. We endogenously tagged all isoforms of LIM-8; LIM-8::mNeonGreen localizes to aligned actin filaments in the embryonic epidermis during elongation, in addition to several adult tissues. LIM-8 is not essential for embryonic elongation and we were unable to identify functional interactions with hmp-1/a-catenin, sma-1/bH-spectrin, or other LIM domain containing proteins, suggesting that, despite its striking localization, LIM-8 does not make major contributions to actin regulation during embryonic elongation.
","acknowledgements":"Some strains were provided by the C. elegans Genetics Center, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
","authors":[{"affiliations":["UW-Madison"],"departments":["Cellular and Molecular Biology Program"],"credit":["conceptualization","formalAnalysis","investigation","methodology","validation","visualization","writing_originalDraft","writing_reviewEditing"],"email":"amarkle@wisc.edu","firstName":"Adelle","lastName":"Markle","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0005-0114-1782"},{"affiliations":["UW–Madison, Madison, WI, United States","UW–Madison, Madison, WI, United States"],"departments":["Biology","Cellular and Molecular Biology Program"],"credit":["conceptualization","formalAnalysis","fundingAcquisition","supervision","writing_reviewEditing"],"email":"jdhardin@wisc.edu","firstName":"Jeff","lastName":"Hardin","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-7399-6580"}],"awards":[{"awardId":"R35 GM145312","funderName":"National Institutes of Health (United States)","awardRecipient":"J. Hardin"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"FASTA files for the lim-8 final exon and knock-in sequences
","doi":null,"resourceType":"Dataset","name":"lim-8 last exon and knock in.fa","url":"https://portal.micropublication.org/uploads/1349fe9a67dd0165913e70c0e3c582ae.fa"},{"description":"FASTA files for new alp-1 RNAi construct
","doi":null,"resourceType":"Dataset","name":"new alp-1 RNAi construct.fa","url":"https://portal.micropublication.org/uploads/7c0f882b454916728944e1a89be4717e.fa"}],"funding":"","image":{"url":"https://portal.micropublication.org/uploads/47d065df13b5a33e945c350af7274b77.jpg"},"imageCaption":"A: Schematic of the lim-8 locus showing tagging strategy. Black boxes: coding exons. White boxes: UTR. Green boxes: FLAG, linker, and mNeonGreen-encoding exons. B-D: Embryos showing LIM-8::mNG expression at comma stage, two-fold, and late elongation. Images are maximum-intensity Z projections of 0.9 µm stacks. Scale bars = 10 µm. E: LIM-8::mNG colocalizes with LifeAct on circumferential filament bundles (CFBs) and along adherens junctions. Images are maximum-intensity Z projections of 0.9 µm stacks. White arrow: CFBs. White arrowhead: seam cell actin mesh. Black arrow: Adherens junction at a seam-non-seam boundary. Scale bar = 10 µm. F: LIM-8::mNG expression in the pharynx of an adult worm. Image is a maximum intensity Z projection of a 4.5 µm stack. White arrow: anterior bulb. White arrowhead: terminal bulb. Scale bar = 10 µm. G: LIM-8::mNG expression in the uterus of an adult worm merged with the corresponding DIC image. Scale bar = 20 µm. H: LIM-8::mNG expression in the rectal and posterior phasmid systems. Image is a maximum-intensity Z projection of a 9.5 µm stack. Due to the strength of the signal in the phasmid cells, this image was acquired at lower laser power than other images. White arrows: phasmid system. White arrowhead: rectal system. Scale bar = 10 µm. I: LIM-8::mNG expression in an occupied spermatheca. LIM-8 signal is not specific to actin bundles but does accumulate at cell-cell junctions in a more apical view (I'). Images are maximum-intensity Z projections of 1.5 µm stacks, with I' immediately apical to I. Scale bar = 10 µm. J: Lethality counts do not reveal any role for lim-8 in sensitized backgrounds. N represents the number of adult worms whose progeny was scored. ns, not significant (P > 0.05 in all cases).
","imageTitle":"LIM-8 is expressed in the epidermis during embryonic elongation as well as other adult tissues but does not make major contributions to embryonic elongation
","methods":"Strains
Hermaphrodite C. elegans were maintained at 20°C on nematode growth media (NGM) plates seeded with E. coli strain OP50 according to standard protocols. N2 Bristol was used as wildtype (Brenner, 1974).
Strains used:
N2: Wildtype, from C. elegans Genetics Center (CGC)
SU1073: zyx-1(cp419)II; tes-1(ok1036)IV from (Lynch et al., 2022)
PS9957: lim-8(sy1989) III from CGC (Wang et al., 2018)
SU1164: zyx-1(cp419) II; lim-8(sy1989) III; tes-1(ok1036) IV from this study
SU1168: lim-8(jc116[lim-8::FLAG::mNG+LoxP]) III 2xOC from this study
AZ30: sma-1(ru18) V from (Praitis et al., 2005)
SU1170: sma-1(ru18) V 4xOC from this study
SU1349: curIs11[plin-26::LifeAct::mCherry]; lim-8(jc116[lim-8::FLAG::mNG+LoxP]) III from this study. Note: the LifeAct integrant likely resides on LG X
hmp-1(fe4) V isolated from balanced line SU287 (hmp-1(fe4)/lon-3(e2175) V) (Lynch et al., 2012) on 6/20/2026
Confocal imaging
Embryos were mounted on 10% agar pads in M9 buffer according to standard protocols (Hardin et al., 2022). Embryos were surrounded with OP50 during mounting to paralyze them by hypoxia (Gally et al., 2009). Confocal images were collected at 20°C using a Dragonfly 500 spinning disc confocal microscope (Oxford Instruments) mounted on a Leica DMi8 microscope equipped with a 63X glycerol immersion objective and a Zyla camera and controlled by Fusion software (Oxford Instruments) using a slice spacing of 0.3 μm. Adult worms were mounted on 9% agarose pads in M9 buffer and imaged using the same settings as for embryos, except that Z stacks were collected with a step size of 0.5 μm.
CRISPR/Cas9 genome editing
To endogenously tag the C. elegans lim-8 locus with FLAG and mNeonGreen, we used the self-excising selection cassette (SEC) method previously described by Dickinson et al. (Dickinson et al., 2015). The guide sequence was cloned into pJW1219 using blunt-end cloning to produce pARM1. A repair template for the C terminus of LIM-8 was generated using SapTrap cloning (Dickinson et al., 2018; Schwartz and Jorgensen, 2016) to assemble homology arms, linker, mNG, and self-excising cassette into the pMLS257 backbone to form pARM2. The forward primer for the 3' homology arm introduced a mutation to remove the PAM. pARM1 at 50 ng/µl and pARM2 at 15 ng/µl were injected into the gonads of adult C. elegans hermaphrodites along with coinjection markers pGH8 (4ng/µl), pCFJ90 (2ng/µl), and pCFJ104 (4ng/µl). Hygromycin selection for worms with the SEC, screening, and removal of SEC by heat shock were performed as described in Dickinson et al. (Dickinson et al., 2015). Oligonucleotides used for cloning, genotyping, and sequencing are as follows (Sequence complementary to C. elegans DNA indicated in ALL CAPS, mutation introduced to remove PAM in red):
pJW1219 F with guide sequence added: ACATTCTAGAAAGAACTTCTgtttaagagctatgctggaaacag
pJW1219 R: caagacatctcgcaataggag
pJW1219 gRNA sequencing: gtgtgaaataccgcacaga
5' homology arm forward: ggctgctcttcgtggGCTACGTCATCGTCGTTGAGG
5' homology arm reverse: gggtgctcttcgcgcGACTTTGCTCAATTGCACACGATC
3' homology arm forward: ggctgctcttcgggtTAAGCTCTAAATAGTCCAGTCgCAGAAGTTC
3' homology arm reverse: gggtgctcttcgtacGCGGTCGGTTTTGAGTTTCC
SEC sequencing reverse for repair template: ttaatgtgagttagctcactcattagg
lim-8 knock in genotyping forward: GCTACGTCATCGTCGTTGAGG
lim-8 knock in genotyping reverse: CCACCTCCGCCGTATAATGC
lim-8 knock in sequencing: GGACGTGGTGCTGCAATGAT
Cloning
Approximately 0.5kb of the alp-1 coding region, common to all known isoforms and not sharing sequences with any other known gene, was amplified from N2 worm cDNA and cloned into the L4440 feeding RNAi vector using standard restriction cloning techniques to produce pARM4. Oligonucleotides used for cloning are as follows (Sequence complementary to C. elegans DNA indicated in ALL CAPS):
Forward primer for alp-1 cDNA with HindIII restriction site added: gcaagcttGGAGTGATGGCTCGTGCAG
Reverse primer for alp-1 cDNA with NheI restriction site added: gcgctagcCATTTGAAGGTGGTGGATTTGACGG
RNAi and plate counts
dsRNA was generated using T7 transcription kit using a lim-8 cDNA clone (courtesy of G. Benian) and pARM4 as templates. dsRNA was injected into L4/young adult worms at 2 µg/µl for alp-1 and 3 µg/µl for lim-8. Uninjected young adults and injected worms 20-24 hours post-injection were singled and allowed to lay for 20-24 hours. For hmp-1(fe4) and sma-1(ru18) lines this time was extended up to 28 hours due to gonad defects in hmp-1(fe4) and body morphology defects in both lines, which slowed egg laying. Adult worms were then removed; 20-24 hours after removal of the adult worm, the number of hatchlings and dead eggs on each plate was counted. Each experiment was performed twice.
Statistical analysis
Percent lethality data, with the offspring of each worm considered as a biological replicate, were compared using Welch's t test (where two groups were to be compared), and one-way Brown-Forsythe and Welch ANOVA (where three groups were to be compared) to assess the significance of differences between groups using GraphPad Prism software. N values for each group are included in Figure 1J.
Results and Discussion
Embryonic elongation of the C. elegans embryo is a powerful system for exploring the actin regulatory mechanisms that facilitate coordinated cell shape change. During embryonic elongation, the C. elegans embryo increases in length four-fold while reducing its diameter three-fold; this dramatic morphological change is accomplished by actomyosin-mediated epidermal cell shape changes, without any contribution from cell division or migration (reviewed in (Labouesse et al., 2026)). Proteins containing LIM domains are known to bind actin filaments under tension and have been implicated in repair of strained actin bundles (Smith et al., 2010; Smith et al., 2014; Sun et al., 2020). In C. elegans, LIM domain proteins have been investigated in striated body wall muscle (Lecroisey et al., 2013; Lecroisey et al., 2008; Qadota et al., 2007), synapses (Luo et al., 2014), and gastrulation (Slabodnick et al., 2023). We recently showed that two LIM domain containing repeat (LCR) proteins, ZYX-1 and TES-1, play roles at cell-cell junctions in elongating C. elegans embryos (Lynch et al., 2022), and so we sought to examine other C. elegansLIM domain containing proteins in the context of embryonic elongation. One such protein that has not been characterized during elongation is LIM-8, despite available single cell RNAseq data indicating it is expressed in the epidermis during elongation (Packer et al., 2019).
We endogenously tagged all known LIM-8 isoforms with mNeonGreen using CRISPR/Cas9 genome editing technology (Fig. 1A). LIM-8::mNG signal is first visible during early elongation, though it remains dim until the two-fold stage (Fig. 1B, 1C). During the second, muscle contraction-dependent phase of elongation, LIM-8::mNG signal is bright and localized to circumferential F-actin filament bundles (CFBs;(Priess and Hirsh, 1986)) in dorsal and ventral epidermal cells, the mesh-like actin network in seam epidermal cells (Costa et al., 1997; Gally et al., 2009), and proximal actin networks associated with adherens junctions ((Costa et al., 1998); Fig. 1D, 1E). During this phase of elongation, the LIM-8::mNG knock-in may have utility as an endogenously encoded reporter of F-actin organization, particularly as an alternative to LifeAct (Havrylenko et al., 2015) or the F-actin-binding fragment of the spectraplakin VAB-10 (Gally et al., 2009) for assessing the organization and alignment of CFBs in the embryonic epidermis.
In adult worms, LIM-8::mNG signal is visible in the pharynx, as expected from previously reported promotor::GFP fusion experiments ((Qadota et al., 2007); Fig. 1F). LIM-8::mNG is also expressed in the uterus, the rectal and phasmid systems, and the spermatheca (Fig. 1G, 1H, 1I). Unlike in the epidermis of elongating embryos, LIM-8 in the spermatheca does not accumulate on aligned actin filaments but instead has a speckled appearance and localizes basal to adherens junctions (Fig. 1I). This localization pattern was observed in both occupied and unoccupied spermathecae, suggesting that the tension state of the actin filaments in the spermatheca does not determine whether LIM-8 is recruited. In the spermatheca, LIM-8 also localizes to apical adherens junctions (Fig. 1I'). While LIM-8 has been shown by antibody staining to localize to the M line in adult body wall muscle (Qadota et al., 2007), we were unable to detect LIM-8::mNG in body wall muscle under our imaging conditions.
While lim-8 loss of function alone is not associated with overt phenotypes (Qadota et al., 2007), the strong actin localization of LIM-8 during elongation, combined with previously identified roles for LIM-domain containing proteins TES-1 and ZYX-1 using sensitized backgrounds (Lynch et al., 2022), led us to consider whether LIM-8 might be functionally redundant with other actin-binding proteins during elongation. Since both tes-1 and zyx-1 loss of function enhance the lethality of the hypomorphic α-catenin mutant hmp-1(fe4), we tested whether lim-8 might also be a hmp-1(fe4) enhancer. We observed no significant difference in embryonic lethality between offspring of hmp-1(fe4) mothers and hmp-1(fe4) mothers injected with lim-8 dsRNA (Fig. 1J). We also tested whether a STOP-IN null allele (Wang et al., 2018) for lim-8 would synergize with mutant alleles for other genes involved in elongation. The βH-spectrin sma-1 is essential for efficient elongation, and loss of sma-1 function, while not lethal, results in hatchlings that reach just over two-fold, rather than complete four-fold elongation (McKeown et al., 1998; Praitis et al., 2005). A lim-8;sma-1 double null line did not show any embryonic lethality, and no obvious additional morphological defects were observed on plates (Fig. 1J). To ask whether loss of LIM-8 might synergize with other LIM domain-containing proteins during elongation, we crossed the lim-8 null allele with tes-1 and zyx-1 null alleles. Since the resulting line likewise did not display embryonic lethality, we considered whether another LIM domain containing protein, ALP-1, might be supporting elongation in this background through functional redundancy (Fig. 1J). As the existing Ahringer library clone targeted to alp-1covers sequence unique to the d isoform and the clone used to knock down alp-1 expression in previous studies is targeted to T11B7.5, a gene found in an intron of alp-1, and therefore is not specific to alp-1 (McKeown et al., 2006), we generated a new RNAi clone targeting all known isoforms of alp-1 but only sequences specific to that gene. Injection of alp-1 dsRNA generated using this clone into the lim-8(su1989); tes-1(ok1036); zyx-1(cp419) line did not result in any embryonic lethality (Fig. 1J).
From these results, we conclude that LIM-8 does not make major contributions to C. elegans embryonic elongation. Any role it may play is dispensable for proper elongation; it is possible that additional proteins act redundantly with LIM-8 that we did not address in this study. Nevertheless, the differences in LIM-8 localization between the epidermis and the spermatheca suggest that LIM-8 may be a useful probe for interrogating the mechanisms regulating the association of LIM domain-containing proteins with actin filaments, which may be of biological relevance in other contexts.
","references":[{"reference":"Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics. 77: 71-94. 6.","pubmedId":"4366476","doi":""},{"reference":"Costa M, Draper BW, Priess JR. 1997. The role of actin filaments in patterning the Caenorhabditis elegans cuticle. Dev Biol. 184: 373-84. 30.","pubmedId":"9133443","doi":"10.1006/dbio.1997.8530"},{"reference":"Costa M, Raich W, Agbunag C, Leung B, Hardin J, Priess JR. 1998. A putative catenin-cadherin system mediates morphogenesis of the Caenorhabditis elegans embryo. J Cell Biol. 141: 297-308. 29.","pubmedId":"9531567","doi":"10.1083/jcb.141.1.297"},{"reference":"Dickinson D, Slabodnick M, Chen A, Goldstein B. 2018. SapTrap assembly of repair templates for Cas9-triggered homologous recombination with a self-excising cassette. MicroPubl Biol. 2018 27.","pubmedId":"32550377","doi":"10.17912/W2KT0N"},{"reference":"Dickinson DJ, Pani AM, Heppert JK, Higgins CD, Goldstein B. 2015. Streamlined Genome Engineering with a Self-Excising Drug Selection Cassette. Genetics. 200: 1035-49. 26.","pubmedId":"26044593","doi":"10.1534/genetics.115.178335"},{"reference":"Gally C, Wissler F, Zahreddine H, Quintin S, Landmann F, Labouesse M. 2009. Myosin II regulation during C. elegans embryonic elongation: LET-502/ROCK, MRCK-1 and PAK-1, three kinases with different roles. Development. 136: 3109-19. 25.","pubmedId":"19675126","doi":"10.1242/dev.039412"},{"reference":"Hardin J, Serre J, King R, Walck Shannon E, Reiner D. 2022. Imaging Epidermal Cell Rearrangement in the C. elegans Embryo. Methods Mol Biol. 2438: 345-376. 24.","pubmedId":"35147953","doi":"10.1007/978-1-0716-2035-9_22"},{"reference":"Havrylenko S, Noguera P, Abou Ghali M, Manzi J, Faqir F, Lamora A, et al., Plastino J. 2015. WAVE binds Ena/VASP for enhanced Arp2/3 complex-based actin assembly. Mol Biol Cell. 26: 55-65. 32.","pubmedId":"25355952","doi":"10.1091/mbc.E14-07-1200"},{"reference":"Labouesse M, Ferraro T, Llense F, Heier J, Tesone Z, Hardin J. 2026. Cellular Processes and Forces Shaping the Embryo: Lessons from C. elegans. Cells. 15 7.","pubmedId":"41972734","doi":"10.3390/cells15070645"},{"reference":"Lecroisey C, Brouilly N, Qadota H, Mariol MC, Rochette NC, Martin E, et al., Gieseler K. 2013. ZYX-1, the unique zyxin protein of Caenorhabditis elegans, is involved in dystrophin-dependent muscle degeneration. Mol Biol Cell. 24: 1232-49. 1.","pubmedId":"23427270","doi":"10.1091/mbc.E12-09-0679"},{"reference":"Lecroisey C, Martin E, Mariol MC, Granger L, Schwab Y, Labouesse M, Segalat L, Gieseler K. 2008. DYC-1, a protein functionally linked to dystrophin in Caenorhabditis elegans is associated with the dense body, where it interacts with the muscle LIM domain protein ZYX-1. Mol Biol Cell. 19: 785-96. 2.","pubmedId":"18094057","doi":"10.1091/mbc.E07-05-0497"},{"reference":"Luo S, Schaefer AM, Dour S, Nonet ML. 2014. The conserved LIM domain-containing focal adhesion protein ZYX-1 regulates synapse maintenance in Caenorhabditis elegans. Development. 141: 3922-33. 14.","pubmedId":"25252943","doi":"10.1242/dev.108217"},{"reference":"Lynch AM, Grana T, Cox Paulson E, Couthier A, Cameron M, Chin Sang I, Pettitt J, Hardin J. 2012. A Genome-wide Functional Screen Shows MAGI-1 Is an L1CAM-Dependent Stabilizer of Apical Junctions in C. elegans. Curr Biol. 22: 1891-9. 4.","pubmedId":"22981773","doi":"10.1016/j.cub.2012.08.024"},{"reference":"Lynch AM, Zhu Y, Lucas BG, Winkelman JD, Bai K, Martin SCT, et al., Hardin J. 2022. TES-1/Tes and ZYX-1/Zyxin protect junctional actin networks under tension during epidermal morphogenesis in the C. elegans embryo. Curr Biol. 32: 5189-5199 e6. 18.","pubmedId":"36384139","doi":"10.1016/j.cub.2022.10.045"},{"reference":"Mc Keown C, Praitis V, Austin J. 1998. sma-1 encodes a betaH-spectrin homolog required for Caenorhabditis elegans morphogenesis. Development. 125: 2087-98. 20.","pubmedId":"9570773","doi":""},{"reference":"Mc Keown CR, Han HF, Beckerle MC. 2006. Molecular characterization of the Caenorhabditis elegans ALP/Enigma gene alp-1. Dev Dyn. 235: 530-8. 22.","pubmedId":"16278882","doi":"10.1002/dvdy.20633"},{"reference":"Packer JS, Zhu Q, Huynh C, Sivaramakrishnan P, Preston E, Dueck H, et al., Murray JI. 2019. A lineage-resolved molecular atlas of C. elegans embryogenesis at single-cell resolution. Science. 365 16.","pubmedId":"31488706","doi":"10.1126/science.aax1971"},{"reference":"Praitis V, Ciccone E, Austin J. 2005. SMA-1 spectrin has essential roles in epithelial cell sheet morphogenesis in C. elegans. Dev Biol. 283: 157-70. 21.","pubmedId":"15890334","doi":""},{"reference":"Priess JR, Hirsh DI. 1986. Caenorhabditis elegans morphogenesis: the role of the cytoskeleton in elongation of the embryo. Dev Biol. 117: 156-73. 5.","pubmedId":"3743895","doi":""},{"reference":"Qadota H, Mercer KB, Miller RK, Kaibuchi K, Benian GM. 2007. Two LIM domain proteins and UNC-96 link UNC-97/pinch to myosin thick filaments in Caenorhabditis elegans muscle. Mol Biol Cell. 18: 4317-26. 8.","pubmedId":"17761533","doi":"10.1091/mbc.e07-03-0278"},{"reference":"Schwartz ML, Jorgensen EM. 2016. SapTrap, a Toolkit for High-Throughput CRISPR/Cas9 Gene Modification in Caenorhabditis elegans. Genetics. 202: 1277-88. 28.","pubmedId":"26837755","doi":"10.1534/genetics.115.184275"},{"reference":"Slabodnick MM, Tintori SC, Prakash M, Zhang P, Higgins CD, Chen AH, et al., Goldstein B. 2023. Zyxin contributes to coupling between cell junctions and contractile actomyosin networks during apical constriction. PLoS Genet. 19: e1010319. 17.","pubmedId":"36976799","doi":"10.1371/journal.pgen.1010319"},{"reference":"Smith MA, Blankman E, Gardel ML, Luettjohann L, Waterman CM, Beckerle MC. 2010. A zyxin-mediated mechanism for actin stress fiber maintenance and repair. Dev Cell. 19: 365-76. 13.","pubmedId":"20833360","doi":"10.1016/j.devcel.2010.08.008"},{"reference":"Smith MA, Hoffman LM, Beckerle MC. 2014. LIM proteins in actin cytoskeleton mechanoresponse. Trends Cell Biol. 24: 575-83. 11.","pubmedId":"24933506","doi":"10.1016/j.tcb.2014.04.009"},{"reference":"Sun X, Phua DYZ, Axiotakis L, Smith MA, Blankman E, Gong R, et al., Alushin GM. 2020. Mechanosensing through Direct Binding of Tensed F-Actin by LIM Domains. Dev Cell. 55: 468-482 e7. 10.","pubmedId":"33058779","doi":"10.1016/j.devcel.2020.09.022"},{"reference":"Wang H, Park H, Liu J, Sternberg PW. 2018. An Efficient Genome Editing Strategy To Generate Putative Null Mutants in Caenorhabditis elegans Using CRISPR/Cas9. G3 (Bethesda). 8: 3607-3616. 19.","pubmedId":"30224336","doi":"10.1534/g3.118.200662"}],"title":"C. elegans LIM-8 localizes to aligned actin filaments in the embryonic epidermis but is not important during embryonic elongation
","reviews":[{"reviewer":{"displayName":"Hirsohi Qadota"},"openAcknowledgement":true,"status":{"submitted":true}}],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Daniela Raciti"},"openAcknowledgement":false,"submitted":null}]},{"id":"91cbe9a6-f3cb-4096-8943-2f097702b9eb","decision":"revise","abstract":"During embryonic elongation in C. elegans multiple actin-binding proteins cooperate to regulate cell shape changes. We investigated whether LIM-8, a LIM domain-containing protein expressed in the elongating epidermis, contributes to this process. We endogenously tagged all isoforms of LIM-8; LIM-8::mNeonGreen localizes to aligned actin filaments in the embryonic epidermis during elongation, in addition to several adult tissues. LIM-8 is not essential for embryonic elongation and we were unable to identify functional interactions with hmp-1/a-catenin, sma-1/bH-spectrin, or other LIM domain containing proteins, suggesting that, despite its striking localization, LIM-8 does not make major contributions to actin regulation during embryonic elongation.
","acknowledgements":"Some strains were provided by the C. elegans Genetics Center, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
","authors":[{"affiliations":["UW-Madison"],"departments":["Cellular and Molecular Biology Program"],"credit":["conceptualization","formalAnalysis","investigation","methodology","validation","visualization","writing_originalDraft","writing_reviewEditing"],"email":"amarkle@wisc.edu","firstName":"Adelle","lastName":"Markle","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0005-0114-1782"},{"affiliations":["UW–Madison, Madison, WI, United States","UW–Madison, Madison, WI, United States"],"departments":["Biology","Cellular and Molecular Biology Program"],"credit":["conceptualization","formalAnalysis","fundingAcquisition","supervision","writing_reviewEditing"],"email":"jdhardin@wisc.edu","firstName":"Jeff","lastName":"Hardin","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-7399-6580"}],"awards":[{"awardId":"R35 GM145312","funderName":"National Institutes of Health (United States)","awardRecipient":"J. Hardin"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"FASTA files for the lim-8 final exon and knock-in sequences
","doi":"10.22002/ffyv9-se005","resourceType":"Dataset","name":"lim-8 last exon and knock in.fa","url":"https://portal.micropublication.org/uploads/1349fe9a67dd0165913e70c0e3c582ae.fa"},{"description":"FASTA files for new alp-1 RNAi construct
","doi":"10.22002/qgptf-s6f23","resourceType":"Dataset","name":"new alp-1 RNAi construct.fa","url":"https://portal.micropublication.org/uploads/7c0f882b454916728944e1a89be4717e.fa"},{"description":"lim-8 scRNAseq data (extracted using VisCello from Packer et al, 2019)
","doi":"10.22002/x8xs2-zzn85","resourceType":"Dataset","name":"Table_S1.xlsx","url":"https://portal.micropublication.org/uploads/932d454a01815d747b20526d24622c36.xlsx"}],"funding":"","image":{"url":"https://portal.micropublication.org/uploads/47d065df13b5a33e945c350af7274b77.jpg"},"imageCaption":"A: Schematic of the lim-8 locus showing tagging strategy. Black boxes: coding exons. White boxes: UTR. Green boxes: FLAG, linker, and mNeonGreen-encoding exons. B-D: Embryos showing LIM-8::mNG expression at comma stage, two-fold, and late elongation. Images are maximum-intensity Z projections of 0.9 µm stacks. Scale bars = 10 µm. E: LIM-8::mNG colocalizes with LifeAct on circumferential filament bundles (CFBs) and along adherens junctions. Images are maximum-intensity Z projections of 0.9 µm stacks. White arrow: CFBs. White arrowhead: seam cell actin mesh. Black arrow: Adherens junction at a seam-non-seam boundary. Scale bar = 10 µm. F: LIM-8::mNG expression in the pharynx of an adult worm. Image is a maximum intensity Z projection of a 4.5 µm stack. White arrow: anterior bulb. White arrowhead: terminal bulb. Scale bar = 10 µm. G: LIM-8::mNG expression in the uterus of an adult worm merged with the corresponding DIC image. Scale bar = 20 µm. H: LIM-8::mNG expression in the rectal and posterior phasmid systems. Image is a maximum-intensity Z projection of a 9.5 µm stack. Due to the strength of the signal in the phasmid cells, this image was acquired at lower laser power than other images. White arrows: phasmid system. White arrowhead: rectal system. Scale bar = 10 µm. I: LIM-8::mNG expression in an occupied spermatheca. LIM-8 signal is not specific to actin bundles but does accumulate at cell-cell junctions in a more apical view (I'). Images are maximum-intensity Z projections of 1.5 µm stacks, with I' immediately apical to I. Scale bar = 10 µm. J: Lethality counts do not reveal any role for lim-8 in sensitized backgrounds. N represents the number of adult worms whose progeny was scored. ns, not significant (P > 0.05 in all cases).
","imageTitle":"LIM-8 is expressed in the epidermis during embryonic elongation as well as other adult tissues but does not make major contributions to embryonic elongation
","methods":"Strains
Hermaphrodite C. elegans were maintained at 20°C on nematode growth media (NGM) plates seeded with E. coli strain OP50 according to standard protocols. N2 Bristol was used as wildtype (Brenner, 1974).
Strains used:
N2: Wildtype, from C. elegans Genetics Center (CGC)
SU1073: zyx-1(cp419)II; tes-1(ok1036)IV from (Lynch et al., 2022)
PS9957: lim-8(sy1989) III from CGC (Wang et al., 2018)
SU1164: zyx-1(cp419) II; lim-8(sy1989) III; tes-1(ok1036) IV from this study
SU1168: lim-8(jc116[lim-8::FLAG::mNG+LoxP]) III 2xOC from this study
AZ30: sma-1(ru18) V from (Praitis et al., 2005)
SU1170: sma-1(ru18) V 4xOC from this study
SU1349: curIs11[plin-26::LifeAct::mCherry]; lim-8(jc116[lim-8::FLAG::mNG+LoxP]) III from this study. Note: the LifeAct integrant likely resides on LG X
hmp-1(fe4) V isolated from balanced line SU287 (hmp-1(fe4)/lon-3(e2175) V) (Lynch et al., 2012) on 6/20/2026
Confocal imaging
Embryos were mounted on 10% agar pads in M9 buffer according to standard protocols (Hardin et al., 2022). Embryos were surrounded with OP50 during mounting to paralyze them by hypoxia (Gally et al., 2009). Confocal images were collected at 20°C using a Dragonfly 500 spinning disc confocal microscope (Oxford Instruments) mounted on a Leica DMi8 microscope equipped with a 63X glycerol immersion objective and a Zyla camera and controlled by Fusion software (Oxford Instruments) using a slice spacing of 0.3 μm. Adult worms were mounted on 9% agarose pads in M9 buffer and imaged using the same settings as for embryos, except that Z stacks were collected with a step size of 0.5 μm.
CRISPR/Cas9 genome editing
To endogenously tag the C. elegans lim-8 locus with FLAG and mNeonGreen, we used the self-excising selection cassette (SEC) method previously described by Dickinson et al. (Dickinson et al., 2015). The guide sequence was cloned into pJW1219 using blunt-end cloning to produce pARM1. A repair template for the C terminus of LIM-8 was generated using SapTrap cloning (Dickinson et al., 2018; Schwartz and Jorgensen, 2016) to assemble homology arms, linker, mNG, and self-excising cassette into the pMLS257 backbone to form pARM2. The forward primer for the 3' homology arm introduced a mutation to remove the PAM. pARM1 at 50 ng/µl and pARM2 at 15 ng/µl were injected into the gonads of adult C. elegans hermaphrodites along with coinjection markers pGH8 (4ng/µl), pCFJ90 (2ng/µl), and pCFJ104 (4ng/µl). Hygromycin selection for worms with the SEC, screening, and removal of SEC by heat shock were performed as described in Dickinson et al. (Dickinson et al., 2015). Oligonucleotides used for cloning, genotyping, and sequencing are as follows (Sequence complementary to C. elegans DNA indicated in ALL CAPS, mutation introduced to remove PAM in red):
pJW1219 F with guide sequence added: ACATTCTAGAAAGAACTTCTgtttaagagctatgctggaaacag
pJW1219 R: caagacatctcgcaataggag
pJW1219 gRNA sequencing: gtgtgaaataccgcacaga
5' homology arm forward: ggctgctcttcgtggGCTACGTCATCGTCGTTGAGG
5' homology arm reverse: gggtgctcttcgcgcGACTTTGCTCAATTGCACACGATC
3' homology arm forward: ggctgctcttcgggtTAAGCTCTAAATAGTCCAGTCgCAGAAGTTC
3' homology arm reverse: gggtgctcttcgtacGCGGTCGGTTTTGAGTTTCC
SEC sequencing reverse for repair template: ttaatgtgagttagctcactcattagg
lim-8 knock in genotyping forward: GCTACGTCATCGTCGTTGAGG
lim-8 knock in genotyping reverse: CCACCTCCGCCGTATAATGC
lim-8 knock in sequencing: GGACGTGGTGCTGCAATGAT
Cloning
Approximately 0.5kb of the alp-1 coding region, common to all known isoforms and not sharing sequences with any other known gene, was amplified from N2 worm cDNA and cloned into the L4440 feeding RNAi vector using standard restriction cloning techniques to produce pARM4. Oligonucleotides used for cloning are as follows (Sequence complementary to C. elegans DNA indicated in ALL CAPS):
Forward primer for alp-1 cDNA with HindIII restriction site added: gcaagcttGGAGTGATGGCTCGTGCAG
Reverse primer for alp-1 cDNA with NheI restriction site added: gcgctagcCATTTGAAGGTGGTGGATTTGACGG
RNAi and plate counts
dsRNA was generated using T7 transcription kit using a lim-8 cDNA clone (courtesy of G. Benian) and pARM4 as templates. dsRNA was injected into L4/young adult worms at 2 µg/µl for alp-1 and 3 µg/µl for lim-8. Uninjected young adults and injected worms 20-24 hours post-injection were singled and allowed to lay for 20-24 hours. For hmp-1(fe4) and sma-1(ru18) lines this time was extended up to 28 hours due to gonad defects in hmp-1(fe4) and body morphology defects in both lines, which slowed egg laying. Adult worms were then removed; 20-24 hours after removal of the adult worm, the number of hatchlings and dead eggs on each plate was counted. Each experiment was performed twice.
Statistical analysis
Percent lethality data, with the offspring of each worm considered as a biological replicate, were compared using Welch's t test (where two groups were to be compared), and one-way Brown-Forsythe and Welch ANOVA (where three groups were to be compared) to assess the significance of differences between groups using GraphPad Prism software. N values for each group are included in Figure 1J.
scRNAseq analysis
Transcript levels for lim-8 in epidermal cells were obtained using the summarized expression tool available in the online VisCello viewer (https://cello.shinyapps.io/celegans_explorer/) for the C. elegans embryo scRNA seq atlas developed by Packer et al. (2019).
Results and Discussion
Embryonic elongation of the C. elegans embryo is a powerful system for exploring the actin regulatory mechanisms that facilitate coordinated cell shape change. During embryonic elongation, the C. elegans embryo increases in length four-fold while reducing its diameter three-fold; this dramatic morphological change is accomplished by actomyosin-mediated epidermal cell shape changes, without any contribution from cell division or migration (reviewed in (Labouesse et al., 2026)). Proteins containing LIM domains are known to bind actin filaments under tension and have been implicated in repair of strained actin bundles (Smith et al., 2010; Smith et al., 2014; Sun et al., 2020). In C. elegans, LIM domain proteins have been investigated in striated body wall muscle (Lecroisey et al., 2013; Lecroisey et al., 2008; Qadota et al., 2007), synapses (Luo et al., 2014), and gastrulation (Slabodnick et al., 2023). We recently showed that two LIM domain containing repeat (LCR) proteins, ZYX-1 and TES-1, play roles at cell-cell junctions in elongating C. elegans embryos (Lynch et al., 2022), and so we sought to examine other C. elegansLIM domain containing proteins in the context of embryonic elongation. One such protein that has not been characterized during elongation is LIM-8, despite available single cell RNAseq data indicating it is expressed in the epidermis during elongation (Packer et al., 2019).
We endogenously tagged all known LIM-8 isoforms with mNeonGreen using CRISPR/Cas9 genome editing technology (Fig. 1A). LIM-8::mNG signal is first visible during early elongation, though it remains dim until the two-fold stage (Fig. 1B, 1C). During the second, muscle contraction-dependent phase of elongation, LIM-8::mNG signal is bright and localized to circumferential F-actin filament bundles (CFBs;(Priess and Hirsh, 1986)) in dorsal and ventral epidermal cells, the mesh-like actin network in seam epidermal cells (Costa et al., 1997; Gally et al., 2009), and proximal actin networks associated with adherens junctions ((Costa et al., 1998); Fig. 1D, 1E). These observations are consistent with scRNA seq data for lim-8 from a published dataset, which shows transcriptional expression of lim-8 in AB- and C-derived epidermis and seam lineages 390-510 min after the first cell division (Packer et al., 2019) (Table S1). However, it is unclear from these data and ours whether the change in expression results from uniform expression during this time window, from increasingly specific localization, or both. Future experiments will be required to adjudicate these possibilities. During the muscle contraction-dependent phase of elongation, the LIM-8::mNG knock-in may have utility as an endogenously encoded reporter of F-actin organization, particularly as an alternative to LifeAct (Havrylenko et al., 2015) or the F-actin-binding fragment of the spectraplakin VAB-10 (Gally et al., 2009) for assessing the organization and alignment of CFBs in the embryonic epidermis.
In adult worms, LIM-8::mNG signal is visible in the pharynx, as expected from previously reported promotor::GFP fusion experiments ((Qadota et al., 2007); Fig. 1F). LIM-8::mNG is also expressed in the uterus, the rectal and phasmid systems, and the spermatheca (Fig. 1G, 1H, 1I). Unlike in the epidermis of elongating embryos, LIM-8 in the spermatheca does not accumulate on aligned actin filaments but instead has a speckled appearance and localizes basal to adherens junctions (Fig. 1I). This localization pattern was observed in both occupied and unoccupied spermathecae, suggesting that the tension state of the actin filaments in the spermatheca does not determine whether LIM-8 is recruited. In the spermatheca, LIM-8 also localizes to apical adherens junctions (Fig. 1I'). While LIM-8 has been shown by antibody staining to localize to the M line in adult body wall muscle (Qadota et al., 2007), we were unable to detect LIM-8::mNG in body wall muscle under our imaging conditions.
While lim-8 loss of function alone is not associated with overt phenotypes (Qadota et al., 2007), the strong actin localization of LIM-8 during elongation, combined with previously identified roles for LIM-domain containing proteins TES-1 and ZYX-1 using sensitized backgrounds (Lynch et al., 2022), led us to consider whether LIM-8 might be functionally redundant with other actin-binding proteins during elongation. Since both tes-1 and zyx-1 loss of function enhance the lethality of the hypomorphic α-catenin mutant hmp-1(fe4), we tested whether lim-8 might also be a hmp-1(fe4) enhancer. We observed no significant difference in embryonic lethality between offspring of hmp-1(fe4) mothers and hmp-1(fe4) mothers injected with lim-8 dsRNA (Fig. 1J). We also tested whether a STOP-IN null allele (Wang et al., 2018) for lim-8 would synergize with mutant alleles for other genes involved in elongation. The βH-spectrin sma-1 is essential for efficient elongation, and loss of sma-1 function, while not lethal, results in hatchlings that reach just over two-fold, rather than complete four-fold elongation (McKeown et al., 1998; Praitis et al., 2005). A lim-8;sma-1 double null line did not show any embryonic lethality, and no obvious additional morphological defects were observed on plates (Fig. 1J). To ask whether loss of LIM-8 might synergize with other LIM domain-containing proteins during elongation, we crossed the lim-8 null allele with tes-1 and zyx-1 null alleles. Since the resulting line likewise did not display embryonic lethality, we considered whether another LIM domain containing protein, ALP-1, might be supporting elongation in this background through functional redundancy (Fig. 1J). As the existing Ahringer library clone targeted to alp-1covers sequence unique to the d isoform and the clone used to knock down alp-1 expression in previous studies is targeted to T11B7.5, a gene found in an intron of alp-1, and therefore is not specific to alp-1 (McKeown et al., 2006), we generated a new RNAi clone targeting all known isoforms of alp-1 but only sequences specific to that gene. Injection of alp-1 dsRNA generated using this clone into the lim-8(su1989); tes-1(ok1036); zyx-1(cp419) line did not result in any embryonic lethality (Fig. 1J).
From these results, we conclude that LIM-8 does not make major contributions to C. elegans embryonic elongation. Any role it may play is dispensable for proper elongation; it is possible that additional proteins act redundantly with LIM-8 that we did not address in this study. Nevertheless, the differences in LIM-8 localization between the epidermis and the spermatheca suggest that LIM-8 may be a useful probe for interrogating the mechanisms regulating the association of LIM domain-containing proteins with actin filaments, which may be of biological relevance in other contexts.
","references":[{"reference":"Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics. 77: 71-94. 6.","pubmedId":"4366476","doi":""},{"reference":"Costa M, Draper BW, Priess JR. 1997. The role of actin filaments in patterning the Caenorhabditis elegans cuticle. Dev Biol. 184: 373-84. 30.","pubmedId":"9133443","doi":"10.1006/dbio.1997.8530"},{"reference":"Costa M, Raich W, Agbunag C, Leung B, Hardin J, Priess JR. 1998. A putative catenin-cadherin system mediates morphogenesis of the Caenorhabditis elegans embryo. J Cell Biol. 141: 297-308. 29.","pubmedId":"9531567","doi":"10.1083/jcb.141.1.297"},{"reference":"Dickinson D, Slabodnick M, Chen A, Goldstein B. 2018. SapTrap assembly of repair templates for Cas9-triggered homologous recombination with a self-excising cassette. MicroPubl Biol. 2018 27.","pubmedId":"32550377","doi":"10.17912/W2KT0N"},{"reference":"Dickinson DJ, Pani AM, Heppert JK, Higgins CD, Goldstein B. 2015. Streamlined Genome Engineering with a Self-Excising Drug Selection Cassette. Genetics. 200: 1035-49. 26.","pubmedId":"26044593","doi":"10.1534/genetics.115.178335"},{"reference":"Gally C, Wissler F, Zahreddine H, Quintin S, Landmann F, Labouesse M. 2009. Myosin II regulation during C. elegans embryonic elongation: LET-502/ROCK, MRCK-1 and PAK-1, three kinases with different roles. Development. 136: 3109-19. 25.","pubmedId":"19675126","doi":"10.1242/dev.039412"},{"reference":"Hardin J, Serre J, King R, Walck Shannon E, Reiner D. 2022. Imaging Epidermal Cell Rearrangement in the C. elegans Embryo. Methods Mol Biol. 2438: 345-376. 24.","pubmedId":"35147953","doi":"10.1007/978-1-0716-2035-9_22"},{"reference":"Havrylenko S, Noguera P, Abou Ghali M, Manzi J, Faqir F, Lamora A, et al., Plastino J. 2015. WAVE binds Ena/VASP for enhanced Arp2/3 complex-based actin assembly. Mol Biol Cell. 26: 55-65. 32.","pubmedId":"25355952","doi":"10.1091/mbc.E14-07-1200"},{"reference":"Labouesse M, Ferraro T, Llense F, Heier J, Tesone Z, Hardin J. 2026. Cellular Processes and Forces Shaping the Embryo: Lessons from C. elegans. Cells. 15 7.","pubmedId":"41972734","doi":"10.3390/cells15070645"},{"reference":"Lecroisey C, Brouilly N, Qadota H, Mariol MC, Rochette NC, Martin E, et al., Gieseler K. 2013. ZYX-1, the unique zyxin protein of Caenorhabditis elegans, is involved in dystrophin-dependent muscle degeneration. Mol Biol Cell. 24: 1232-49. 1.","pubmedId":"23427270","doi":"10.1091/mbc.E12-09-0679"},{"reference":"Lecroisey C, Martin E, Mariol MC, Granger L, Schwab Y, Labouesse M, Segalat L, Gieseler K. 2008. DYC-1, a protein functionally linked to dystrophin in Caenorhabditis elegans is associated with the dense body, where it interacts with the muscle LIM domain protein ZYX-1. Mol Biol Cell. 19: 785-96. 2.","pubmedId":"18094057","doi":"10.1091/mbc.E07-05-0497"},{"reference":"Luo S, Schaefer AM, Dour S, Nonet ML. 2014. The conserved LIM domain-containing focal adhesion protein ZYX-1 regulates synapse maintenance in Caenorhabditis elegans. Development. 141: 3922-33. 14.","pubmedId":"25252943","doi":"10.1242/dev.108217"},{"reference":"Lynch AM, Grana T, Cox Paulson E, Couthier A, Cameron M, Chin Sang I, Pettitt J, Hardin J. 2012. A Genome-wide Functional Screen Shows MAGI-1 Is an L1CAM-Dependent Stabilizer of Apical Junctions in C. elegans. Curr Biol. 22: 1891-9. 4.","pubmedId":"22981773","doi":"10.1016/j.cub.2012.08.024"},{"reference":"Lynch AM, Zhu Y, Lucas BG, Winkelman JD, Bai K, Martin SCT, et al., Hardin J. 2022. TES-1/Tes and ZYX-1/Zyxin protect junctional actin networks under tension during epidermal morphogenesis in the C. elegans embryo. Curr Biol. 32: 5189-5199 e6. 18.","pubmedId":"36384139","doi":"10.1016/j.cub.2022.10.045"},{"reference":"Mc Keown C, Praitis V, Austin J. 1998. sma-1 encodes a betaH-spectrin homolog required for Caenorhabditis elegans morphogenesis. Development. 125: 2087-98. 20.","pubmedId":"9570773","doi":""},{"reference":"Mc Keown CR, Han HF, Beckerle MC. 2006. Molecular characterization of the Caenorhabditis elegans ALP/Enigma gene alp-1. Dev Dyn. 235: 530-8. 22.","pubmedId":"16278882","doi":"10.1002/dvdy.20633"},{"reference":"Packer JS, Zhu Q, Huynh C, Sivaramakrishnan P, Preston E, Dueck H, et al., Murray JI. 2019. A lineage-resolved molecular atlas of C. elegans embryogenesis at single-cell resolution. Science. 365 16.","pubmedId":"31488706","doi":"10.1126/science.aax1971"},{"reference":"Praitis V, Ciccone E, Austin J. 2005. SMA-1 spectrin has essential roles in epithelial cell sheet morphogenesis in C. elegans. Dev Biol. 283: 157-70. 21.","pubmedId":"15890334","doi":""},{"reference":"Priess JR, Hirsh DI. 1986. Caenorhabditis elegans morphogenesis: the role of the cytoskeleton in elongation of the embryo. Dev Biol. 117: 156-73. 5.","pubmedId":"3743895","doi":""},{"reference":"Qadota H, Mercer KB, Miller RK, Kaibuchi K, Benian GM. 2007. Two LIM domain proteins and UNC-96 link UNC-97/pinch to myosin thick filaments in Caenorhabditis elegans muscle. Mol Biol Cell. 18: 4317-26. 8.","pubmedId":"17761533","doi":"10.1091/mbc.e07-03-0278"},{"reference":"Schwartz ML, Jorgensen EM. 2016. SapTrap, a Toolkit for High-Throughput CRISPR/Cas9 Gene Modification in Caenorhabditis elegans. Genetics. 202: 1277-88. 28.","pubmedId":"26837755","doi":"10.1534/genetics.115.184275"},{"reference":"Slabodnick MM, Tintori SC, Prakash M, Zhang P, Higgins CD, Chen AH, et al., Goldstein B. 2023. Zyxin contributes to coupling between cell junctions and contractile actomyosin networks during apical constriction. PLoS Genet. 19: e1010319. 17.","pubmedId":"36976799","doi":"10.1371/journal.pgen.1010319"},{"reference":"Smith MA, Blankman E, Gardel ML, Luettjohann L, Waterman CM, Beckerle MC. 2010. A zyxin-mediated mechanism for actin stress fiber maintenance and repair. Dev Cell. 19: 365-76. 13.","pubmedId":"20833360","doi":"10.1016/j.devcel.2010.08.008"},{"reference":"Smith MA, Hoffman LM, Beckerle MC. 2014. LIM proteins in actin cytoskeleton mechanoresponse. Trends Cell Biol. 24: 575-83. 11.","pubmedId":"24933506","doi":"10.1016/j.tcb.2014.04.009"},{"reference":"Sun X, Phua DYZ, Axiotakis L, Smith MA, Blankman E, Gong R, et al., Alushin GM. 2020. Mechanosensing through Direct Binding of Tensed F-Actin by LIM Domains. Dev Cell. 55: 468-482 e7. 10.","pubmedId":"33058779","doi":"10.1016/j.devcel.2020.09.022"},{"reference":"Wang H, Park H, Liu J, Sternberg PW. 2018. An Efficient Genome Editing Strategy To Generate Putative Null Mutants in Caenorhabditis elegans Using CRISPR/Cas9. G3 (Bethesda). 8: 3607-3616. 19.","pubmedId":"30224336","doi":"10.1534/g3.118.200662"}],"title":"C. elegans LIM-8 localizes to aligned actin filaments in the embryonic epidermis but is not important during embryonic elongation
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Daniela Raciti"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Daniela Raciti"},"openAcknowledgement":true,"submitted":"1792502188273"}]},{"id":"08b71305-6881-452b-a067-44997d7dbb3b","decision":"accept","abstract":"During embryonic elongation in C. elegans multiple actin-binding proteins cooperate to regulate cell shape changes. We investigated whether LIM-8, a LIM domain-containing protein expressed in the elongating epidermis, contributes to this process. We endogenously tagged all isoforms of LIM-8; LIM-8::mNeonGreen localizes to aligned actin filaments in the embryonic epidermis during elongation, in addition to several adult tissues. LIM-8 is not essential for embryonic elongation and we were unable to identify functional interactions with hmp-1/a-catenin, sma-1/bH-spectrin, or other LIM domain containing proteins, suggesting that, despite its striking localization, LIM-8 does not make major contributions to actin regulation during embryonic elongation.
","acknowledgements":"Some strains were provided by the C. elegans Genetics Center, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
","authors":[{"affiliations":["UW-Madison"],"departments":["Cellular and Molecular Biology Program"],"credit":["conceptualization","formalAnalysis","investigation","methodology","validation","visualization","writing_originalDraft","writing_reviewEditing"],"email":"amarkle@wisc.edu","firstName":"Adelle","lastName":"Markle","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0005-0114-1782"},{"affiliations":["UW–Madison, Madison, WI, United States","UW–Madison, Madison, WI, United States"],"departments":["Biology","Cellular and Molecular Biology Program"],"credit":["conceptualization","formalAnalysis","fundingAcquisition","supervision","writing_reviewEditing"],"email":"jdhardin@wisc.edu","firstName":"Jeff","lastName":"Hardin","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-7399-6580"}],"awards":[{"awardId":"R35 GM145312","funderName":"National Institutes of Health (United States)","awardRecipient":"J. Hardin"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"FASTA files for the lim-8 final exon and knock-in sequences
","doi":"10.22002/ffyv9-se005","resourceType":"Dataset","name":"lim-8 last exon and knock in.fa","url":"https://portal.micropublication.org/uploads/1349fe9a67dd0165913e70c0e3c582ae.fa"},{"description":"FASTA files for new alp-1 RNAi construct
","doi":"10.22002/qgptf-s6f23","resourceType":"Dataset","name":"new alp-1 RNAi construct.fa","url":"https://portal.micropublication.org/uploads/7c0f882b454916728944e1a89be4717e.fa"}],"funding":"","image":{"url":"https://portal.micropublication.org/uploads/47d065df13b5a33e945c350af7274b77.jpg"},"imageCaption":"A: Schematic of the lim-8 locus showing tagging strategy. Black boxes: coding exons. White boxes: UTR. Green boxes: FLAG, linker, and mNeonGreen-encoding exons. B-D: Embryos showing LIM-8::mNG expression at comma stage, two-fold, and late elongation. Images are maximum-intensity Z projections of 0.9 µm stacks. Scale bars = 10 µm. E: LIM-8::mNG colocalizes with LifeAct on circumferential filament bundles (CFBs) and along adherens junctions. Images are maximum-intensity Z projections of 0.9 µm stacks. White arrow: CFBs. White arrowhead: seam cell actin mesh. Black arrow: Adherens junction at a seam-non-seam boundary. Scale bar = 10 µm. F: LIM-8::mNG expression in the pharynx of an adult worm. Image is a maximum intensity Z projection of a 4.5 µm stack. White arrow: anterior bulb. White arrowhead: terminal bulb. Scale bar = 10 µm. G: LIM-8::mNG expression in the uterus of an adult worm merged with the corresponding DIC image. Scale bar = 20 µm. H: LIM-8::mNG expression in the rectal and posterior phasmid systems. Image is a maximum-intensity Z projection of a 9.5 µm stack. Due to the strength of the signal in the phasmid cells, this image was acquired at lower laser power than other images. White arrows: phasmid system. White arrowhead: rectal system. Scale bar = 10 µm. I: LIM-8::mNG expression in an occupied spermatheca. LIM-8 signal is not specific to actin bundles but does accumulate at cell-cell junctions in a more apical view (I'). Images are maximum-intensity Z projections of 1.5 µm stacks, with I' immediately apical to I. Scale bar = 10 µm. J: Lethality counts do not reveal any role for lim-8 in sensitized backgrounds. N represents the number of adult worms whose progeny was scored. ns, not significant (P > 0.05 in all cases).
","imageTitle":"LIM-8 is expressed in the epidermis during embryonic elongation as well as other adult tissues but does not make major contributions to embryonic elongation
","methods":"Strains
Hermaphrodite C. elegans were maintained at 20°C on nematode growth media (NGM) plates seeded with E. coli strain OP50 according to standard protocols. N2 Bristol was used as wildtype (Brenner, 1974).
Strains used:
N2: Wildtype, from C. elegans Genetics Center (CGC)
SU1073: zyx-1(cp419)II; tes-1(ok1036)IV from (Lynch et al., 2022)
PS9957: lim-8(sy1989) III from CGC (Wang et al., 2018)
SU1164: zyx-1(cp419) II; lim-8(sy1989) III; tes-1(ok1036) IV from this study
SU1168: lim-8(jc116[lim-8::FLAG::mNG+LoxP]) III 2xOC from this study
AZ30: sma-1(ru18) V from (Praitis et al., 2005)
SU1170: sma-1(ru18) V 4xOC from this study
SU1349: curIs11[plin-26::LifeAct::mCherry]; lim-8(jc116[lim-8::FLAG::mNG+LoxP]) III from this study. Note: the LifeAct integrant likely resides on LG X
hmp-1(fe4) V isolated from balanced line SU287 (hmp-1(fe4)/lon-3(e2175) V) (Lynch et al., 2012) on 6/20/2026
Confocal imaging
Embryos were mounted on 10% agar pads in M9 buffer according to standard protocols (Hardin et al., 2022). Embryos were surrounded with OP50 during mounting to paralyze them by hypoxia (Gally et al., 2009). Confocal images were collected at 20°C using a Dragonfly 500 spinning disc confocal microscope (Oxford Instruments) mounted on a Leica DMi8 microscope equipped with a 63X glycerol immersion objective and a Zyla camera and controlled by Fusion software (Oxford Instruments) using a slice spacing of 0.3 μm. Adult worms were mounted on 9% agarose pads in M9 buffer and imaged using the same settings as for embryos, except that Z stacks were collected with a step size of 0.5 μm.
CRISPR/Cas9 genome editing
To endogenously tag the C. elegans lim-8 locus with FLAG and mNeonGreen, we used the self-excising selection cassette (SEC) method previously described by Dickinson et al. (Dickinson et al., 2015). The guide sequence was cloned into pJW1219 using blunt-end cloning to produce pARM1. A repair template for the C terminus of LIM-8 was generated using SapTrap cloning (Dickinson et al., 2018; Schwartz and Jorgensen, 2016) to assemble homology arms, linker, mNG, and self-excising cassette into the pMLS257 backbone to form pARM2. The forward primer for the 3' homology arm introduced a mutation to remove the PAM. pARM1 at 50 ng/µl and pARM2 at 15 ng/µl were injected into the gonads of adult C. elegans hermaphrodites along with coinjection markers pGH8 (4ng/µl), pCFJ90 (2ng/µl), and pCFJ104 (4ng/µl). Hygromycin selection for worms with the SEC, screening, and removal of SEC by heat shock were performed as described in Dickinson et al. (Dickinson et al., 2015). Oligonucleotides used for cloning, genotyping, and sequencing are as follows (Sequence complementary to C. elegans DNA indicated in ALL CAPS, mutation introduced to remove PAM in red):
pJW1219 F with guide sequence added: ACATTCTAGAAAGAACTTCTgtttaagagctatgctggaaacag
pJW1219 R: caagacatctcgcaataggag
pJW1219 gRNA sequencing: gtgtgaaataccgcacaga
5' homology arm forward: ggctgctcttcgtggGCTACGTCATCGTCGTTGAGG
5' homology arm reverse: gggtgctcttcgcgcGACTTTGCTCAATTGCACACGATC
3' homology arm forward: ggctgctcttcgggtTAAGCTCTAAATAGTCCAGTCgCAGAAGTTC
3' homology arm reverse: gggtgctcttcgtacGCGGTCGGTTTTGAGTTTCC
SEC sequencing reverse for repair template: ttaatgtgagttagctcactcattagg
lim-8 knock in genotyping forward: GCTACGTCATCGTCGTTGAGG
lim-8 knock in genotyping reverse: CCACCTCCGCCGTATAATGC
lim-8 knock in sequencing: GGACGTGGTGCTGCAATGAT
Cloning
Approximately 0.5kb of the alp-1 coding region, common to all known isoforms and not sharing sequences with any other known gene, was amplified from N2 worm cDNA and cloned into the L4440 feeding RNAi vector using standard restriction cloning techniques to produce pARM4. Oligonucleotides used for cloning are as follows (Sequence complementary to C. elegans DNA indicated in ALL CAPS):
Forward primer for alp-1 cDNA with HindIII restriction site added: gcaagcttGGAGTGATGGCTCGTGCAG
Reverse primer for alp-1 cDNA with NheI restriction site added: gcgctagcCATTTGAAGGTGGTGGATTTGACGG
RNAi and plate counts
dsRNA was generated using T7 transcription kit using a lim-8 cDNA clone (courtesy of G. Benian) and pARM4 as templates. dsRNA was injected into L4/young adult worms at 2 µg/µl for alp-1 and 3 µg/µl for lim-8. Uninjected young adults and injected worms 20-24 hours post-injection were singled and allowed to lay for 20-24 hours. For hmp-1(fe4) and sma-1(ru18) lines this time was extended up to 28 hours due to gonad defects in hmp-1(fe4) and body morphology defects in both lines, which slowed egg laying. Adult worms were then removed; 20-24 hours after removal of the adult worm, the number of hatchlings and dead eggs on each plate was counted. Each experiment was performed twice.
Statistical analysis
Percent lethality data, with the offspring of each worm considered as a biological replicate, were compared using Welch's t test (where two groups were to be compared), and one-way Brown-Forsythe and Welch ANOVA (where three groups were to be compared) to assess the significance of differences between groups using GraphPad Prism software. N values for each group are included in Figure 1J.
scRNAseq analysis
Transcript levels for lim-8 in epidermal cells were obtained using the summarized expression tool available in the online VisCello viewer (https://cello.shinyapps.io/celegans_explorer/) for the C. elegans embryo scRNA seq atlas developed by Packer et al. (2019).
Embryonic elongation of the C. elegans embryo is a powerful system for exploring the actin regulatory mechanisms that facilitate coordinated cell shape change. During embryonic elongation, the C. elegans embryo increases in length four-fold while reducing its diameter three-fold; this dramatic morphological change is accomplished by actomyosin-mediated epidermal cell shape changes, without any contribution from cell division or migration (reviewed in Labouesse et al., 2026). Proteins containing LIM domains are known to bind actin filaments under tension and have been implicated in repair of strained actin bundles (Smith et al., 2010; Smith et al., 2014; Sun et al., 2020). In C. elegans, LIM domain proteins have been investigated in striated body wall muscle (Lecroisey et al., 2013; Lecroisey et al., 2008; Qadota et al., 2007), synapses (Luo et al., 2014), and gastrulation (Slabodnick et al., 2023). We recently showed that two LIM domain containing repeat (LCR) proteins, ZYX-1 and TES-1, play roles at cell-cell junctions in elongating C. elegans embryos (Lynch et al., 2022), and so we sought to examine other C. elegansLIM domain containing proteins in the context of embryonic elongation. One such protein that has not been characterized during elongation is LIM-8, despite available single cell RNAseq data indicating it is expressed in the epidermis during elongation (Packer et al., 2019).
We endogenously tagged all known LIM-8 isoforms with mNeonGreen using CRISPR/Cas9 genome editing technology (Fig. 1A). LIM-8::mNG signal is first visible during early elongation, though it remains dim until the two-fold stage (Fig. 1B, 1C). During the second, muscle contraction-dependent phase of elongation, LIM-8::mNG signal is bright and localized to circumferential F-actin filament bundles (CFBs; Priess and Hirsh, 1986) in dorsal and ventral epidermal cells, the mesh-like actin network in seam epidermal cells (Costa et al., 1997; Gally et al., 2009), and proximal actin networks associated with adherens junctions (Costa et al., 1998; Fig. 1D, 1E). These observations are consistent with scRNA seq data for lim-8 from a published dataset, which shows transcriptional expression of lim-8 in AB- and C-derived epidermis and seam lineages 390-510 min after the first cell division (Packer et al., 2019). However, it is unclear from these data and ours whether the change in expression results from uniform expression during this time window, from increasingly specific localization, or both. Future experiments will be required to adjudicate these possibilities. During the muscle contraction-dependent phase of elongation, the LIM-8::mNG knock-in may have utility as an endogenously encoded reporter of F-actin organization, particularly as an alternative to LifeAct (Havrylenko et al., 2015) or the F-actin-binding fragment of the spectraplakin VAB-10 (Gally et al., 2009) for assessing the organization and alignment of CFBs in the embryonic epidermis.
In adult worms, LIM-8::mNG signal is visible in the pharynx, as expected from previously reported promoter::GFP fusion experiments (Qadota et al., 2007; Fig. 1F). LIM-8::mNG is also expressed in the uterus, the rectal and phasmid systems, and the spermatheca (Fig. 1G, 1H, 1I). Unlike in the epidermis of elongating embryos, LIM-8 in the spermatheca does not accumulate on aligned actin filaments but instead has a speckled appearance and localizes basal to adherens junctions (Fig. 1I). This localization pattern was observed in both occupied and unoccupied spermathecae, suggesting that the tension state of the actin filaments in the spermatheca does not determine whether LIM-8 is recruited. In the spermatheca, LIM-8 also localizes to apical adherens junctions (Fig. 1I'). While LIM-8 has been shown by antibody staining to localize to the M line in adult body wall muscle (Qadota et al., 2007), we were unable to detect LIM-8::mNG in body wall muscle under our imaging conditions.
While lim-8 loss of function alone is not associated with overt phenotypes (Qadota et al., 2007), the strong actin localization of LIM-8 during elongation, combined with previously identified roles for LIM-domain containing proteins TES-1 and ZYX-1 using sensitized backgrounds (Lynch et al., 2022), led us to consider whether LIM-8 might be functionally redundant with other actin-binding proteins during elongation. Since both tes-1 and zyx-1 loss of function enhance the lethality of the hypomorphic α-catenin mutant hmp-1(fe4), we tested whether lim-8 might also be a hmp-1(fe4) enhancer. We observed no significant difference in embryonic lethality between offspring of hmp-1(fe4) mothers and hmp-1(fe4) mothers injected with lim-8 dsRNA (Fig. 1J). We also tested whether a STOP-IN null allele (Wang et al., 2018) for lim-8 would synergize with mutant alleles for other genes involved in elongation. The βH-spectrin sma-1 is essential for efficient elongation, and loss of sma-1 function, while not lethal, results in hatchlings that reach just over two-fold, rather than complete four-fold elongation (McKeown et al., 1998; Praitis et al., 2005). A lim-8;sma-1 double null line did not show any embryonic lethality, and no obvious additional morphological defects were observed on plates (Fig. 1J). To ask whether loss of LIM-8 might synergize with other LIM domain-containing proteins during elongation, we crossed the lim-8 null allele with tes-1 and zyx-1 null alleles. Since the resulting line likewise did not display embryonic lethality, we considered whether another LIM domain containing protein, ALP-1, might be supporting elongation in this background through functional redundancy (Fig. 1J). As the existing Ahringer library clone targeted to alp-1covers sequence unique to the d isoform and the clone used to knock down alp-1 expression in previous studies is targeted to T11B7.5, a gene found in an intron of alp-1, and therefore is not specific to alp-1 (McKeown et al., 2006), we generated a new RNAi clone targeting all known isoforms of alp-1 but only sequences specific to that gene. Injection of alp-1 dsRNA generated using this clone into the lim-8(sy1989); tes-1(ok1036); zyx-1(cp419) line did not result in any embryonic lethality (Fig. 1J).
From these results, we conclude that LIM-8 does not make major contributions to C. elegans embryonic elongation. Any role it may play is dispensable for proper elongation; it is possible that additional proteins act redundantly with LIM-8 that we did not address in this study. Nevertheless, the differences in LIM-8 localization between the epidermis and the spermatheca suggest that LIM-8 may be a useful probe for interrogating the mechanisms regulating the association of LIM domain-containing proteins with actin filaments, which may be of biological relevance in other contexts.
","references":[{"reference":"Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics. 77: 71-94. 6.","pubmedId":"4366476","doi":""},{"reference":"Costa M, Draper BW, Priess JR. 1997. The role of actin filaments in patterning the Caenorhabditis elegans cuticle. Dev Biol. 184: 373-84. 30.","pubmedId":"9133443","doi":"10.1006/dbio.1997.8530"},{"reference":"Costa M, Raich W, Agbunag C, Leung B, Hardin J, Priess JR. 1998. A putative catenin-cadherin system mediates morphogenesis of the Caenorhabditis elegans embryo. J Cell Biol. 141: 297-308. 29.","pubmedId":"9531567","doi":"10.1083/jcb.141.1.297"},{"reference":"Dickinson D, Slabodnick M, Chen A, Goldstein B. 2018. SapTrap assembly of repair templates for Cas9-triggered homologous recombination with a self-excising cassette. MicroPubl Biol. 2018 27.","pubmedId":"32550377","doi":"10.17912/W2KT0N"},{"reference":"Dickinson DJ, Pani AM, Heppert JK, Higgins CD, Goldstein B. 2015. Streamlined Genome Engineering with a Self-Excising Drug Selection Cassette. Genetics. 200: 1035-49. 26.","pubmedId":"26044593","doi":"10.1534/genetics.115.178335"},{"reference":"Gally C, Wissler F, Zahreddine H, Quintin S, Landmann F, Labouesse M. 2009. Myosin II regulation during C. elegans embryonic elongation: LET-502/ROCK, MRCK-1 and PAK-1, three kinases with different roles. Development. 136: 3109-19. 25.","pubmedId":"19675126","doi":"10.1242/dev.039412"},{"reference":"Hardin J, Serre J, King R, Walck Shannon E, Reiner D. 2022. Imaging Epidermal Cell Rearrangement in the C. elegans Embryo. Methods Mol Biol. 2438: 345-376. 24.","pubmedId":"35147953","doi":"10.1007/978-1-0716-2035-9_22"},{"reference":"Havrylenko S, Noguera P, Abou Ghali M, Manzi J, Faqir F, Lamora A, et al., Plastino J. 2015. WAVE binds Ena/VASP for enhanced Arp2/3 complex-based actin assembly. Mol Biol Cell. 26: 55-65. 32.","pubmedId":"25355952","doi":"10.1091/mbc.E14-07-1200"},{"reference":"Labouesse M, Ferraro T, Llense F, Heier J, Tesone Z, Hardin J. 2026. Cellular Processes and Forces Shaping the Embryo: Lessons from C. elegans. Cells. 15 7.","pubmedId":"41972734","doi":"10.3390/cells15070645"},{"reference":"Lecroisey C, Brouilly N, Qadota H, Mariol MC, Rochette NC, Martin E, et al., Gieseler K. 2013. ZYX-1, the unique zyxin protein of Caenorhabditis elegans, is involved in dystrophin-dependent muscle degeneration. Mol Biol Cell. 24: 1232-49. 1.","pubmedId":"23427270","doi":"10.1091/mbc.E12-09-0679"},{"reference":"Lecroisey C, Martin E, Mariol MC, Granger L, Schwab Y, Labouesse M, Segalat L, Gieseler K. 2008. DYC-1, a protein functionally linked to dystrophin in Caenorhabditis elegans is associated with the dense body, where it interacts with the muscle LIM domain protein ZYX-1. Mol Biol Cell. 19: 785-96. 2.","pubmedId":"18094057","doi":"10.1091/mbc.E07-05-0497"},{"reference":"Luo S, Schaefer AM, Dour S, Nonet ML. 2014. The conserved LIM domain-containing focal adhesion protein ZYX-1 regulates synapse maintenance in Caenorhabditis elegans. Development. 141: 3922-33. 14.","pubmedId":"25252943","doi":"10.1242/dev.108217"},{"reference":"Lynch AM, Grana T, Cox Paulson E, Couthier A, Cameron M, Chin Sang I, Pettitt J, Hardin J. 2012. A Genome-wide Functional Screen Shows MAGI-1 Is an L1CAM-Dependent Stabilizer of Apical Junctions in C. elegans. Curr Biol. 22: 1891-9. 4.","pubmedId":"22981773","doi":"10.1016/j.cub.2012.08.024"},{"reference":"Lynch AM, Zhu Y, Lucas BG, Winkelman JD, Bai K, Martin SCT, et al., Hardin J. 2022. TES-1/Tes and ZYX-1/Zyxin protect junctional actin networks under tension during epidermal morphogenesis in the C. elegans embryo. Curr Biol. 32: 5189-5199 e6. 18.","pubmedId":"36384139","doi":"10.1016/j.cub.2022.10.045"},{"reference":"Mc Keown C, Praitis V, Austin J. 1998. sma-1 encodes a betaH-spectrin homolog required for Caenorhabditis elegans morphogenesis. Development. 125: 2087-98. 20.","pubmedId":"9570773","doi":""},{"reference":"Mc Keown CR, Han HF, Beckerle MC. 2006. Molecular characterization of the Caenorhabditis elegans ALP/Enigma gene alp-1. Dev Dyn. 235: 530-8. 22.","pubmedId":"16278882","doi":"10.1002/dvdy.20633"},{"reference":"Packer JS, Zhu Q, Huynh C, Sivaramakrishnan P, Preston E, Dueck H, et al., Murray JI. 2019. A lineage-resolved molecular atlas of C. elegans embryogenesis at single-cell resolution. Science. 365 16.","pubmedId":"31488706","doi":"10.1126/science.aax1971"},{"reference":"Praitis V, Ciccone E, Austin J. 2005. SMA-1 spectrin has essential roles in epithelial cell sheet morphogenesis in C. elegans. Dev Biol. 283: 157-70. 21.","pubmedId":"15890334","doi":""},{"reference":"Priess JR, Hirsh DI. 1986. Caenorhabditis elegans morphogenesis: the role of the cytoskeleton in elongation of the embryo. Dev Biol. 117: 156-73. 5.","pubmedId":"3743895","doi":""},{"reference":"Qadota H, Mercer KB, Miller RK, Kaibuchi K, Benian GM. 2007. Two LIM domain proteins and UNC-96 link UNC-97/pinch to myosin thick filaments in Caenorhabditis elegans muscle. Mol Biol Cell. 18: 4317-26. 8.","pubmedId":"17761533","doi":"10.1091/mbc.e07-03-0278"},{"reference":"Schwartz ML, Jorgensen EM. 2016. SapTrap, a Toolkit for High-Throughput CRISPR/Cas9 Gene Modification in Caenorhabditis elegans. Genetics. 202: 1277-88. 28.","pubmedId":"26837755","doi":"10.1534/genetics.115.184275"},{"reference":"Slabodnick MM, Tintori SC, Prakash M, Zhang P, Higgins CD, Chen AH, et al., Goldstein B. 2023. Zyxin contributes to coupling between cell junctions and contractile actomyosin networks during apical constriction. PLoS Genet. 19: e1010319. 17.","pubmedId":"36976799","doi":"10.1371/journal.pgen.1010319"},{"reference":"Smith MA, Blankman E, Gardel ML, Luettjohann L, Waterman CM, Beckerle MC. 2010. A zyxin-mediated mechanism for actin stress fiber maintenance and repair. Dev Cell. 19: 365-76. 13.","pubmedId":"20833360","doi":"10.1016/j.devcel.2010.08.008"},{"reference":"Smith MA, Hoffman LM, Beckerle MC. 2014. LIM proteins in actin cytoskeleton mechanoresponse. Trends Cell Biol. 24: 575-83. 11.","pubmedId":"24933506","doi":"10.1016/j.tcb.2014.04.009"},{"reference":"Sun X, Phua DYZ, Axiotakis L, Smith MA, Blankman E, Gong R, et al., Alushin GM. 2020. Mechanosensing through Direct Binding of Tensed F-Actin by LIM Domains. Dev Cell. 55: 468-482 e7. 10.","pubmedId":"33058779","doi":"10.1016/j.devcel.2020.09.022"},{"reference":"Wang H, Park H, Liu J, Sternberg PW. 2018. An Efficient Genome Editing Strategy To Generate Putative Null Mutants in Caenorhabditis elegans Using CRISPR/Cas9. G3 (Bethesda). 8: 3607-3616. 19.","pubmedId":"30224336","doi":"10.1534/g3.118.200662"}],"title":"C. elegans LIM-8 localizes to aligned actin filaments in the embryonic epidermis but is not important during embryonic elongation
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Daniela Raciti"},"openAcknowledgement":false,"submitted":null}]},{"id":"2ebce67a-d1da-4c67-85e4-34d6a7c43378","decision":"edit","abstract":"During embryonic elongation in C. elegans multiple actin-binding proteins cooperate to regulate cell shape changes. We investigated whether LIM-8, a LIM domain-containing protein expressed in the elongating epidermis, contributes to this process. We endogenously tagged all isoforms of LIM-8; LIM-8::mNeonGreen localizes to aligned actin filaments in the embryonic epidermis during elongation, in addition to several adult tissues. LIM-8 is not essential for embryonic elongation and we were unable to identify functional interactions with hmp-1/α-catenin, sma-1/βH-spectrin, or other LIM domain containing proteins, suggesting that, despite its striking localization, LIM-8 does not make major contributions to actin regulation during embryonic elongation.
","acknowledgements":"Some strains were provided by the C. elegans Genetics Center, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
","authors":[{"affiliations":["UW–Madison, Madison, WI, United States"],"departments":["Cellular and Molecular Biology Program"],"credit":["conceptualization","formalAnalysis","investigation","methodology","validation","visualization","writing_originalDraft","writing_reviewEditing"],"email":"amarkle@wisc.edu","firstName":"Adelle","lastName":"Markle","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0005-0114-1782"},{"affiliations":["UW–Madison, Madison, WI, United States","UW–Madison, Madison, WI, United States"],"departments":["Department of Biology","Cellular and Molecular Biology Program"],"credit":["conceptualization","formalAnalysis","fundingAcquisition","supervision","writing_reviewEditing"],"email":"jdhardin@wisc.edu","firstName":"Jeff","lastName":"Hardin","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-7399-6580"}],"awards":[{"awardId":"R35 GM145312","funderName":"National Institutes of Health (United States)","awardRecipient":"J. Hardin"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"FASTA files for the lim-8 final exon and knock-in sequences
","doi":"10.22002/ffyv9-se005","resourceType":"Dataset","name":"lim-8 last exon and knock in.fa","url":"https://portal.micropublication.org/uploads/1349fe9a67dd0165913e70c0e3c582ae.fa"},{"description":"FASTA files for new alp-1 RNAi construct
","doi":"10.22002/qgptf-s6f23","resourceType":"Dataset","name":"new alp-1 RNAi construct.fa","url":"https://portal.micropublication.org/uploads/7c0f882b454916728944e1a89be4717e.fa"}],"funding":"","image":{"url":"https://portal.micropublication.org/uploads/47d065df13b5a33e945c350af7274b77.jpg"},"imageCaption":"A: Schematic of the lim-8 locus showing tagging strategy. Black boxes: coding exons. White boxes: UTR. Green boxes: FLAG, linker, and mNeonGreen-encoding exons. B-D: Embryos showing LIM-8::mNG expression at comma stage, two-fold, and late elongation. Images are maximum-intensity Z projections of 0.9 µm stacks. Scale bars = 10 µm. E: LIM-8::mNG colocalizes with LifeAct on circumferential filament bundles (CFBs) and along adherens junctions. Images are maximum-intensity Z projections of 0.9 µm stacks. White arrow: CFBs. White arrowhead: seam cell actin mesh. Black arrow: adherens junction at a seam-non-seam boundary. Scale bar = 10 µm. F: LIM-8::mNG expression in the pharynx of an adult worm. Image is a maximum intensity Z projection of a 4.5 µm stack. White arrow: anterior bulb. White arrowhead: terminal bulb. Scale bar = 10 µm. G: LIM-8::mNG expression in the uterus of an adult worm merged with the corresponding DIC image. Scale bar = 20 µm. H: LIM-8::mNG expression in the rectal and posterior phasmid systems. Image is a maximum-intensity Z projection of a 9.5 µm stack. Due to the strength of the signal in the phasmid cells, this image was acquired at lower laser power than other images. White arrows: phasmid system. White arrowhead: rectal system. Scale bar = 10 µm. I: LIM-8::mNG expression in an occupied spermatheca. LIM-8 signal is not specific to actin bundles but does accumulate at cell-cell junctions in a more apical view (I'). Images are maximum-intensity Z projections of 1.5 µm stacks, with I' immediately apical to I. Scale bar = 10 µm. J: Lethality counts do not reveal any role for lim-8 in sensitized backgrounds. N represents the number of adult worms whose progeny was scored. ns, not significant (P > 0.05 in all cases).
","imageTitle":"LIM-8 is expressed in the epidermis during embryonic elongation as well as other adult tissues but does not make major contributions to embryonic elongation
","methods":"Strains
Hermaphrodite C. elegans were maintained at 20°C on nematode growth media (NGM) plates seeded with E. coli strain OP50 according to standard protocols. N2 Bristol was used as wildtype (Brenner, 1974).
Strains used:
N2: Wildtype, from C. elegans Genetics Center (CGC)
SU1073: zyx-1(cp419)II; tes-1(ok1036)IV from (Lynch et al., 2022)
PS9957: lim-8(sy1989) III from CGC (Wang et al., 2018)
SU1164: zyx-1(cp419) II; lim-8(sy1989) III; tes-1(ok1036) IV from this study
SU1168: lim-8(jc116[lim-8::FLAG::mNG+LoxP]) III 2xOC from this study
AZ30: sma-1(ru18) V from (Praitis et al., 2005)
SU1170: sma-1(ru18) V 4xOC from this study
SU1349: curIs11[plin-26::LifeAct::mCherry]; lim-8(jc116[lim-8::FLAG::mNG+LoxP]) III from this study. Note: the LifeAct integrant likely resides on LG X
hmp-1(fe4) V isolated from balanced line SU287 (hmp-1(fe4)/lon-3(e2175) V) (Lynch et al., 2012) on 6/20/2026
Confocal imaging
Embryos were mounted on 10% agar pads in M9 buffer according to standard protocols (Hardin et al., 2022). Embryos were surrounded with OP50 during mounting to paralyze them by hypoxia (Gally et al., 2009). Confocal images were collected at 20°C using a Dragonfly 500 spinning disc confocal microscope (Oxford Instruments) mounted on a Leica DMi8 microscope equipped with a 63X glycerol immersion objective and a Zyla camera and controlled by Fusion software (Oxford Instruments) using a slice spacing of 0.3 μm. Adult worms were mounted on 9% agarose pads in M9 buffer and imaged using the same settings as for embryos, except that Z stacks were collected with a step size of 0.5 μm.
CRISPR/Cas9 genome editing
To endogenously tag the C. elegans lim-8 locus with FLAG and mNeonGreen, we used the self-excising selection cassette (SEC) method previously described by Dickinson et al. (Dickinson et al., 2015). The guide sequence was cloned into pJW1219 using blunt-end cloning to produce pARM1. A repair template for the C terminus of LIM-8 was generated using SapTrap cloning (Dickinson et al., 2018; Schwartz and Jorgensen, 2016) to assemble homology arms, linker, mNG, and self-excising cassette into the pMLS257 backbone to form pARM2. The forward primer for the 3' homology arm introduced a mutation to remove the PAM. pARM1 at 50 ng/µl and pARM2 at 15 ng/µl were injected into the gonads of adult C. elegans hermaphrodites along with coinjection markers pGH8 (4ng/µl), pCFJ90 (2ng/µl), and pCFJ104 (4ng/µl). Hygromycin selection for worms with the SEC, screening, and removal of SEC by heat shock were performed as described in Dickinson et al. (Dickinson et al., 2015). Oligonucleotides used for cloning, genotyping, and sequencing are as follows (Sequence complementary to C. elegans DNA indicated in ALL CAPS, mutation introduced to remove PAM in red):
pJW1219 F with guide sequence added: ACATTCTAGAAAGAACTTCTgtttaagagctatgctggaaacag
pJW1219 R: caagacatctcgcaataggag
pJW1219 gRNA sequencing: gtgtgaaataccgcacaga
5' homology arm forward: ggctgctcttcgtggGCTACGTCATCGTCGTTGAGG
5' homology arm reverse: gggtgctcttcgcgcGACTTTGCTCAATTGCACACGATC
3' homology arm forward: ggctgctcttcgggtTAAGCTCTAAATAGTCCAGTCgCAGAAGTTC
3' homology arm reverse: gggtgctcttcgtacGCGGTCGGTTTTGAGTTTCC
SEC sequencing reverse for repair template: ttaatgtgagttagctcactcattagg
lim-8 knock in genotyping forward: GCTACGTCATCGTCGTTGAGG
lim-8 knock in genotyping reverse: CCACCTCCGCCGTATAATGC
lim-8 knock in sequencing: GGACGTGGTGCTGCAATGAT
Cloning
Approximately 0.5kb of the alp-1 coding region, common to all known isoforms and not sharing sequences with any other known gene, was amplified from N2 worm cDNA and cloned into the L4440 feeding RNAi vector using standard restriction cloning techniques to produce pARM4. Oligonucleotides used for cloning are as follows (Sequence complementary to C. elegans DNA indicated in ALL CAPS):
Forward primer for alp-1 cDNA with HindIII restriction site added: gcaagcttGGAGTGATGGCTCGTGCAG
Reverse primer for alp-1 cDNA with NheI restriction site added: gcgctagcCATTTGAAGGTGGTGGATTTGACGG
RNAi and plate counts
dsRNA was generated using T7 transcription kit using a lim-8 cDNA clone (courtesy of G. Benian) and pARM4 as templates. dsRNA was injected into L4/young adult worms at 2 µg/µl for alp-1 and 3 µg/µl for lim-8. Uninjected young adults and injected worms 20-24 hours post-injection were singled and allowed to lay for 20-24 hours. For hmp-1(fe4) and sma-1(ru18) lines this time was extended up to 28 hours due to gonad defects in hmp-1(fe4) and body morphology defects in both lines, which slowed egg laying. Adult worms were then removed; 20-24 hours after removal of the adult worm, the number of hatchlings and dead eggs on each plate was counted. Each experiment was performed twice.
Statistical analysis
Percent lethality data, with the offspring of each worm considered as a biological replicate, were compared using Welch's t test (where two groups were to be compared), and one-way Brown-Forsythe and Welch ANOVA (where three groups were to be compared) to assess the significance of differences between groups using GraphPad Prism software. N values for each group are included in Figure 1J.
scRNAseq analysis
Transcript levels for lim-8 in epidermal cells were obtained using the summarized expression tool available in the online VisCello viewer (https://cello.shinyapps.io/celegans_explorer/) for the C. elegans embryo scRNA seq atlas developed by Packer et al. (2019).
Embryonic elongation of the C. elegans embryo is a powerful system for exploring the actin regulatory mechanisms that facilitate coordinated cell shape change. During embryonic elongation, the C. elegans embryo increases in length four-fold while reducing its diameter three-fold; this dramatic morphological change is accomplished by actomyosin-mediated epidermal cell shape changes, without any contribution from cell division or migration (reviewed in Labouesse et al., 2026). Proteins containing LIM domains are known to bind actin filaments under tension and have been implicated in repair of strained actin bundles (Smith et al., 2010; Smith et al., 2014; Sun et al., 2020). In C. elegans, LIM domain proteins have been investigated in striated body wall muscle (Lecroisey et al., 2013; Lecroisey et al., 2008; Qadota et al., 2007), synapses (Luo et al., 2014), and gastrulation (Slabodnick et al., 2023). We recently showed that two LIM domain containing repeat (LCR) proteins, ZYX-1 and TES-1, play roles at cell-cell junctions in elongating C. elegans embryos (Lynch et al., 2022), and so we sought to examine other C. elegans LIM domain containing proteins in the context of embryonic elongation. One such protein that has not been characterized during elongation is LIM-8, despite available single cell RNAseq data indicating it is expressed in the epidermis during elongation (Packer et al., 2019).
We endogenously tagged all known LIM-8 isoforms with mNeonGreen using CRISPR/Cas9 genome editing technology (Fig. 1A). LIM-8::mNG signal is first visible during early elongation, though it remains dim until the two-fold stage (Fig. 1B, 1C). During the second, muscle contraction-dependent phase of elongation, LIM-8::mNG signal is bright and localized to circumferential F-actin filament bundles (CFBs; Priess and Hirsh, 1986) in dorsal and ventral epidermal cells, the mesh-like actin network in seam epidermal cells (Costa et al., 1997; Gally et al., 2009), and proximal actin networks associated with adherens junctions (Costa et al., 1998; Fig. 1D, 1E). These observations are consistent with scRNA seq data for lim-8 from a published dataset, which shows transcriptional expression of lim-8 in AB- and C-derived epidermis and seam lineages 390-510 min after the first cell division (Packer et al., 2019). However, it is unclear from these data and ours whether the change in expression results from uniform expression during this time window, from increasingly specific localization, or both. Future experiments will be required to adjudicate these possibilities. During the muscle contraction-dependent phase of elongation, the LIM-8::mNG knock-in may have utility as an endogenously encoded reporter of F-actin organization, particularly as an alternative to LifeAct (Havrylenko et al., 2015) or the F-actin-binding fragment of the spectraplakin VAB-10 (Gally et al., 2009) for assessing the organization and alignment of CFBs in the embryonic epidermis.
In adult worms, LIM-8::mNG signal is visible in the pharynx, as expected from previously reported promoter::GFP fusion experiments (Qadota et al., 2007; Fig. 1F). LIM-8::mNG is also expressed in the uterus, the rectal and phasmid systems, and the spermatheca (Fig. 1G, 1H, 1I). Unlike in the epidermis of elongating embryos, LIM-8 in the spermatheca does not accumulate on aligned actin filaments but instead has a speckled appearance and localizes basal to adherens junctions (Fig. 1I). This localization pattern was observed in both occupied and unoccupied spermathecae, suggesting that the tension state of the actin filaments in the spermatheca does not determine whether LIM-8 is recruited. In the spermatheca, LIM-8 also localizes to apical adherens junctions (Fig. 1I'). While LIM-8 has been shown by antibody staining to localize to the M line in adult body wall muscle (Qadota et al., 2007), we were unable to detect LIM-8::mNG in body wall muscle under our imaging conditions.
While lim-8 loss of function alone is not associated with overt phenotypes (Qadota et al., 2007), the strong actin localization of LIM-8 during elongation, combined with previously identified roles for LIM-domain containing proteins TES-1 and ZYX-1 using sensitized backgrounds (Lynch et al., 2022), led us to consider whether LIM-8 might be functionally redundant with other actin-binding proteins during elongation. Since both tes-1 and zyx-1 loss of function enhance the lethality of the hypomorphic α-catenin mutant hmp-1(fe4), we tested whether lim-8 might also be a hmp-1(fe4) enhancer. We observed no significant difference in embryonic lethality between offspring of hmp-1(fe4) mothers and hmp-1(fe4) mothers injected with lim-8 dsRNA (Fig. 1J). We also tested whether a STOP-IN null allele (Wang et al., 2018) for lim-8 would synergize with mutant alleles for other genes involved in elongation. The βH-spectrin sma-1 is essential for efficient elongation, and loss of sma-1 function, while not lethal, results in hatchlings that reach just over two-fold, rather than complete four-fold elongation (McKeown et al., 1998; Praitis et al., 2005). A lim-8;sma-1 double null line did not show any embryonic lethality, and no obvious additional morphological defects were observed on plates (Fig. 1J). To ask whether loss of LIM-8 might synergize with other LIM domain-containing proteins during elongation, we crossed the lim-8 null allele with tes-1 and zyx-1 null alleles. Since the resulting line likewise did not display embryonic lethality, we considered whether another LIM domain containing protein, ALP-1, might be supporting elongation in this background through functional redundancy (Fig. 1J). As the existing Ahringer library clone targeted to alp-1 covers sequence unique to the d isoform and the clone used to knock down alp-1 expression in previous studies is targeted to T11B7.5, a gene found in an intron of alp-1, and therefore is not specific to alp-1 (McKeown et al., 2006), we generated a new RNAi clone targeting all known isoforms of alp-1 but only sequences specific to that gene. Injection of alp-1 dsRNA generated using this clone into the lim-8(sy1989); tes-1(ok1036); zyx-1(cp419) line did not result in any embryonic lethality (Fig. 1J).
From these results, we conclude that LIM-8 does not make major contributions to C. elegans embryonic elongation. Any role it may play is dispensable for proper elongation; it is possible that additional proteins act redundantly with LIM-8 that we did not address in this study. Nevertheless, the differences in LIM-8 localization between the epidermis and the spermatheca suggest that LIM-8 may be a useful probe for interrogating the mechanisms regulating the association of LIM domain-containing proteins with actin filaments, which may be of biological relevance in other contexts.
","references":[{"reference":"Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics. 77: 71-94. 6.","pubmedId":"4366476","doi":""},{"reference":"Costa M, Draper BW, Priess JR. 1997. The role of actin filaments in patterning the Caenorhabditis elegans cuticle. Dev Biol. 184: 373-84. 30.","pubmedId":"9133443","doi":"10.1006/dbio.1997.8530"},{"reference":"Costa M, Raich W, Agbunag C, Leung B, Hardin J, Priess JR. 1998. A putative catenin-cadherin system mediates morphogenesis of the Caenorhabditis elegans embryo. J Cell Biol. 141: 297-308. 29.","pubmedId":"9531567","doi":"10.1083/jcb.141.1.297"},{"reference":"Dickinson D, Slabodnick M, Chen A, Goldstein B. 2018. SapTrap assembly of repair templates for Cas9-triggered homologous recombination with a self-excising cassette. MicroPubl Biol. 2018 27.","pubmedId":"32550377","doi":"10.17912/W2KT0N"},{"reference":"Dickinson DJ, Pani AM, Heppert JK, Higgins CD, Goldstein B. 2015. Streamlined Genome Engineering with a Self-Excising Drug Selection Cassette. Genetics. 200: 1035-49. 26.","pubmedId":"26044593","doi":"10.1534/genetics.115.178335"},{"reference":"Gally C, Wissler F, Zahreddine H, Quintin S, Landmann F, Labouesse M. 2009. Myosin II regulation during C. elegans embryonic elongation: LET-502/ROCK, MRCK-1 and PAK-1, three kinases with different roles. Development. 136: 3109-19. 25.","pubmedId":"19675126","doi":"10.1242/dev.039412"},{"reference":"Hardin J, Serre J, King R, Walck Shannon E, Reiner D. 2022. Imaging Epidermal Cell Rearrangement in the C. elegans Embryo. Methods Mol Biol. 2438: 345-376. 24.","pubmedId":"35147953","doi":"10.1007/978-1-0716-2035-9_22"},{"reference":"Havrylenko S, Noguera P, Abou Ghali M, Manzi J, Faqir F, Lamora A, et al., Plastino J. 2015. WAVE binds Ena/VASP for enhanced Arp2/3 complex-based actin assembly. Mol Biol Cell. 26: 55-65. 32.","pubmedId":"25355952","doi":"10.1091/mbc.E14-07-1200"},{"reference":"Labouesse M, Ferraro T, Llense F, Heier J, Tesone Z, Hardin J. 2026. Cellular Processes and Forces Shaping the Embryo: Lessons from C. elegans. Cells. 15 7.","pubmedId":"41972734","doi":"10.3390/cells15070645"},{"reference":"Lecroisey C, Brouilly N, Qadota H, Mariol MC, Rochette NC, Martin E, et al., Gieseler K. 2013. ZYX-1, the unique zyxin protein of Caenorhabditis elegans, is involved in dystrophin-dependent muscle degeneration. Mol Biol Cell. 24: 1232-49. 1.","pubmedId":"23427270","doi":"10.1091/mbc.E12-09-0679"},{"reference":"Lecroisey C, Martin E, Mariol MC, Granger L, Schwab Y, Labouesse M, Segalat L, Gieseler K. 2008. DYC-1, a protein functionally linked to dystrophin in Caenorhabditis elegans is associated with the dense body, where it interacts with the muscle LIM domain protein ZYX-1. Mol Biol Cell. 19: 785-96. 2.","pubmedId":"18094057","doi":"10.1091/mbc.E07-05-0497"},{"reference":"Luo S, Schaefer AM, Dour S, Nonet ML. 2014. The conserved LIM domain-containing focal adhesion protein ZYX-1 regulates synapse maintenance in Caenorhabditis elegans. Development. 141: 3922-33. 14.","pubmedId":"25252943","doi":"10.1242/dev.108217"},{"reference":"Lynch AM, Grana T, Cox Paulson E, Couthier A, Cameron M, Chin Sang I, Pettitt J, Hardin J. 2012. A Genome-wide Functional Screen Shows MAGI-1 Is an L1CAM-Dependent Stabilizer of Apical Junctions in C. elegans. Curr Biol. 22: 1891-9. 4.","pubmedId":"22981773","doi":"10.1016/j.cub.2012.08.024"},{"reference":"Lynch AM, Zhu Y, Lucas BG, Winkelman JD, Bai K, Martin SCT, et al., Hardin J. 2022. TES-1/Tes and ZYX-1/Zyxin protect junctional actin networks under tension during epidermal morphogenesis in the C. elegans embryo. Curr Biol. 32: 5189-5199 e6. 18.","pubmedId":"36384139","doi":"10.1016/j.cub.2022.10.045"},{"reference":"Mc Keown C, Praitis V, Austin J. 1998. sma-1 encodes a betaH-spectrin homolog required for Caenorhabditis elegans morphogenesis. Development. 125: 2087-98. 20.","pubmedId":"9570773","doi":""},{"reference":"Mc Keown CR, Han HF, Beckerle MC. 2006. Molecular characterization of the Caenorhabditis elegans ALP/Enigma gene alp-1. Dev Dyn. 235: 530-8. 22.","pubmedId":"16278882","doi":"10.1002/dvdy.20633"},{"reference":"Packer JS, Zhu Q, Huynh C, Sivaramakrishnan P, Preston E, Dueck H, et al., Murray JI. 2019. A lineage-resolved molecular atlas of C. elegans embryogenesis at single-cell resolution. Science. 365 16.","pubmedId":"31488706","doi":"10.1126/science.aax1971"},{"reference":"Praitis V, Ciccone E, Austin J. 2005. SMA-1 spectrin has essential roles in epithelial cell sheet morphogenesis in C. elegans. Dev Biol. 283: 157-70. 21.","pubmedId":"15890334","doi":""},{"reference":"Priess JR, Hirsh DI. 1986. Caenorhabditis elegans morphogenesis: the role of the cytoskeleton in elongation of the embryo. Dev Biol. 117: 156-73. 5.","pubmedId":"3743895","doi":""},{"reference":"Qadota H, Mercer KB, Miller RK, Kaibuchi K, Benian GM. 2007. Two LIM domain proteins and UNC-96 link UNC-97/pinch to myosin thick filaments in Caenorhabditis elegans muscle. Mol Biol Cell. 18: 4317-26. 8.","pubmedId":"17761533","doi":"10.1091/mbc.e07-03-0278"},{"reference":"Schwartz ML, Jorgensen EM. 2016. SapTrap, a Toolkit for High-Throughput CRISPR/Cas9 Gene Modification in Caenorhabditis elegans. Genetics. 202: 1277-88. 28.","pubmedId":"26837755","doi":"10.1534/genetics.115.184275"},{"reference":"Slabodnick MM, Tintori SC, Prakash M, Zhang P, Higgins CD, Chen AH, et al., Goldstein B. 2023. Zyxin contributes to coupling between cell junctions and contractile actomyosin networks during apical constriction. PLoS Genet. 19: e1010319. 17.","pubmedId":"36976799","doi":"10.1371/journal.pgen.1010319"},{"reference":"Smith MA, Blankman E, Gardel ML, Luettjohann L, Waterman CM, Beckerle MC. 2010. A zyxin-mediated mechanism for actin stress fiber maintenance and repair. Dev Cell. 19: 365-76. 13.","pubmedId":"20833360","doi":"10.1016/j.devcel.2010.08.008"},{"reference":"Smith MA, Hoffman LM, Beckerle MC. 2014. LIM proteins in actin cytoskeleton mechanoresponse. Trends Cell Biol. 24: 575-83. 11.","pubmedId":"24933506","doi":"10.1016/j.tcb.2014.04.009"},{"reference":"Sun X, Phua DYZ, Axiotakis L, Smith MA, Blankman E, Gong R, et al., Alushin GM. 2020. Mechanosensing through Direct Binding of Tensed F-Actin by LIM Domains. Dev Cell. 55: 468-482 e7. 10.","pubmedId":"33058779","doi":"10.1016/j.devcel.2020.09.022"},{"reference":"Wang H, Park H, Liu J, Sternberg PW. 2018. An Efficient Genome Editing Strategy To Generate Putative Null Mutants in Caenorhabditis elegans Using CRISPR/Cas9. G3 (Bethesda). 8: 3607-3616. 19.","pubmedId":"30224336","doi":"10.1534/g3.118.200662"}],"title":"C. elegans LIM-8 localizes to aligned actin filaments in the embryonic epidermis but is not important during embryonic elongation
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Daniela Raciti"},"openAcknowledgement":false,"submitted":null}]},{"id":"dd5c4df6-9d9b-4d2f-8d1a-cfdaa1d3116d","decision":"publish","abstract":"During embryonic elongation in C. elegans multiple actin-binding proteins cooperate to regulate cell shape changes. We investigated whether LIM-8, a LIM domain-containing protein expressed in the elongating epidermis, contributes to this process. We endogenously tagged all isoforms of LIM-8; LIM-8::mNeonGreen localizes to aligned actin filaments in the embryonic epidermis during elongation, in addition to several adult tissues. LIM-8 is not essential for embryonic elongation and we were unable to identify functional interactions with hmp-1/α-catenin, sma-1/βH-spectrin, or other LIM domain containing proteins, suggesting that, despite its striking localization, LIM-8 does not make major contributions to actin regulation during embryonic elongation.
","acknowledgements":"Some strains were provided by the C. elegans Genetics Center, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
","authors":[{"affiliations":["UW–Madison, Madison, WI, United States"],"departments":["Cellular and Molecular Biology Program"],"credit":["conceptualization","formalAnalysis","investigation","methodology","validation","visualization","writing_originalDraft","writing_reviewEditing"],"email":"amarkle@wisc.edu","firstName":"Adelle","lastName":"Markle","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0005-0114-1782"},{"affiliations":["UW–Madison, Madison, WI, United States","UW–Madison, Madison, WI, United States"],"departments":["Department of Biology","Cellular and Molecular Biology Program"],"credit":["conceptualization","formalAnalysis","fundingAcquisition","supervision","writing_reviewEditing"],"email":"jdhardin@wisc.edu","firstName":"Jeff","lastName":"Hardin","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-7399-6580"}],"awards":[{"awardId":"R35 GM145312","funderName":"National Institutes of Health (United States)","awardRecipient":"J. Hardin"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"FASTA files for the lim-8 final exon and knock-in sequences
","doi":"10.22002/ffyv9-se005","resourceType":"Dataset","name":"lim-8 last exon and knock in.fa","url":"https://portal.micropublication.org/uploads/1349fe9a67dd0165913e70c0e3c582ae.fa"},{"description":"FASTA files for new alp-1 RNAi construct
","doi":"10.22002/qgptf-s6f23","resourceType":"Dataset","name":"new alp-1 RNAi construct.fa","url":"https://portal.micropublication.org/uploads/7c0f882b454916728944e1a89be4717e.fa"}],"funding":"","image":{"url":"https://portal.micropublication.org/uploads/47d065df13b5a33e945c350af7274b77.jpg"},"imageCaption":"A: Schematic of the lim-8 locus showing tagging strategy. Black boxes: coding exons. White boxes: UTR. Green boxes: FLAG, linker, and mNeonGreen-encoding exons. B-D: Embryos showing LIM-8::mNG expression at comma stage, two-fold, and late elongation. Images are maximum-intensity Z projections of 0.9 µm stacks. Scale bars = 10 µm. E: LIM-8::mNG colocalizes with LifeAct on circumferential filament bundles (CFBs) and along adherens junctions. Images are maximum-intensity Z projections of 0.9 µm stacks. White arrow: CFBs. White arrowhead: seam cell actin mesh. Black arrow: adherens junction at a seam-non-seam boundary. Scale bar = 10 µm. F: LIM-8::mNG expression in the pharynx of an adult worm. Image is a maximum intensity Z projection of a 4.5 µm stack. White arrow: anterior bulb. White arrowhead: terminal bulb. Scale bar = 10 µm. G: LIM-8::mNG expression in the uterus of an adult worm merged with the corresponding DIC image. Scale bar = 20 µm. H: LIM-8::mNG expression in the rectal and posterior phasmid systems. Image is a maximum-intensity Z projection of a 9.5 µm stack. Due to the strength of the signal in the phasmid cells, this image was acquired at lower laser power than other images. White arrows: phasmid system. White arrowhead: rectal system. Scale bar = 10 µm. I: LIM-8::mNG expression in an occupied spermatheca. LIM-8 signal is not specific to actin bundles but does accumulate at cell-cell junctions in a more apical view (I'). Images are maximum-intensity Z projections of 1.5 µm stacks, with I' immediately apical to I. Scale bar = 10 µm. J: Lethality counts do not reveal any role for lim-8 in sensitized backgrounds. N represents the number of adult worms whose progeny was scored. ns, not significant (P > 0.05 in all cases).
","imageTitle":"LIM-8 is expressed in the epidermis during embryonic elongation as well as other adult tissues but does not make major contributions to embryonic elongation
","methods":"Strains
Hermaphrodite C. elegans were maintained at 20°C on nematode growth media (NGM) plates seeded with E. coli strain OP50 according to standard protocols. N2 Bristol was used as wildtype (Brenner, 1974).
Strains used:
N2: Wildtype, from C. elegans Genetics Center (CGC)
SU1073: zyx-1(cp419)II; tes-1(ok1036)IV from (Lynch et al., 2022)
PS9957: lim-8(sy1989) III from CGC (Wang et al., 2018)
SU1164: zyx-1(cp419) II; lim-8(sy1989) III; tes-1(ok1036) IV from this study
SU1168: lim-8(jc116[lim-8::FLAG::mNG+LoxP]) III 2xOC from this study
AZ30: sma-1(ru18) V from (Praitis et al., 2005)
SU1170: sma-1(ru18) V 4xOC from this study
SU1349: curIs11[plin-26::LifeAct::mCherry]; lim-8(jc116[lim-8::FLAG::mNG+LoxP]) III from this study. Note: the LifeAct integrant likely resides on LG X
hmp-1(fe4) V isolated from balanced line SU287 (hmp-1(fe4)/lon-3(e2175) V) (Lynch et al., 2012) on 6/20/2026
Confocal imaging
Embryos were mounted on 10% agar pads in M9 buffer according to standard protocols (Hardin et al., 2022). Embryos were surrounded with OP50 during mounting to paralyze them by hypoxia (Gally et al., 2009). Confocal images were collected at 20°C using a Dragonfly 500 spinning disc confocal microscope (Oxford Instruments) mounted on a Leica DMi8 microscope equipped with a 63X glycerol immersion objective and a Zyla camera and controlled by Fusion software (Oxford Instruments) using a slice spacing of 0.3 μm. Adult worms were mounted on 9% agarose pads in M9 buffer and imaged using the same settings as for embryos, except that Z stacks were collected with a step size of 0.5 μm.
CRISPR/Cas9 genome editing
To endogenously tag the C. elegans lim-8 locus with FLAG and mNeonGreen, we used the self-excising selection cassette (SEC) method previously described by Dickinson et al. (Dickinson et al., 2015). The guide sequence was cloned into pJW1219 using blunt-end cloning to produce pARM1. A repair template for the C terminus of LIM-8 was generated using SapTrap cloning (Dickinson et al., 2018; Schwartz and Jorgensen, 2016) to assemble homology arms, linker, mNG, and self-excising cassette into the pMLS257 backbone to form pARM2. The forward primer for the 3' homology arm introduced a mutation to remove the PAM. pARM1 at 50 ng/µl and pARM2 at 15 ng/µl were injected into the gonads of adult C. elegans hermaphrodites along with coinjection markers pGH8 (4ng/µl), pCFJ90 (2ng/µl), and pCFJ104 (4ng/µl). Hygromycin selection for worms with the SEC, screening, and removal of SEC by heat shock were performed as described in Dickinson et al. (Dickinson et al., 2015). Oligonucleotides used for cloning, genotyping, and sequencing are as follows (Sequence complementary to C. elegans DNA indicated in ALL CAPS, mutation introduced to remove PAM in red):
pJW1219 F with guide sequence added: ACATTCTAGAAAGAACTTCTgtttaagagctatgctggaaacag
pJW1219 R: caagacatctcgcaataggag
pJW1219 gRNA sequencing: gtgtgaaataccgcacaga
5' homology arm forward: ggctgctcttcgtggGCTACGTCATCGTCGTTGAGG
5' homology arm reverse: gggtgctcttcgcgcGACTTTGCTCAATTGCACACGATC
3' homology arm forward: ggctgctcttcgggtTAAGCTCTAAATAGTCCAGTCgCAGAAGTTC
3' homology arm reverse: gggtgctcttcgtacGCGGTCGGTTTTGAGTTTCC
SEC sequencing reverse for repair template: ttaatgtgagttagctcactcattagg
lim-8 knock in genotyping forward: GCTACGTCATCGTCGTTGAGG
lim-8 knock in genotyping reverse: CCACCTCCGCCGTATAATGC
lim-8 knock in sequencing: GGACGTGGTGCTGCAATGAT
Cloning
Approximately 0.5kb of the alp-1 coding region, common to all known isoforms and not sharing sequences with any other known gene, was amplified from N2 worm cDNA and cloned into the L4440 feeding RNAi vector using standard restriction cloning techniques to produce pARM4. Oligonucleotides used for cloning are as follows (Sequence complementary to C. elegans DNA indicated in ALL CAPS):
Forward primer for alp-1 cDNA with HindIII restriction site added: gcaagcttGGAGTGATGGCTCGTGCAG
Reverse primer for alp-1 cDNA with NheI restriction site added: gcgctagcCATTTGAAGGTGGTGGATTTGACGG
RNAi and plate counts
dsRNA was generated using T7 transcription kit using a lim-8 cDNA clone (courtesy of G. Benian) and pARM4 as templates. dsRNA was injected into L4/young adult worms at 2 µg/µl for alp-1 and 3 µg/µl for lim-8. Uninjected young adults and injected worms 20-24 hours post-injection were singled and allowed to lay for 20-24 hours. For hmp-1(fe4) and sma-1(ru18) lines this time was extended up to 28 hours due to gonad defects in hmp-1(fe4) and body morphology defects in both lines, which slowed egg laying. Adult worms were then removed; 20-24 hours after removal of the adult worm, the number of hatchlings and dead eggs on each plate was counted. Each experiment was performed twice.
Statistical analysis
Percent lethality data, with the offspring of each worm considered as a biological replicate, were compared using Welch's t test (where two groups were to be compared), and one-way Brown-Forsythe and Welch ANOVA (where three groups were to be compared) to assess the significance of differences between groups using GraphPad Prism software. N values for each group are included in Figure 1J.
scRNAseq analysis
Transcript levels for lim-8 in epidermal cells were obtained using the summarized expression tool available in the online VisCello viewer (https://cello.shinyapps.io/celegans_explorer/) for the C. elegans embryo scRNA seq atlas developed by Packer et al. (2019).
Embryonic elongation of the C. elegans embryo is a powerful system for exploring the actin regulatory mechanisms that facilitate coordinated cell shape change. During embryonic elongation, the C. elegans embryo increases in length four-fold while reducing its diameter three-fold; this dramatic morphological change is accomplished by actomyosin-mediated epidermal cell shape changes, without any contribution from cell division or migration (reviewed in Labouesse et al., 2026). Proteins containing LIM domains are known to bind actin filaments under tension and have been implicated in repair of strained actin bundles (Smith et al., 2010; Smith et al., 2014; Sun et al., 2020). In C. elegans, LIM domain proteins have been investigated in striated body wall muscle (Lecroisey et al., 2013; Lecroisey et al., 2008; Qadota et al., 2007), synapses (Luo et al., 2014), and gastrulation (Slabodnick et al., 2023). We recently showed that two LIM domain containing repeat (LCR) proteins, ZYX-1 and TES-1, play roles at cell-cell junctions in elongating C. elegans embryos (Lynch et al., 2022), and so we sought to examine other C. elegans LIM domain containing proteins in the context of embryonic elongation. One such protein that has not been characterized during elongation is LIM-8, despite available single cell RNAseq data indicating it is expressed in the epidermis during elongation (Packer et al., 2019).
We endogenously tagged all known LIM-8 isoforms with mNeonGreen using CRISPR/Cas9 genome editing technology (Fig. 1A). LIM-8::mNG signal is first visible during early elongation, though it remains dim until the two-fold stage (Fig. 1B, 1C). During the second, muscle contraction-dependent phase of elongation, LIM-8::mNG signal is bright and localized to circumferential F-actin filament bundles (CFBs; Priess and Hirsh, 1986) in dorsal and ventral epidermal cells, the mesh-like actin network in seam epidermal cells (Costa et al., 1997; Gally et al., 2009), and proximal actin networks associated with adherens junctions (Costa et al., 1998; Fig. 1D, 1E). These observations are consistent with scRNA seq data for lim-8 from a published dataset, which shows transcriptional expression of lim-8 in AB- and C-derived epidermis and seam lineages 390-510 min after the first cell division (Packer et al., 2019). However, it is unclear from these data and ours whether the change in expression results from uniform expression during this time window, from increasingly specific localization, or both. Future experiments will be required to adjudicate these possibilities. During the muscle contraction-dependent phase of elongation, the LIM-8::mNG knock-in may have utility as an endogenously encoded reporter of F-actin organization, particularly as an alternative to LifeAct (Havrylenko et al., 2015) or the F-actin-binding fragment of the spectraplakin VAB-10 (Gally et al., 2009) for assessing the organization and alignment of CFBs in the embryonic epidermis.
In adult worms, LIM-8::mNG signal is visible in the pharynx, as expected from previously reported promoter::GFP fusion experiments (Qadota et al., 2007; Fig. 1F). LIM-8::mNG is also expressed in the uterus, the rectal and phasmid systems, and the spermatheca (Fig. 1G, 1H, 1I). Unlike in the epidermis of elongating embryos, LIM-8 in the spermatheca does not accumulate on aligned actin filaments but instead has a speckled appearance and localizes basal to adherens junctions (Fig. 1I). This localization pattern was observed in both occupied and unoccupied spermathecae, suggesting that the tension state of the actin filaments in the spermatheca does not determine whether LIM-8 is recruited. In the spermatheca, LIM-8 also localizes to apical adherens junctions (Fig. 1I'). While LIM-8 has been shown by antibody staining to localize to the M line in adult body wall muscle (Qadota et al., 2007), we were unable to detect LIM-8::mNG in body wall muscle under our imaging conditions.
While lim-8 loss of function alone is not associated with overt phenotypes (Qadota et al., 2007), the strong actin localization of LIM-8 during elongation, combined with previously identified roles for LIM-domain containing proteins TES-1 and ZYX-1 using sensitized backgrounds (Lynch et al., 2022), led us to consider whether LIM-8 might be functionally redundant with other actin-binding proteins during elongation. Since both tes-1 and zyx-1 loss of function enhance the lethality of the hypomorphic α-catenin mutant hmp-1(fe4), we tested whether lim-8 might also be a hmp-1(fe4) enhancer. We observed no significant difference in embryonic lethality between offspring of hmp-1(fe4) mothers and hmp-1(fe4) mothers injected with lim-8 dsRNA (Fig. 1J). We also tested whether a STOP-IN null allele (Wang et al., 2018) for lim-8 would synergize with mutant alleles for other genes involved in elongation. The βH-spectrin sma-1 is essential for efficient elongation, and loss of sma-1 function, while not lethal, results in hatchlings that reach just over two-fold, rather than complete four-fold elongation (McKeown et al., 1998; Praitis et al., 2005). A lim-8;sma-1 double null line did not show any embryonic lethality, and no obvious additional morphological defects were observed on plates (Fig. 1J). To ask whether loss of LIM-8 might synergize with other LIM domain-containing proteins during elongation, we crossed the lim-8 null allele with tes-1 and zyx-1 null alleles. Since the resulting line likewise did not display embryonic lethality, we considered whether another LIM domain containing protein, ALP-1, might be supporting elongation in this background through functional redundancy (Fig. 1J). As the existing Ahringer library clone targeted to alp-1 covers sequence unique to the d isoform and the clone used to knock down alp-1 expression in previous studies is targeted to T11B7.5, a gene found in an intron of alp-1, and therefore is not specific to alp-1 (McKeown et al., 2006), we generated a new RNAi clone targeting all known isoforms of alp-1 but only sequences specific to that gene. Injection of alp-1 dsRNA generated using this clone into the lim-8(sy1989); tes-1(ok1036); zyx-1(cp419) line did not result in any embryonic lethality (Fig. 1J).
From these results, we conclude that LIM-8 does not make major contributions to C. elegans embryonic elongation. Any role it may play is dispensable for proper elongation; it is possible that additional proteins act redundantly with LIM-8 that we did not address in this study. Nevertheless, the differences in LIM-8 localization between the epidermis and the spermatheca suggest that LIM-8 may be a useful probe for interrogating the mechanisms regulating the association of LIM domain-containing proteins with actin filaments, which may be of biological relevance in other contexts.
","references":[{"reference":"Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics. 77: 71-94. 6.","pubmedId":"4366476","doi":""},{"reference":"Costa M, Draper BW, Priess JR. 1997. The role of actin filaments in patterning the Caenorhabditis elegans cuticle. Dev Biol. 184: 373-84. 30.","pubmedId":"9133443","doi":"10.1006/dbio.1997.8530"},{"reference":"Costa M, Raich W, Agbunag C, Leung B, Hardin J, Priess JR. 1998. A putative catenin-cadherin system mediates morphogenesis of the Caenorhabditis elegans embryo. J Cell Biol. 141: 297-308. 29.","pubmedId":"9531567","doi":"10.1083/jcb.141.1.297"},{"reference":"Dickinson D, Slabodnick M, Chen A, Goldstein B. 2018. SapTrap assembly of repair templates for Cas9-triggered homologous recombination with a self-excising cassette. MicroPubl Biol. 2018 27.","pubmedId":"32550377","doi":"10.17912/W2KT0N"},{"reference":"Dickinson DJ, Pani AM, Heppert JK, Higgins CD, Goldstein B. 2015. Streamlined Genome Engineering with a Self-Excising Drug Selection Cassette. Genetics. 200: 1035-49. 26.","pubmedId":"26044593","doi":"10.1534/genetics.115.178335"},{"reference":"Gally C, Wissler F, Zahreddine H, Quintin S, Landmann F, Labouesse M. 2009. Myosin II regulation during C. elegans embryonic elongation: LET-502/ROCK, MRCK-1 and PAK-1, three kinases with different roles. Development. 136: 3109-19. 25.","pubmedId":"19675126","doi":"10.1242/dev.039412"},{"reference":"Hardin J, Serre J, King R, Walck Shannon E, Reiner D. 2022. Imaging Epidermal Cell Rearrangement in the C. elegans Embryo. Methods Mol Biol. 2438: 345-376. 24.","pubmedId":"35147953","doi":"10.1007/978-1-0716-2035-9_22"},{"reference":"Havrylenko S, Noguera P, Abou Ghali M, Manzi J, Faqir F, Lamora A, et al., Plastino J. 2015. WAVE binds Ena/VASP for enhanced Arp2/3 complex-based actin assembly. Mol Biol Cell. 26: 55-65. 32.","pubmedId":"25355952","doi":"10.1091/mbc.E14-07-1200"},{"reference":"Labouesse M, Ferraro T, Llense F, Heier J, Tesone Z, Hardin J. 2026. Cellular Processes and Forces Shaping the Embryo: Lessons from C. elegans. Cells. 15 7.","pubmedId":"41972734","doi":"10.3390/cells15070645"},{"reference":"Lecroisey C, Brouilly N, Qadota H, Mariol MC, Rochette NC, Martin E, et al., Gieseler K. 2013. ZYX-1, the unique zyxin protein of Caenorhabditis elegans, is involved in dystrophin-dependent muscle degeneration. Mol Biol Cell. 24: 1232-49. 1.","pubmedId":"23427270","doi":"10.1091/mbc.E12-09-0679"},{"reference":"Lecroisey C, Martin E, Mariol MC, Granger L, Schwab Y, Labouesse M, Segalat L, Gieseler K. 2008. DYC-1, a protein functionally linked to dystrophin in Caenorhabditis elegans is associated with the dense body, where it interacts with the muscle LIM domain protein ZYX-1. Mol Biol Cell. 19: 785-96. 2.","pubmedId":"18094057","doi":"10.1091/mbc.E07-05-0497"},{"reference":"Luo S, Schaefer AM, Dour S, Nonet ML. 2014. The conserved LIM domain-containing focal adhesion protein ZYX-1 regulates synapse maintenance in Caenorhabditis elegans. Development. 141: 3922-33. 14.","pubmedId":"25252943","doi":"10.1242/dev.108217"},{"reference":"Lynch AM, Grana T, Cox Paulson E, Couthier A, Cameron M, Chin Sang I, Pettitt J, Hardin J. 2012. A Genome-wide Functional Screen Shows MAGI-1 Is an L1CAM-Dependent Stabilizer of Apical Junctions in C. elegans. Curr Biol. 22: 1891-9. 4.","pubmedId":"22981773","doi":"10.1016/j.cub.2012.08.024"},{"reference":"Lynch AM, Zhu Y, Lucas BG, Winkelman JD, Bai K, Martin SCT, et al., Hardin J. 2022. TES-1/Tes and ZYX-1/Zyxin protect junctional actin networks under tension during epidermal morphogenesis in the C. elegans embryo. Curr Biol. 32: 5189-5199 e6. 18.","pubmedId":"36384139","doi":"10.1016/j.cub.2022.10.045"},{"reference":"Mc Keown C, Praitis V, Austin J. 1998. sma-1 encodes a betaH-spectrin homolog required for Caenorhabditis elegans morphogenesis. Development. 125: 2087-98. 20.","pubmedId":"9570773","doi":""},{"reference":"Mc Keown CR, Han HF, Beckerle MC. 2006. Molecular characterization of the Caenorhabditis elegans ALP/Enigma gene alp-1. Dev Dyn. 235: 530-8. 22.","pubmedId":"16278882","doi":"10.1002/dvdy.20633"},{"reference":"Packer JS, Zhu Q, Huynh C, Sivaramakrishnan P, Preston E, Dueck H, et al., Murray JI. 2019. A lineage-resolved molecular atlas of C. elegans embryogenesis at single-cell resolution. Science. 365 16.","pubmedId":"31488706","doi":"10.1126/science.aax1971"},{"reference":"Praitis V, Ciccone E, Austin J. 2005. SMA-1 spectrin has essential roles in epithelial cell sheet morphogenesis in C. elegans. Dev Biol. 283: 157-70. 21.","pubmedId":"15890334","doi":""},{"reference":"Priess JR, Hirsh DI. 1986. Caenorhabditis elegans morphogenesis: the role of the cytoskeleton in elongation of the embryo. Dev Biol. 117: 156-73. 5.","pubmedId":"3743895","doi":""},{"reference":"Qadota H, Mercer KB, Miller RK, Kaibuchi K, Benian GM. 2007. Two LIM domain proteins and UNC-96 link UNC-97/pinch to myosin thick filaments in Caenorhabditis elegans muscle. Mol Biol Cell. 18: 4317-26. 8.","pubmedId":"17761533","doi":"10.1091/mbc.e07-03-0278"},{"reference":"Schwartz ML, Jorgensen EM. 2016. SapTrap, a Toolkit for High-Throughput CRISPR/Cas9 Gene Modification in Caenorhabditis elegans. Genetics. 202: 1277-88. 28.","pubmedId":"26837755","doi":"10.1534/genetics.115.184275"},{"reference":"Slabodnick MM, Tintori SC, Prakash M, Zhang P, Higgins CD, Chen AH, et al., Goldstein B. 2023. Zyxin contributes to coupling between cell junctions and contractile actomyosin networks during apical constriction. PLoS Genet. 19: e1010319. 17.","pubmedId":"36976799","doi":"10.1371/journal.pgen.1010319"},{"reference":"Smith MA, Blankman E, Gardel ML, Luettjohann L, Waterman CM, Beckerle MC. 2010. A zyxin-mediated mechanism for actin stress fiber maintenance and repair. Dev Cell. 19: 365-76. 13.","pubmedId":"20833360","doi":"10.1016/j.devcel.2010.08.008"},{"reference":"Smith MA, Hoffman LM, Beckerle MC. 2014. LIM proteins in actin cytoskeleton mechanoresponse. Trends Cell Biol. 24: 575-83. 11.","pubmedId":"24933506","doi":"10.1016/j.tcb.2014.04.009"},{"reference":"Sun X, Phua DYZ, Axiotakis L, Smith MA, Blankman E, Gong R, et al., Alushin GM. 2020. Mechanosensing through Direct Binding of Tensed F-Actin by LIM Domains. Dev Cell. 55: 468-482 e7. 10.","pubmedId":"33058779","doi":"10.1016/j.devcel.2020.09.022"},{"reference":"Wang H, Park H, Liu J, Sternberg PW. 2018. An Efficient Genome Editing Strategy To Generate Putative Null Mutants in Caenorhabditis elegans Using CRISPR/Cas9. G3 (Bethesda). 8: 3607-3616. 19.","pubmedId":"30224336","doi":"10.1534/g3.118.200662"}],"title":"C. elegans LIM-8 localizes to aligned actin filaments in the embryonic epidermis but is not important during embryonic elongation
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Daniela Raciti"},"openAcknowledgement":false,"submitted":null}]}]}},"species":{"species":[{"value":"acer saccharum","label":"Acer saccharum","imageSrc":"","imageAlt":"","mod":"TreeGenes","modLink":"https://treegenesdb.org","linkVariable":""},{"value":"achillea millefolium","label":"Achillea millefolium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"acinetobacter baylyi","label":"Acinetobacter baylyi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"actinobacteria bacterium","label":"Actinobacteria bacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adelges tsugae","label":"Adelges tsugae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adenocaulon chilense","label":"Adenocaulon chilense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aedes japonicus","label":"Aedes japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aegorhinus vitulus","label":"Aegorhinus vitulus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aerococcus","label":"Aerococcus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alaimidae","label":"Alaimidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"allobates femoralis","label":"Allobates femoralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alnus glutinosa","label":"Alnus glutinosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa aestivalis","label":"Alosa aestivalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa pseudoharengus","label":"Alosa pseudoharengus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alternaria alternata","label":"Alternaria alternata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"amynthas agrestis","label":"Amynthas Agrestis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma caninum","label":"Ancylostoma caninum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma ceylanicum","label":"Ancylostoma ceylanicum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anemone multifida","label":"Anemone multifida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anguilla rostrata","label":"Anguilla rostrata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anisakis simplex","label":"Anisakis simplex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anomala albopilosa","label":"Anomala albopilosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arabidopsis","label":"Arabidopsis","imageSrc":"arabidopsis.png","imageAlt":"Arabidopsis graphic by Zoe Zorn CC BY 4.0","mod":"TAIR","modLink":"https://arabidopsis.org","linkVariable":""},{"value":"architeuthis dux","label":"Architeuthis dux","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arion vulgaris","label":"Arion vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"armeria","label":"Armeria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"artemia","label":"Artemia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arthrobacter sp.","label":"Arthrobacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia","label":"Ascaridia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia galli","label":"Ascaridia galli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"asparagopsis taxiformis","label":"Asparagopsis taxiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"astatotilapia burtoni","label":"Astatotilapia burtoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"avena sativa","label":"Avena sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aves","label":"Aves","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus","label":"Bacillus (firmicutes)","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus cereus","label":"Bacillus cereus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus mycoides","label":"Bacillus mycoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus subtilis","label":"Bacillus subtilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus thuringiensis","label":"Bacillus thuringiensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus toyonensis","label":"Bacillus toyonensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus wiedmannii","label":"Bacillus wiedmannii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteria","label":"Bacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteriophage","label":"Bacteriophage","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bactrocera","label":"Bactrocera sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"batrachospermum gelatinosum","label":"Batrachospermum gelatinosum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula lenta","label":"Betula lenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula nigra","label":"Betula nigra","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus dahlbohmii","label":"Bombus dahlbohmii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus terrestris","label":"Bombus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombyx mori","label":"Bombyx mori","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bos taurus","label":"Bos Taurus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brachygobius doriae","label":"Brachygobius doriae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica oleracea","label":"Brassica oleracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica rapa","label":"Brassica rapa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brugia malayi","label":"Brugia malayi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"burkholderia thailandensis","label":"Burkholderia thailandensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"buttiauxella","label":"Buttiauxella","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis brenneri","label":"Caenorhabditis brenneri","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis briggsae","label":"Caenorhabditis briggsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"c. elegans","label":"Caenorhabditis elegans","imageSrc":"c-elegans.jpg","imageAlt":"C. elegans graphic by Zoe Zorn CC BY 4.0","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"caenorhabditis inopinata","label":"Caenorhabditis inopinata","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis japonica","label":"Caenorhabditis japonica","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis nigoni","label":"Caenorhabditis nigoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis remanei","label":"Caenorhabditis remanei","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis tropicalis","label":"Caenorhabditis tropicalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus","label":"Calidifontibacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus erzuremensis","label":"Calidifontibacillus erzuremensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calliphora sp","label":"Calliphora sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caltha sagittata","label":"Caltha sagittata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cambarus latimanus","label":"Cambarus latimanus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"candida albicans","label":"Candida albicans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"canis familiaris","label":"Canis familiaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cannabis sativa","label":"Cannabis sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caretta caretta","label":"Caretta caretta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cassiopea xamachana","label":"Cassiopea xamachana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caulobacter vibrioides","label":"Caulobacter vibrioides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cephalopods","label":"Cephalopoda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cerastium arvense","label":"Cerastium arvense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceriodaphnia","label":"Ceriodaphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceroglossus suturalis","label":"Ceroglossus suturalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chaetoceros","label":"Chaetoceros","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chamaecrista fasciculata","label":"Chamaecrista fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chilicola chalcidiformis","label":"Chilicola chalcidiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chitinimonas","label":"Chitinimonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chlamydomonas reinhardtii","label":"Chlamydomonas reinhardtii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chromobacterium","label":"Chromobacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysemys picta","label":"Chrysemys picta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysoperla rufilabris","label":"Chrysoperla rufilabris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"citrus","label":"Citrus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"clavibacter sp.","label":"Clavibacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"colinus virginianus","label":"Colinus virginianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crassostrea virginica","label":"Crassostrea virginica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crithidia fasciculata","label":"Crithidia fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cutibacterium acnes","label":"Cutibacterium acnes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cyanobacteria","label":"Cyanobacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia","label":"Daphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia pulex","label":"Daphnia pulex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dermacoccus nishinomiyaensis","label":"Dermacoccus nishinomiyaensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera","label":"Diabrotica virgifera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera virgifera virus 1","label":"Diabrotica virgifera virgifera virus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"d. discoideum","label":"Dictyostelium discoideum","imageSrc":"dicty.png","imageAlt":"D. discoideum","mod":"dictyBase","modLink":"http://dictybase.org","linkVariable":""},{"value":"diptera","label":"Diptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dotocryptus bellicosus","label":"Dotocryptus bellicosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drechmeria coniospora","label":"Drechmeria coniospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drosophila","label":"Drosophila","imageSrc":"drosophila.png","imageAlt":"Drosophila graphic by Zoe Zorn CC BY 4.0","mod":"FlyBase","modLink":"https://flybase.org/doi/","linkVariable":"doi"},{"value":"dryopteris campyloptera","label":"Dryopteris campyloptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris expansa","label":"Dryopteris expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris intermedia","label":"Dryopteris intermedia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dugesia dorotocephala","label":"Dugesia dorotocephala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"elasmobranchii","label":"Elasmobranchii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"embryophyta","label":"Embryophyta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enoploteuthis chunii","label":"Enoploteuthis chunii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterobacter aerogenes","label":"Enterobacter aerogenes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterococcus raffinosus","label":"Enterococcus raffinosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"epichloë coenophiala","label":"Epichloë coenophiala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"equus caballus","label":"Equus caballus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erigeron sp","label":"Erigeron sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eristalis","label":"Eristalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eruca vesicaria","label":"Eruca vesicaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erwinia carotovora","label":"Erwinia carotovora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erythronium americanum","label":"Erythronium americanum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"escherichia coli","label":"Escherichia coli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eukaryota","label":"Eukaryotes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"felis catus","label":"Felis catus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella novicida","label":"Francisella novicida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella tularensis","label":"Francisella tularensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fraxinus americana","label":"Fraxinus americana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fucus distichus","label":"Fucus distichus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fungi","label":"Fungi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gasteropelecus sp.","label":"Gasteropelecus sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"geranium sp","label":"Geranium sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"girardia","label":"Girardia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glaucomys volans","label":"Glaucomys volans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glycine max","label":"Glycine max","imageSrc":"","imageAlt":"","mod":"Soybase","modLink":"https://soybase.org","linkVariable":""},{"value":"glyptemys insculpta","label":"Glyptemys insculpta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gossypium hirsutum","label":"Gossypium hirsutum","imageSrc":"","imageAlt":"","mod":"CottonGen","modLink":"https://www.cottongen.org/","linkVariable":""},{"value":"gromphadorhina portentosa","label":"Gromphadorhina portentosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gryllodes sigillatus","label":"Gryllodes sigillatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"haliotis rufescens","label":"Haliotis rufescens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hepacivirus hominis","label":"Hepatitis C Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"herpes simplex virus type 1","label":"Herpes simplex virus type 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human","label":"Human","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human coronavirus oc43","label":"Human coronavirus OC43","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydra vulgaris","label":"Hydra vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydropsyche sp","label":"Hydropsyche sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hymenoptera","label":"Hymenoptera","imageSrc":"","imageAlt":"","mod":"Hymenoptera Genome Database","modLink":"https://hymenoptera.elsiklab.missouri.edu/","linkVariable":""},{"value":"hypochaeris radicata","label":"Hypochaeris radicata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hypodynerus vespiformis","label":"Hypodynerus vespiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflaviridae","label":"Iflaviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflavuris","label":"Iflavirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ipomoea hederacea","label":"Ipomoea hederacea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera","label":"Ischnomera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera ruficollis","label":"Ischnomera ruficollis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"julidochromis marlieri","label":"Julidochromis marlieri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"juniperus virginiana","label":"Juniperus virginiana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"kluyveromyces marxianus","label":"Kluyveromyces marxianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"l. casei","label":"L. casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lacticaseibacillus casei","label":"Lacticaseibacillus casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lactobacillus","label":"Lactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"larentiinae sp","label":"Larentiinae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"laurus nobilis","label":"Laurus nobilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lepidoptera","label":"Lepidoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"leucanthemum vulgare","label":"Leucanthemum vulgare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ligilactobacillus","label":"Ligilactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ligilactobacillus salivarius","label":"Ligilactobacillus salivarius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"limosilactobacillus","label":"Limosilactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"linepithema humile","label":"Linepithema humile","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"liometopum occidentale","label":"Liometopum occidentale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lolium arundinaceum","label":"Lolium arundinaceum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lontra longicaudis","label":"Lontra longicaudis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbriculus variegatus","label":"Lumbriculus variegatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbricus terrestris","label":"Lumbricus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lupinus polyphyllus","label":"Lupinus polyphyllus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lycorma delicatula","label":"Lycorma delicatula","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lynx rufus","label":"Lynx rufus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"magnaporthe oryzae","label":"Magnaporthe oryzae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mammalia","label":"Mammalia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"manihot esculenta","label":"Manihot esculenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"medicago lupulina","label":"Medicago lupulina","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"meloidogyne","label":"Meloidogyne","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mimus polyglottos","label":"Mimus polyglottos","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bryophyta","label":"Mosses","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mouse","label":"Mouse","imageSrc":"","imageAlt":"","mod":"MGI","modLink":"https://informatics.jax.org","linkVariable":""},{"value":"m. minutoides","label":"Mus minutoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mycobacterium smegmatis","label":"Mycobacterium smegmatis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nakaseomyces glabratus","label":"Nakaseomyces glabratus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nauphoeta cinerea","label":"Nauphoeta cinerea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"neurospora","label":"Neurospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"n. benthamiana","label":"Nicotiana benthamiana","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/Nicotiana_benthamiana/genome","linkVariable":""},{"value":"nicotiana tabacum","label":"Nicotiana tabacum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae","label":"Noctuidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae sp","label":"Noctuidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nothobranchius furzeri","label":"Nothobranchius furzeri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"onchocerca volvulus","label":"Onchocerca volvulus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"orconectes virilis","label":"Orconectes virilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ormia ochracea","label":"Ormia ochracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"o. sativa","label":"Oryza sativa","imageSrc":"","imageAlt":"","mod":"Gramene","modLink":"https://www.gramene.org/","linkVariable":""},{"value":"other","label":"Other","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"oxalis enneaphylla","label":"Oxalis enneaphylla","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea","label":"Pantoea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea agglomerans","label":"Pantoea agglomerans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"papaver sp","label":"Papaver sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paramecium bursaria","label":"Paramecium bursaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"partitiviridae","label":"Partitiviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pelodiscus sinensis","label":"Pelodiscus sinensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"perezia recurvata","label":"Perezia recurvata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"petromyzon marinus","label":"Petromyzon marinus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis","label":"Photinus pyralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis associated partiti-like virus","label":"Photinus pyralis associated partiti-like virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis iflavirus 1","label":"Photinus pyralis iflavirus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"physcomitrium patens","label":"Physcomitrium patens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus strobus","label":"Pinus strobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus taeda","label":"Pinus taeda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"platycheirus","label":"Platycheirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"plectus sambesii","label":"Plectus sambesii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pogonomyrmex occidentalis","label":"Pogonomyrmex occidentalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"poncirus trifoliata","label":"Poncirus trifoliata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"populus deltoides","label":"Populus deltoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"potato virus y","label":"Potato virus Y","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"primula magellanica","label":"Primula magellanica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pristionchus pacificus","label":"Pristionchus pacificus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"prunus persica","label":"Prunus persica","imageSrc":"","imageAlt":"","mod":"Genome Database for Rosaceae","modLink":"https://www.rosaceae.org/","linkVariable":""},{"value":"psalmopoeus iriminia","label":"Psalmopoeus iriminia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudanabaena sp.","label":"Pseudanabaena sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas","label":"Pseudomonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas aeruginosa","label":"Pseudomonas aeruginosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas glycinae","label":"Pseudomonas glycinae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas putida","label":"Pseudomonas putida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas syringae","label":"Pseudomonas syringae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pterophyllum scalare","label":"Pterophyllum scalare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"python regius","label":"Python regius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"quercus macrocarpa","label":"Quercus macrocarpa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ralstonia solanacearum","label":"Ralstonia solanacearum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranitomeya imitator","label":"Ranitomeya imitator","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranunculus peduncularis","label":"Ranunculus peduncularis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"rat","label":"Rat","imageSrc":"","imageAlt":"","mod":"RGD","modLink":"https://rgd.mcw.edu","linkVariable":""},{"value":"rheinheimera","label":"Rheinheimera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ribes rubrum","label":"Ribes rubrum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"sars-cov-2","label":"SARS-CoV-2","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. cerevisiae","label":"Saccharomyces cerevisiae","imageSrc":"yeast.png","imageAlt":"Yeast graphic by Zoe Zorn CC BY 4.0","mod":"SGD","modLink":"https://yeastgenome.org","linkVariable":""},{"value":"saccharomyces paradoxus","label":"Saccharomyces paradoxus ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. uvarum","label":"Saccharomyces uvarum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schistosoma","label":"Schistosoma","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schizosaccharomyces japonicus","label":"Schizosaccharomyces japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. pombe","label":"Schizosaccharomyces pombe","imageSrc":"pombe.png","imageAlt":"Pombe graphic by Zoe Zorn © Caltech","mod":"PomBase","modLink":"https://www.pombase.org/reference/PMID:","linkVariable":"pmId"},{"value":"schmidtea mediterranea","label":"Schmidtea mediterranea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"senecio sp","label":"Senecio sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"simocephalus","label":"Simocephalus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"siraitia grosvenorii","label":"Siraitia grosvenorii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"solanum lycopersicum","label":"Solanum lycopersicum","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/1/view/","linkVariable":""},{"value":"sorghum","label":"Sorghum","imageSrc":"","imageAlt":"","mod":"SorghumBase","modLink":"https://www.sorghumbase.org","linkVariable":""},{"value":"spiroplasma eriocheiris","label":"Spiroplasma eriocheiris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus aureus","label":"Staphylococcus aureus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus epidermidis","label":"Staphylococcus epidermidis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"steinernema carpocapsae","label":"Steinernema carpocapsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"steinernema hermaphroditum","label":"Steinernema hermaphroditum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stenotrophomonas geniculata","label":"Stenotrophomonas geniculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stewartia floidana","label":"Stewartia floridana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus gordonii ","label":"Streptococcus gordonii ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus mutans","label":"Streptococcus mutans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":" streptococcus pneumoniae","label":"Streptococcus pneumoniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. purpuratus","label":"Strongylocentrotus purpuratus","imageSrc":"","imageAlt":"","mod":"Echinobase","modLink":"https://www.echinobase.org","linkVariable":""},{"value":"strongyloides ratti","label":"Strongyloides ratti","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"sulfolobus","label":"Sulfolobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"symphoricarpos albus","label":"Symphoricarpos albus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syncirsodes","label":"Syncirsodes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"synechococcus elongatus","label":"Synechococcus elongatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syrphidae","label":"Syrphidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tarantobelus jeffdanielsi","label":"Tarantobelus jeffdanielsi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"taraxacum officinale","label":"Taraxacum officinale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tatochila theodice","label":"Tatochila theodice","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetrahymena","label":"Tetrahymena","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetramorium immigrans","label":"Tetramorium immigrans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tomato brown rugose fruit virus","label":"ToBRFV","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trachemys scripta","label":"Trachemys scripta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tribolium castaneum","label":"Tribolium castaneum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichoptera","label":"Trichoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichuris muris","label":"Trichuris muris","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"trifolium repens","label":"Trifolium repens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trypoxylus dichotomus","label":"Trypoxylus dichotomus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tsuga canadensis","label":"Tsuga canadensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ulva expansa","label":"Ulva expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"universal","label":"Universal","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"vargula hilgendorfii","label":"Vargula hilgendorfii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"vespula vulgaris","label":"Vespula vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"virus","label":"Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"watasenia scintillans","label":"Watasenia scintillans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"wolbachia pipientis","label":"Wolbachia pipientis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"xenopus","label":"Xenopus","imageSrc":"xenopus.png","imageAlt":"Xenopus graphic by Zoe Zorn CC BY 4.0","mod":"XenBase","modLink":"https://xenbase.org","linkVariable":""},{"value":"xenorhabdus griffiniae","label":"Xenorhabdus griffiniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"yramea cytheris","label":"Yramea cytheris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zaprionus indianus","label":"Zaprionus indianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zea mays","label":"Zea mays","imageSrc":"","imageAlt":"","mod":"MaizeGDB","modLink":"https://www.maizegdb.org","linkVariable":""},{"value":"zebrafish","label":"Zebrafish","imageSrc":"zebrafish.png","imageAlt":"Zebrafish graphic by Zoe Zorn CC BY 4.0","mod":"ZFIN","modLink":"https://zfin.org","linkVariable":""}]}},"pageContext":{"id":"b4b62280-6863-4f76-a756-c1ad42f64f8c","citedBy":[],"parsedCsv":{"csvHeader":[],"csvData":[]}}}, "staticQueryHashes": ["2114697108"]}