Integrins are heterodimeric transmembrane receptors that are critical in many biological processes, including neuronal development. Here we investigate integrin signaling in the outgrowth of dendritic spines on C. elegans GABAergic neurons using mutations engineered within the NPxY motif of the β integrin subunit PAT-3. We found a Y/E substitution, but not Y/A or Y/F substitutions, reduced dendritic spine number and misoriented spines. The Y/E substitution in the NPxY motif also altered the distribution of the presynaptic scaffold CLA-1, suggesting roles in both pre- and postsynaptic development. Our findings implicate integrin activation through the NPxY motif in synapse formation/maturation.
","acknowledgements":"We thank Dr. Shankar Ramachandran for technical assistance. We also thank Emily Norman for helpful comments and suggestions.
","authors":[{"affiliations":["Assumption University","University of Massachusetts Chan Medical School"],"departments":["Biological and Physical Sciences","Neurobiology"],"credit":["conceptualization","investigation","fundingAcquisition","supervision","writing_originalDraft","methodology","dataCuration","formalAnalysis"],"email":"mlemons@assumption.edu","firstName":"Michele L","lastName":"Lemons","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-8459-4130"},{"affiliations":["Assumption University"],"departments":["Biological and Physical Sciences"],"credit":["dataCuration","visualization","investigation"],"email":"Noelia.GenaoGarcia@umassmed.edu","firstName":"Noelia","lastName":"Genao","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0007-1611-452X"},{"affiliations":["Assumption University"],"departments":["Biological and Physical Sciences"],"credit":["investigation","validation","visualization","dataCuration"],"email":"hailey.mckillop@umassmed.edu","firstName":"Hailey","lastName":"McKillop","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0001-5582-6964"},{"affiliations":["University of Massachusetts Chan Medical School"],"departments":["Neurobiology"],"credit":["conceptualization","methodology","project","supervision","writing_reviewEditing","fundingAcquisition","investigation","resources"],"email":"michael.francis@umassmed.edu","firstName":"Michael M","lastName":"Francis","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-8076-6668"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work was supported by a collaborative RUI grant from the National Science Foundation, Division of Integrative Organismal Systems IOS1754986 (M.L.L.) and IOS1755019 (M.M.F.)
","image":{"url":"https://portal.micropublication.org/uploads/09830dc03e87b28fe060280b4990a7ba.png"},"imageCaption":"A) Maximum projection confocal image of the C. elegans GABAergic DD1 neuron dendritic shaft (inverted LUT grey scale) labeled by transcriptional expression of myristoylated GFP (mGFP). pGABA::mGFP in top image refers to cell specific transcriptional expression of mGFP in DD GABAergic neurons using the flp-13 promoter. Bottom panel is a cartoon representation of the top image and includes red carets pointing to ventrally directed spines protruding from the dendritic shaft. All images are from larval stage 4 animals and oriented with anterior to the left and ventral towards the bottom, as indicated by arrows. Scale bar, 5 μm. B) Inverted maximal projection images showing DD1 dendritic spines of wildtype, pat-3(kq8041), pat-3(kq8042) and pat-3(kq8043) animals. Scale bar, 5 μm. C) Scatterplot of the total number of spines within a 15 μm region of DD1 neurons in wild-type animals and pat-3 mutants. The number of spines in pat-3(kq8042) animals was significantly decreased compared to wildtype, pat-3(kq8041), and pat-3(kq8043) animals. Each data point represents a measurement from an independent animal. Red horizontal bar indicates the mean. *p<0.05, **p<0.005, *** p<0.0005, Kruskal Wallis test. D) Number of dorsally directed spines per animal shown as a scatterplot. Inset image shows region from pat-3(kq8042) animal with dorsally directed spines identified by red carets. Dorsally directed spines were significantly increased in pat-3(kq8042) compared to wild type. Red horizontal bar indicates the mean. Inset image of pat-3(kq8042) animal with carets pointing to dorsally directed spines. *p<0.05, **p<0.005, ***p<0.0005, Kruskal Wallis test. Scale bar, 2 μm. E) Maximum projection confocal images of C. elegans GABAergic DD1 neuron dendritic shaft and spines (red) and presynaptic protein CLA-1 (green). pGABA::mCherry refers to transgenic expression of the red fluorescent marker mCherry in GABAergic DD neurons (flp-13 promoter). pACh::CLA-1::GFP refers to expression of the active zone protein CLA-1 tagged with green fluorescent protein (GFP) in cholinergic neurons (unc-17 beta promoter), including those that are presynaptic to GABAergic DD motor neurons. Representative images of wild type (left) and pat-3(kq8042) mutants (right) are shown. Scale bar, 5 μm. Scatterplots showing the number (F) and size (G) of CLA-1::GFP puncta within a 50 μm anterior most portion of ventral nerve cord. Each dot in F represents a single animal and each dot in G represents one puncta. The number of CLA-1::GFP clusters is decreased and the size of CLA-1::GFP clusters is increased in pat-3(kq8042) animals compared to wild-type controls. ***p<0.0005, Mann Whitney test.
","imageTitle":"
A Y/E substitution in the membrane distal NPxY motif of the cytoplasmic tail of β integrin/pat-3 disrupts dendritic spines
","methods":"Strains
All strains used in these experiments are listed in Table 1. Strains are N2 Bristol strain derivatives (wildtype) and were maintained at room temperature on nematode growth media plates seeded with E. coli strain OP50. Some strains were kindly shared by the Lee lab at Baylor University (Hanna et al., 2020). Transgenic strains were obtained by microinjection to achieve transformation (Mello et al., 1991) and identified by using co-injection markers. Integrated lines were produced with X-ray irradiation and outcrossed to wild type/N2 Bristol eight times. Only larval stage 4 (L4) hermaphrodites were used in this study.
Confocal microscopy and analysis
Animals were immobilized in sodium azide (0.3 M) on a 2% agarose pad. Images of dendrites of the DD1 neuron shown in Panels A, B and D were obtained using a Yokogawa CSU-10 spinning disk confocal system on an upright Olympus BX51WI microscope equipped with a Hammamatsu C9100-13 EMCCD camera and 63X oil immersion objective. A Cobolt Calypso 491 nm laser was used for excitation, and images were acquired using Volocity 4.3 software (Perkin-Elmer). All images were obtained using identical imaging and laser settings. Z stack volumes were acquired using an objective-coupled Piezo. Image analysis was conducted using Fiji software (open source) as described previously (He et al., 2015; Lemons et al., 2024; Oliver et al., 2022; Philbrook et al., 2018). Briefly, spines that were at least 0.2 μm in length were counted within a 15 µm region of interest (ROI) anterior to the DD1 cell soma.
Images in Panel E were obtained on a Yokogawa CSU-Z1 spinning disk confocal mounted on a Nikon NiE upright motorized microscope equipped with a Nikon 60x oil immersion objective and a Prime BSI Express CMOS camera (Teledyne Vision Solutions). Z stack images were acquired using Nikon Elements software, using identical imaging and laser settings. CLA-1::GFP puncta number and size were measured within a 50 µm region of the anterior ventral nerve cord using the analyze particles function in Image J.
","reagents":"Primers used to confirm pat-3 (kq8041), pat-3 (kq8042) and pat-3 (kq8043).
Forward primer OMF 3153 (primer in Exon 7 in pat-3 transcript): ggccacagataatgcaacag. Reverse primer OMF3141: (primer in downstream UTR): acaatttatcgctaaatactcgtt. PCR generated 436bp product. Product was sequenced using forward primer OMF3140 (in exon 7): catgatagatccgaatacgc
Table 1. Worm strains
Strain | Genotype | Description | Plasmid |
IZ3105 | ufIs175 | DD-specific myristoylated GFP transcriptional reporter (green) | pflp-13::myr-GFP (pAP168@30ng/ul), coinjection marker punc-122::GFP (pPD97.98@50ng/ul) |
BU8041 | pat-3(kq8041) | CRISPR engineered pat-3 mutation changes NPVY to NPVA (Hanna et al., 2020) |
|
BU8042 | pat-3(kq8042) | CRISPR engineered pat-3 mutation changes NPVY to NPVE (Hanna et al., 2020) |
|
BU8043 | pat-3(kq8043) | CRISPR engineered pat-3 mutation changes NPVY to NPVF (Hanna et al., 2020) |
|
IZ4167 | pat-3(kq8042); ufIs175 | DD-specific myristoylated GFP transcriptional reporter (green) | pflp-13::myr-GFP (pAP168@30ng/ul), coinjection marker punc-122::GFP (pPD97.98@50ng/ul) |
IZ4225 | pat-3(kq8042); ufIs175 | DD-specific myristoylated GFP transcriptional reporter (green) | pflp-13::myr-GFP (pAP168@30ng/ul), coinjection marker punc-122::GFP (pPD97.98@50ng/ul) |
IZ4226 | pat-3(kq8043); ufIs175 | DD-specific myristoylated GFP transcriptional reporter (green) | pflp-13::myr-GFP (pAP168@30ng/ul), coinjection marker punc-122::GFP (pPD97.98@50ng/ul) |
IZ3973 | ufIs128; ufEx1679 | DD-specific mCherry transcriptional reporter (red), extrachromosomal array with cholinergic promoter driving CLA-1::green fluorescent protein (GFP) expression | punc-17. beta::novoiGFP::cla-1e (pSR58 @30ng/ul), co-injection marker Plgc-11::GFP (pHP6 at 30ng/ul)
|
IZ4598 | pat-3(kq8042); ufIs128; ufEx1679 | DD-specific mCherry transcriptional reporter (red), extrachromosomal array with cholinergic promoter driving CLA-1::green fluorescent protein (GFP) expression | punc-17. beta::novoiGFP::cla-1e (pSR58 @30ng/ul), co-injection marker Plgc-11::GFP (pHP6 at 30ng/ul) |
Synapse formation involves a sequence of carefully orchestrated molecular interactions to concentrate synaptic vesicles and release machinery at precisely defined sites opposite clusters of post-synaptic neurotransmitter receptors (Drapeau et al., 1995; Waites et al., 2005). Many studies have identified shared groups of proteins that form the core pre- and post-synaptic scaffolds, but the events that initiate synapse assembly and maturation often vary at the level of individual neurons and synapses. Mounting evidence indicates that integrin family members have key roles in synapse assembly and maturation (de Wit & Ghosh, 2016; Dityatev et al., 2010; Lilja & Ivaska, 2018; Park & Goda, 2016). Integrins are transmembrane extracellular matrix receptors that function as αβ βheterodimers (Campbell & Humphries, 2011; Giancotti & Ruoslahti, 1999; Hynes, 1992, 2002). Integrins bind a variety of ligands including extracellular matrix, cell adhesion and axon guidance proteins, as well as intracellular signaling machinery such as talin and kindlin (Humphries et al., 2006; Moser et al., 2009; Nakamoto et al., 2004; Sonnenberg, 1993; Ye et al., 2014). At least 24 different integrin combinations are formed from 18α and 8β subunits in mammals, while the invertebrate model C. elegans forms only two integrin heterodimers (Fassler & Meyer, 1995) composed of one α subunit (INA-1 or PAT-2) and a sole β subunit (PAT-3)(Gettner et al., 1995; Kramer, 2005).
Integrin function is greatly influenced by conformational state, integrins shift between low- (inactivated) and high-ligand affinity (activated) states. Integrin activation can be triggered by cytoplasmic signaling, known as “inside-out” activation (Calderwood, 2004a; Ginsberg, 2014; Kim et al., 2011; Liddington & Ginsberg, 2002; Wang, 2012). Inside out activation is associated with molecules containing phosphotyrosine binding (PTB) domains (including talin, kindlin) that interact with cytoplasmic NPxY (asp-pro-x-tyr) motifs in the β integrin cytoplasmic domain (Bumm et al., 2025; Czuchra et al., 2006; Hanna et al., 2020; Jannuzi et al., 2002; Jannuzi et al., 2004; Kaapa et al., 1999; Lee et al., 2001; Sakai et al., 1998). Tyrosine phosphorylation of the NPxY motif regulates the binding of PTB domain containing proteins, implicating NPxY motifs as molecular switches for integrin activation and signaling (Bledzka et al., 2010; Calderwood, 2004a, 2004b; Calderwood et al., 2013; Calderwood et al., 2002; Liddington & Ginsberg, 2002). While null mutations in the gene encoding the C. elegans β integrin pat-3 are lethal, viable CRISPR-engineered mutations targeting the membrane-distal NPXY motif of PAT-3 were recently generated (Bumm et al., 2025; Hanna et al., 2020). Building upon previous studies from our lab and others that implicate integrins in the outgrowth of GABAergic axons (Baum & Garriga, 1997; Chisholm et al., 2016; Forrester & Garriga, 1997; Oliver et al., 2019; Poinat et al., 2002), we sought to employ these NPxY engineered mutants to investigate integrin signaling in the formation of previously characterized dendritic spines in C. elegans GABAergic neurons (Cuentas-Condori et al., 2019; Lemons et al., 2024; Oliver et al., 2022; Oliver et al., 2026; Philbrook et al., 2018).
To investigate the role of integrin activation through the β integrin/PAT-3 NPxY motif in spine outgrowth, we used cell-specific expression of the myristoylated green fluorescent protein (mGFP) to visualize GABAergic dendrites in 3 available strains carrying CRISPR-engineered mutations in the conserved tyrosine residue of the PAT-3 membrane distal NPxY motif: wild type 801NPVY804 to NPVA804 [alanine, pat-3(kq8041)], NPVE804 [glutamate, pat-3(kq8042)], or NPVF804 [phenylalanine, (pat-3(kq8043)] (Bumm et al., 2025; Hanna et al., 2020). Consistent with previous studies (Lemons et al., 2024; Oliver et al., 2022; Philbrook et al., 2018), we observed roughly 8 dendritic spines in a 15 μm region anterior to the DD1 GABAergic neuron of wild-type larval stage 4 (L4) animals (Figure 1A-C). The number of dendritic spines on GABAergic DD1 neurons was significantly reduced by 43±6% in pat-3(kq8042) animals carrying a Y>E substitution (Figure 1B,C). Surprisingly, some spines appeared dorsally rather than ventrally oriented in these animals (Figure 1B, D), suggesting misdirected synapse growth. Substitution of the negatively charged glutamic acid (E) for tyrosine (Y) in pat-3(kq8042) animals is predicted to mimic tyrosine phosphorylation (Anthis et al., 2009; Qiu et al., 2019; Reszka et al., 1992). Our findings suggest that constitutive tyrosine phosphorylation disrupts dendritic spines, perhaps by impacting interactions with kindlin/UNC-112 or other modulators of integrin activation that act through this motif.
To ask whether the effects of the PAT-3 Y/E substitution were specific to the post-synapse or affected both pre- and postsynaptic specializations, we examined the distribution of the GFP-tagged active zone marker CLA-1 (Xuan et al., 2017) in cholinergic neurons, which are presynaptic partners to GABAergic motor neurons. As expected, CLA-1::GFP puncta were observed on the ventral side of ventrally directed spines in the wildtype (Figure 1E), indicating presynaptic specializations opposing the dendritic spines. We found that the number of CLA-1::GFP puncta within a 50 μm region of the anterior ventral nerve cord was significantly decreased in pat-3(kq8042) animals compared to controls (Figure 1F), while the size of CLA-1::GFP puncta slightly increased (Figure 1G). These findings demonstrate that both pre- and postsynaptic specializations are disrupted in pat-3(kq8042) animals.
We next examined dendritic spines in pat-3(kq8041) and pat-3(kq8043) animals. A tyrosine (Y) to phenylalanine substitution (F) in the NPxY motif in pat-3(kq8043) animals is predicted to preserve hydrophobic interactions associated with tyrosine but eliminate phosphorylation, perhaps acting similarly to a non-phosphorylatable tyrosine residue (Chen et al., 2006; Xu et al., 2010). The tyrosine (Y) to alanine substitution (A) in the NPxY motif of pat-3(kq8041) animals is predicted to disrupt interactions requiring the hydrophobic aromatic ring of tyrosine as well as phosphorylation at this site (Chen et al., 2006). Surprisingly, we found that spine number was not significantly different in either of these mutants compared to wild-type animals (Figure 1B,C).
Prior analysis of membrane distal NPxY substitutions revealed that all three substitutions produced defects in the migration of gonadal distal tip cells (Hanna et al., 2020). In contrast, our finding that solely the phosphomimetic Y/E substitution disrupts dendritic spines is more consistent with recent studies of neuronal function in these strains, where the phosphomimetic E substitution produced severe effects, while the A and F substitutions did not (Bumm et al., 2025). Together, our results argue that tyrosine phosphorylation at the distal NPxY motif of PAT-3 is not essential for spine outgrowth, but may instead have a modulatory role, perhaps by influencing integrin interaction with kindlin/UNC-112.
","references":[{"reference":"Anthis NJ, Haling JR, Oxley CL, Memo M, Wegener KL, Lim CJ, Ginsberg MH, Campbell ID. 2009. Beta integrin tyrosine phosphorylation is a conserved mechanism for regulating talin-induced integrin activation. J Biol Chem 284(52): 36700-36710.
","pubmedId":"19843520","doi":""},{"reference":"Baum PD, Garriga G. 1997. Neuronal migrations and axon fasciculation are disrupted in ina-1 integrin mutants. Neuron. 19: 51-62. 1047.","pubmedId":"9247263","doi":""},{"reference":"Bledzka K, Bialkowska K, Nie H, Qin J, Byzova T, Wu C, Plow EF, Ma YQ. 2010. Tyrosine phosphorylation of integrin beta3 regulates kindlin-2 binding and integrin activation. J Biol Chem 285(40): 30370-4.
","pubmedId":"20702409","doi":""},{"reference":"Bumm JH, Lee DD, Qiu Z, Choi AH, Kolluri M, Olsen MJ, Wang L, Lee M. 2025. The beta integrin modulates serotonin sensitivity via NPxY motifs to regulate egg laying and mechanosensation behaviors in Caenorhabditis elegans. Dev Dyn 1442.","pubmedId":"41117756","doi":"10.1002/dvdy.70090"},{"reference":"Calderwood DA. 2004. Talin controls integrin activation. Biochem Soc Trans. 32: 434-7. 675.","pubmedId":"15157154","doi":"10.1042/BST0320434"},{"reference":"Calderwood DA. 2004. Integrin activation. J Cell Sci. 117: 657-66. 676.","pubmedId":"14754902","doi":"10.1242/jcs.01014"},{"reference":"Calderwood DA, Campbell ID, Critchley DR. 2013. Talins and kindlins: partners in integrin-mediated adhesion. Nat Rev Mol Cell Biol 14(8): 503-17.
","pubmedId":"23860236","doi":""},{"reference":"Calderwood DA, Yan B, de Pereda JM, Alvarez BG, Fujioka Y, Liddington RC, Ginsberg MH. 2002. The phosphotyrosine binding-like domain of talin activates integrins. J Biol Chem 277(24): 21749-58.
","pubmedId":"11932255","doi":""},{"reference":"Campbell ID, Humphries MJ. 2011. Integrin structure, activation, and interactions. Cold Spring Harb Perspect Biol 3(3): 10.1101/cshperspect.a004994.
","pubmedId":"21421922","doi":""},{"reference":"Chen H, Zou Z, Sarratt KL, Zhou D, Zhang M, Sebzda E, Hammer DA, Kahn ML. 2006. In vivo beta1 integrin function requires phosphorylation-independent regulation by cytoplasmic tyrosines. Genes Dev 20(8): 927-32.
","pubmedId":"16618804","doi":""},{"reference":"Chisholm AD, Hutter H, Jin Y, Wadsworth WG. 2016. The Genetics of Axon Guidance and Axon Regeneration in Caenorhabditis elegans. Genetics. 204: 849-882. 1406.","pubmedId":"28114100","doi":"10.1534/genetics.115.186262"},{"reference":"Cuentas-Condori A, Mulcahy B, He S, Palumbos S, Zhen M, Miller DM 3rd. 2019. C. elegans neurons have functional dendritic spines. Elife 8: 10.7554/eLife.47918.
","pubmedId":"31584430","doi":""},{"reference":"Czuchra A, Meyer H, Legate KR, Brakebusch C, Fässler R. 2006. Genetic analysis of beta1 integrin \"activation motifs\" in mice. J Cell Biol 174(6): 889-99.
","pubmedId":"16954348","doi":""},{"reference":"de Wit J, Ghosh A. 2016. Specification of synaptic connectivity by cell surface interactions. Nat Rev Neurosci 17(1): 22-35.
","pubmedId":"26656254","doi":""},{"reference":"Dityatev A, Schachner M, Sonderegger P. 2010. The dual role of the extracellular matrix in synaptic plasticity and homeostasis. Nat Rev Neurosci. 11: 735-46. 1242.","pubmedId":"20944663","doi":"10.1038/nrn2898"},{"reference":"Drapeau P, Catarsi S, Merz DC. 1995. Signalling synapse formation between identified neurons. J Physiol Paris 89(3): 115-23.
","pubmedId":"7581300","doi":""},{"reference":"Fässler R, Meyer M. 1995. Consequences of lack of beta 1 integrin gene expression in mice. Genes Dev 9(15): 1896-908.
","pubmedId":"7544313","doi":""},{"reference":"Forrester WC, Garriga G. 1997. Genes necessary for C. elegans cell and growth cone migrations. Development. 124: 1831-43. 1053.","pubmedId":"9165130","doi":""},{"reference":"Gettner SN, Kenyon C, Reichardt LF. 1995. Characterization of beta pat-3 heterodimers, a family of essential integrin receptors in C. elegans. J Cell Biol. 129: 1127-41. 1080.","pubmedId":"7744961","doi":""},{"reference":"Giancotti FG, Ruoslahti E. 1999. Integrin signaling. Science. 285: 1028-32. 363.","pubmedId":"10446041","doi":""},{"reference":"Ginsberg MH. 2014. Integrin activation. BMB Rep. 47: 655-9. 1163.","pubmedId":"25388208","doi":""},{"reference":"Hanna J, Ramani S, Williams T, Anaya R, Campion N, Lopez E, et al., Lee M. 2020. Three alleles in the pat-3 locus of Caenorhabditis elegans: mutations in the membrane-distal NPxY phosphotyrosine motif. MicroPubl Biol. 2020 1441.","pubmedId":"32821887","doi":"10.17912/micropub.biology.000291"},{"reference":"He S, Philbrook A, Mc Whirter R, Gabel CV, Taub DG, Carter MH, et al., Miller DM. 2015. Transcriptional Control of Synaptic Remodeling through Regulated Expression of an Immunoglobulin Superfamily Protein. Curr Biol. 25: 2541-8. 1161.","pubmedId":"26387713","doi":"10.1016/j.cub.2015.08.022"},{"reference":"Humphries JD, Byron A, Humphries MJ. 2006. Integrin ligands at a glance. J Cell Sci. 119: 3901-3. 856.","pubmedId":"16988024","doi":"119/19/3901 [pii] 10.1242/jcs.03098"},{"reference":"Hynes RO. 1992. Integrins: versatility, modulation, and signaling in cell adhesion. Cell. 69: 11-25.. 97.","pubmedId":"","doi":""},{"reference":"Hynes RO. 2002. Integrins: bidirectional, allosteric signaling machines. Cell. 110: 673-87. 865.","pubmedId":"12297042","doi":"S0092867402009716"},{"reference":"Jannuzi AL, Bunch TA, Brabant MC, Miller SW, Mukai L, Zavortink M, Brower DL. 2002. Disruption of C-terminal cytoplasmic domain of betaPS integrin subunit has dominant negative properties in developing Drosophila. Mol Biol Cell 13(4): 1352-65.
","pubmedId":"11950944","doi":""},{"reference":"Jannuzi AL, Bunch TA, West RF, Brower DL. 2004. Identification of integrin beta subunit mutations that alter heterodimer function in situ. Mol Biol Cell 15(8): 3829-40.
","pubmedId":"15194810","doi":""},{"reference":"Kääpä A, Peter K, Ylänne J. 1999. Effects of mutations in the cytoplasmic domain of integrin beta(1) to talin binding and cell spreading. Exp Cell Res 250(2): 524-34.
","pubmedId":"10413605","doi":""},{"reference":"Kim C, Ye F, Ginsberg MH. 2011. Regulation of integrin activation. Annu Rev Cell Dev Biol. 27: 321-45. 1152.","pubmedId":"21663444","doi":"10.1146/annurev-cellbio-100109-104104"},{"reference":"Kramer JM. 2005. Basement membranes. WormBook: 1-15.
","pubmedId":"18050423","doi":""},{"reference":"Lee M, Cram EJ, Shen B, Schwarzbauer JE. 2001. Roles for beta(pat-3) integrins in development and function of Caenorhabditis elegans muscles and gonads. J Biol Chem. 276: 36404-10. 1167.","pubmedId":"11473126","doi":"10.1074/jbc.M105795200"},{"reference":"Lemons L M, McKillop H, Genao N, Francis M M. 2024. The extracellular matrix molecule Collagen XVIII/CLE-1 affects neuronal dendritic spines. MicroPubl Biol 2024: 10.17912/micropub.biology.001331.
","pubmedId":"39568805","doi":""},{"reference":"Liddington RC, Ginsberg MH. 2002. Integrin activation takes shape. J Cell Biol. 158: 833-9. 688.","pubmedId":"12213832","doi":"10.1083/jcb.200206011 cb.200206011 [pii]"},{"reference":"Lilja J, Ivaska J. 2018. Integrin activity in neuronal connectivity. J Cell Sci 131(12): pii: jcs212803. 10.1242/jcs.212803.
","pubmedId":"29907643","doi":""},{"reference":"Mello CC, Kramer JM, Stinchcomb D, Ambros V. 1991. Efficient gene transfer in C.elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J. 10: 3959-70. 1413.","pubmedId":"1935914","doi":""},{"reference":"Moser M, Legate KR, Zent R, Fassler R. 2009. The tail of integrins, talin, and kindlins. Science. 324: 895-9. 689.","pubmedId":"19443776","doi":"324/5929/895 [pii]10.1126/science.1163865"},{"reference":"Nakamoto T, Kain KH, Ginsberg MH. 2004. Neurobiology: New connections between integrins and axon guidance. Curr Biol. 14: R121-3. 412.","pubmedId":"14986683","doi":""},{"reference":"Oliver D, Norman E, Bates H, Avard R, Rettler M, Bénard CY, Francis MM, Lemons ML. 2019. Integrins Have Cell-Type-Specific Roles in the Development of Motor Neuron Connectivity. J Dev Biol 7(3): 10.3390/jdb7030017.
","pubmedId":"31461926","doi":""},{"reference":"Oliver D, Ramachandran S, Philbrook A, Lambert CM, Nguyen KCQ, Hall DH, Francis MM. 2022. Kinesin-3 mediated axonal delivery of presynaptic neurexin stabilizes dendritic spines and postsynaptic components. PLoS Genet 18(1): e1010016.
","pubmedId":"35089924","doi":""},{"reference":"Oliver DB, Ramachandran S, Biswas K, Bénard CY, Doitsidou M, McKillop H, et al., Francis MM. 2026. Genome-wide analysis reveals pathways important for the development and maturation of excitatory synaptic connections to GABAergic neurons. G3 (Bethesda) 16(4): 10.1093/g3journal/jkag028.
","pubmedId":"41655250","doi":""},{"reference":"Park YK, Goda Y. 2016. Integrins in synapse regulation. Nat Rev Neurosci. 17: 745-756. 1226.","pubmedId":"27811927","doi":"10.1038/nrn.2016.138"},{"reference":"Philbrook A, Ramachandran S, Lambert CM, Oliver D, Florman J, Alkema MJ, Lemons M, Francis MM. 2018. Neurexin directs partner-specific synaptic connectivity in C. elegans. Elife. 7 1401.","pubmedId":"30039797","doi":"10.7554/eLife.35692"},{"reference":"Poinat P, De Arcangelis A, Sookhareea S, Zhu X, Hedgecock EM, Labouesse M, Georges Labouesse E. 2002. A conserved interaction between beta1 integrin/PAT-3 and Nck-interacting kinase/MIG-15 that mediates commissural axon navigation in C. elegans. Curr Biol. 12: 622-31. 1055.","pubmedId":"11967148","doi":""},{"reference":"Sonnenberg A. 1993. Integrins and their ligands. Curr Top Microbiol Immunol. 184: 7-35. 1414.","pubmedId":"8313723","doi":""},{"reference":"Qiu Z, Sheesley P, Ahn JH, Yu EJ, Lee M. 2019. A Novel Mutation in an NPXY Motif of β Integrin Reveals Phenotypes Similar to him-4/hemicentin. Front Cell Dev Biol 7: 247.
","pubmedId":"31720287","doi":""},{"reference":"Reszka AA, Hayashi Y, Horwitz AF. 1992. Identification of amino acid sequences in the integrin beta 1 cytoplasmic domain implicated in cytoskeletal association. J Cell Biol 117(6): 1321-30.
","pubmedId":"1376731","doi":""},{"reference":"Sakai T, Zhang Q, Fässler R, Mosher DF. 1998. Modulation of beta1A integrin functions by tyrosine residues in the beta1 cytoplasmic domain. J Cell Biol 141(2): 527-38.
","pubmedId":"9548729","doi":""},{"reference":"Waites CL, Craig AM, Garner CC. 2005. Mechanisms of vertebrate synaptogenesis. Annu Rev Neurosci 28: 251-74.
","pubmedId":"16022596","doi":""},{"reference":"Wang JH. 2012. Pull and push: talin activation for integrin signaling. Cell Res 22(11): 1512-4.
","pubmedId":"22777425","doi":""},{"reference":"Xu X, Ahn JH, Tam P, Yu EJ, Batra S, Cram EJ, Lee M. 2010. Analysis of conserved residues in the betapat-3 cytoplasmic tail reveals important functions of integrin in multiple tissues. Dev Dyn 239(3): 763-72.
","pubmedId":"20063417","doi":""},{"reference":"Xuan Z, Manning L, Nelson J, Richmond JE, Colón-Ramos DA, Shen K, Kurshan PT. 2017. Clarinet (CLA-1), a novel active zone protein required for synaptic vesicle clustering and release. Elife 6: 10.7554/eLife.29276.
","pubmedId":"29160205","doi":""},{"reference":"Ye F, Snider AK, Ginsberg MH. 2014. Talin and kindlin: the one-two punch in integrin activation. Front Med 8(1): 6-16.
","pubmedId":"24477625","doi":""}],"title":"A mutation in the conserved NPxY motif of β integrin PAT-3 alters outgrowth of neuronal dendritic spines
","reviews":[{"reviewer":{"displayName":"Kota Mizumoto"},"openAcknowledgement":false,"status":{"submitted":true}}],"curatorReviews":[{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null}]},{"id":"25659643-31ae-405d-9bc7-9fb332428147","decision":"revise","abstract":"Integrins are heterodimeric transmembrane receptors that are critical in many biological processes, including neuronal development. Here we investigate integrin signaling in the outgrowth of dendritic spines on C. elegans GABAergic neurons using mutations engineered within the membrane-distal NPxY motif of the β integrin subunit PAT-3. We found a Y/E substitution, but not Y/A or Y/F substitutions, reduced dendritic spine number and misoriented spines. The Y/E substitution in the NPxY motif also altered the distribution of the presynaptic scaffold CLA-1, suggesting roles in both pre- and postsynaptic development. Our findings implicate integrin activation through the NPxY motif in synapse formation/maturation.
","acknowledgements":"We thank Dr. Shankar Ramachandran for technical assistance. We also thank Emily Norman for helpful comments and suggestions.
","authors":[{"affiliations":["Assumption University","University of Massachusetts Chan Medical School"],"departments":["Biological and Physical Sciences","Neurobiology"],"credit":["conceptualization","investigation","fundingAcquisition","supervision","writing_originalDraft","methodology","dataCuration","formalAnalysis"],"email":"mlemons@assumption.edu","firstName":"Michele L","lastName":"Lemons","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-8459-4130"},{"affiliations":["Assumption University"],"departments":["Biological and Physical Sciences"],"credit":["dataCuration","visualization","investigation"],"email":"Noelia.GenaoGarcia@umassmed.edu","firstName":"Noelia","lastName":"Genao","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0007-1611-452X"},{"affiliations":["Assumption University"],"departments":["Biological and Physical Sciences"],"credit":["investigation","validation","visualization","dataCuration"],"email":"hailey.mckillop@umassmed.edu","firstName":"Hailey","lastName":"McKillop","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0001-5582-6964"},{"affiliations":["University of Massachusetts Chan Medical School"],"departments":["Neurobiology"],"credit":["conceptualization","methodology","project","supervision","writing_reviewEditing","fundingAcquisition","investigation","resources"],"email":"michael.francis@umassmed.edu","firstName":"Michael M","lastName":"Francis","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-8076-6668"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work was supported by a collaborative RUI grant from the National Science Foundation, Division of Integrative Organismal Systems IOS1754986 (M.L.L.) and IOS1755019 (M.M.F.)
","image":{"url":"https://portal.micropublication.org/uploads/7280e660e59ce41f5cad570b8de5cb52.png"},"imageCaption":"A) Maximum projection confocal image of the C. elegans GABAergic DD1 neuron dendritic shaft (inverted LUT grey scale) labeled by transcriptional expression of myristoylated GFP (myrGFP). pGABA::myrGFP in top image refers to cell specific transcriptional expression of myrGFP in DD GABAergic neurons using the flp-13 promoter. Bottom panel is a cartoon representation of the top image and includes red carets pointing to ventrally directed spines protruding from the dendritic shaft. All images are from larval stage 4 animals and oriented with anterior to the left and ventral towards the bottom, as indicated by arrows. Scale bar, 5 μm. B) Inverted maximal projection images showing DD1 dendritic spines of wildtype, pat-3(kq8041), pat-3(kq8042) and pat-3(kq8043) animals. Scale bar, 5 μm. C) Scatterplot of the total number of spines within a 15 μm region of DD1 neurons in wild-type animals and pat-3 mutants. The number of spines in pat-3(kq8042) animals is significantly decreased compared to wildtype, pat-3(kq8041), and pat-3(kq8043) animals. Each data point represents a measurement from an independent animal. Red horizontal bar indicates the mean. *p<0.05, **p<0.005, *** p<0.0005, Kruskal Wallis test. D) Number of dorsally directed spines per animal shown as a scatterplot. Dorsally directed spines are significantly increased in pat-3(kq8042) compared to wild type. Red horizontal bar indicates the mean. Inset image of pat-3(kq8042) animal with carets pointing to dorsally directed spines. *p<0.05, **p<0.005, ***p<0.0005, Kruskal Wallis test. Scale bar, 2 μm. E) Maximum projection confocal images of C. elegans GABAergic DD1 neuron dendritic shaft and spines (red) and presynaptic protein CLA-1 (green). pGABA::mCherry refers to transgenic expression of the red fluorescent marker mCherry in GABAergic DD neurons (flp-13 promoter). pACh::CLA-1::GFP refers to expression of the active zone protein CLA-1 tagged with green fluorescent protein (GFP) in cholinergic neurons (unc-17 beta promoter), including those that are presynaptic to GABAergic DD motor neurons. Representative images of wild type (left) and pat-3(kq8042) mutants (right) are shown. Scale bar, 5 μm. Scatterplots showing the average number (F) and size (G) of CLA-1::GFP puncta per animal within a 50 μm anterior most portion of ventral nerve cord. Each dot represents a single animal. The number of CLA-1::GFP clusters is decreased and the size of CLA-1::GFP clusters is increased in pat-3(kq8042) animals compared to wild-type controls. ***p<0.0005, **p<0.005, Mann Whitney test.
","imageTitle":"
A Y/E substitution in the membrane distal NPxY motif of the cytoplasmic tail of β integrin/pat-3 disrupts dendritic spines
","methods":"Strains
All strains used in these experiments are listed in Table 1. Strains are N2 Bristol strain derivatives (wildtype) and were maintained at room temperature on nematode growth media plates seeded with E. coli strain OP50. Some strains were kindly shared by the Lee lab at Baylor University (Hanna et al., 2020). Transgenic strains were obtained by microinjection to achieve transformation (Mello et al., 1991) and identified by using co-injection markers. Integrated lines were produced with X-ray irradiation and outcrossed to wild type/N2 Bristol eight times. Only larval stage 4 (L4) hermaphrodites were used in this study.
Confocal microscopy and analysis
Animals were immobilized in sodium azide (0.3 M) on a 2% agarose pad. Images of dendrites of the DD1 neuron shown in Panels A, B and D were obtained using a Yokogawa CSU-10 spinning disk confocal system on an upright Olympus BX51WI microscope equipped with a Hammamatsu C9100-13 EMCCD camera and 63X oil immersion objective. A Cobolt Calypso 491 nm laser was used for excitation, and images were acquired using Volocity 4.3 software (Perkin-Elmer). All images were obtained using identical imaging and laser settings. Z stack volumes were acquired using an objective-coupled Piezo. Image analysis was conducted using Fiji software (open source) as described previously (He et al., 2015; Lemons et al., 2024; Oliver et al., 2022; Philbrook et al., 2018). Briefly, spines that were at least 0.2 μm in length were counted within a 15 µm region of interest (ROI) anterior to the DD1 cell soma.
Images in Panel E were obtained on a Yokogawa CSU-Z1 spinning disk confocal mounted on a Nikon NiE upright motorized microscope equipped with a Nikon 60x oil immersion objective and a Prime BSI Express CMOS camera (Teledyne Vision Solutions). Z stack images were acquired using Nikon Elements software, using identical imaging and laser settings. CLA-1::GFP puncta number and size were measured within a 50 µm region of the anterior ventral nerve cord using the analyze particles function in Image J.
","reagents":"Primers used to confirm pat-3 (kq8041), pat-3 (kq8042) and pat-3 (kq8043).
Forward primer OMF 3153 (primer in Exon 7 in pat-3 transcript): ggccacagataatgcaacag. Reverse primer OMF3141: (primer in downstream UTR): acaatttatcgctaaatactcgtt. PCR generated 436bp product. Product was sequenced using forward primer OMF3140 (in exon 7): catgatagatccgaatacgc
Table 1. Worm strains
Strain | Genotype | Description | Plasmid |
DD-specific myristoylated (myr) GFP transcriptional reporter (green) | Pflp-13:: myrGFP (pAP168@30ng/ul), coinjection marker Punc-122::GFP (pPD97.98@50ng/ul) | ||
CRISPR engineered pat-3 mutation changes NPVY to NPVA (Hanna et al., 2020) |
| ||
CRISPR engineered pat-3 mutation changes NPVY to NPVE (Hanna et al., 2020) |
| ||
CRISPR engineered pat-3 mutation changes NPVY to NPVF (Hanna et al., 2020) |
| ||
DD-specific myrGFP transcriptional reporter (green) | Pflp-13::myrGFP (pAP168@30ng/ul), coinjection marker Punc-122::GFP (pPD97.98@50ng/ul) | ||
DD-specific myrGFP transcriptional reporter (green) | Pflp-13::myrGFP (pAP168@30ng/ul), coinjection marker Punc-122::GFP (pPD97.98@50ng/ul) | ||
DD-specific myrGFP transcriptional reporter (green) | Pflp-13:: myrGFP (pAP168@30ng/ul), coinjection marker Punc-122::GFP (pPD97.98@50ng/ul) | ||
DD-specific mCherry transcriptional reporter (red), extrachromosomal array with cholinergic promoter driving CLA-1::green fluorescent protein (GFP) expression | Punc-17β::GFPnovo2::cla-1 (pSR58 @30ng/ul), co-injection marker Plgc-11::GFP (pHP6 at 30ng/ul)
| ||
DD-specific mCherry transcriptional reporter (red), extrachromosomal array with cholinergic promoter driving CLA-1::green fluorescent protein (GFP) expression | Punc-17β::GFPnovo2::cla-1 (pSR58 @30ng/ul), co-injection marker Plgc-11::GFP (pHP6 at 30ng/ul) |
Synapse formation involves a sequence of carefully orchestrated molecular interactions to concentrate synaptic vesicles and release machinery at precisely defined sites opposite clusters of post-synaptic neurotransmitter receptors (Drapeau et al., 1995; Waites et al., 2005). Many studies have identified shared groups of proteins that form the core pre- and post-synaptic scaffolds, but the events that initiate synapse assembly and maturation often vary at the level of individual neurons and synapses. Mounting evidence indicates that integrin family members have key roles in synapse assembly and maturation (de Wit & Ghosh, 2016; Dityatev et al., 2010; Lilja & Ivaska, 2018; Park & Goda, 2016). Integrins are transmembrane extracellular matrix receptors that function as αβ heterodimers (Campbell & Humphries, 2011; Giancotti & Ruoslahti, 1999; Hynes, 1992, 2002). Integrins bind a variety of ligands including extracellular matrix, cell adhesion and axon guidance proteins, as well as intracellular signaling machinery such as talin and kindlin (Humphries et al., 2006; Moser et al., 2009; Nakamoto et al., 2004; Sonnenberg, 1993; Ye et al., 2014). At least 24 different integrin combinations are formed from 18 α and 8 β subunits in mammals, while the invertebrate model C. elegans forms only two integrin heterodimers (Fassler & Meyer, 1995) composed of one α subunit (INA-1 or PAT-2) and a sole β subunit (PAT-3)(Gettner et al., 1995; Kramer, 2005).
Integrin function is greatly influenced by conformational state, integrins shift between low- (inactivated) and high-ligand affinity (activated) states. Integrin activation can be triggered by cytoplasmic signaling, known as “inside-out” activation (Calderwood, 2004a; Ginsberg, 2014; Kim et al., 2011; Liddington & Ginsberg, 2002; Wang, 2012). Inside-out activation is mediated through interactions between phosphotyrosine binding (PTB) domain proteins (including talin, kindlin) and cytoplasmic NPxY (asp-pro-x-tyr) motifs in the β integrin cytoplasmic domain (Bumm et al., 2025; Czuchra et al., 2006; Hanna et al., 2020; Jannuzi et al., 2002; Jannuzi et al., 2004; Kaapa et al., 1999; Lee et al., 2001; Sakai et al., 1998). The cytoplasmic tail of β integrin has two NPxY motifs, the membrane-proximal motif is proposed to interact with talin while the membrane-distal motif has been shown to interact with kindlin (Morse et al., 2014). Tyrosine phosphorylation of the NPxY motifs regulates the binding of PTB domain containing proteins, implicating NPxY motifs as molecular switches for integrin activation and signaling (Bledzka et al., 2010; Calderwood, 2004a, 2004b; Calderwood et al., 2013; Calderwood et al., 2002; Liddington & Ginsberg, 2002). While null mutations in the gene encoding the C. elegans β integrin pat-3 are lethal, viable CRISPR-engineered mutations targeting the membrane-distal NPXY motif of PAT-3 were recently generated (Bumm et al., 2025; Hanna et al., 2020). Building upon previous studies from our lab and others that implicate integrins in the outgrowth of GABAergic axons (Baum & Garriga, 1997; Chisholm et al., 2016; Forrester & Garriga, 1997; Oliver et al., 2019; Poinat et al., 2002), we sought to employ these NPxY engineered mutants to investigate integrin signaling in the formation of previously characterized dendritic spines in C. elegans GABAergic neurons (Cuentas-Condori et al., 2019; Lemons et al., 2024; Oliver et al., 2022; Oliver et al., 2026; Philbrook et al., 2018).
To investigate the role of integrin activation through the β integrin/PAT-3 NPxY motif in spine outgrowth, we used cell-specific expression of myristoylated green fluorescent protein (myrGFP) to visualize GABAergic dendrites in 3 available strains carrying CRISPR-engineered mutations in the conserved tyrosine residue of the PAT-3 membrane distal NPxY motif: wild type 801NPVY804 to NPVA804 [alanine, pat-3(kq8041)], NPVE804 [glutamate, pat-3(kq8042)], or NPVF804 [phenylalanine, (pat-3(kq8043)] (Bumm et al., 2025; Hanna et al., 2020). These mutations are expected to disrupt the tyrosine residue (A), mimic tyrosine phosphorylation (E), or mimic non-phosphorylatable tyrosine (F), respectively. Consistent with previous studies (Lemons et al., 2024; Oliver et al., 2022; Philbrook et al., 2018), we observed roughly 8 dendritic spines in a 15 μm region anterior to the DD1 GABAergic neuron of wild-type larval stage 4 (L4) animals (Figure 1A-C). The number of dendritic spines on GABAergic DD1 neurons was significantly reduced by 43±6% in pat-3(kq8042) animals carrying a Y>E substitution (Figure 1B,C). Surprisingly, some spines appeared dorsally rather than ventrally oriented in these animals (Figure 1B, D), suggesting either misdirected spine growth or the possibility of ectopic synaptic contacts. Substitution of the negatively charged glutamic acid (E) for tyrosine (Y) in pat-3(kq8042) animals is predicted to mimic tyrosine phosphorylation (Anthis et al., 2009; Qiu et al., 2019; Reszka et al., 1992). Previous studies suggest phosphorylation of the distal NPxY motif disrupts kindlin binding, therefore disabling kindlin's ability to co-activate integrin (Bledzka et al., 2010; Harburger et al., 2009). Our findings suggest that constitutive tyrosine phosphorylation disrupts dendritic spines, perhaps by impacting interactions with kindlin/UNC-112 or other modulators of integrin activation that act through this motif.
To ask whether the effects of the PAT-3 Y/E substitution were specific to the post-synapse or affected both pre- and postsynaptic specializations, we examined the distribution of the GFP-tagged active zone marker CLA-1 (Xuan et al., 2017) in cholinergic neurons, which are presynaptic partners to GABAergic motor neurons. As expected, CLA-1::GFP puncta were observed on the ventral side of ventrally directed spines in wild-type controls (Figure 1E), indicating presynaptic specializations opposing the dendritic spines. We found that the number of CLA-1::GFP puncta within a 50 μm region of the anterior ventral nerve cord was significantly decreased in pat-3(kq8042) animals compared to controls (Figure 1F), while the size of CLA-1::GFP puncta slightly increased (Figure 1G). These findings demonstrate that both pre- and postsynaptic specializations are disrupted in pat-3(kq8042) animals.
We next examined dendritic spines in pat-3(kq8041) and pat-3(kq8043) animals. A tyrosine (Y) to phenylalanine substitution (F) in the NPxY motif in pat-3(kq8043) animals is predicted to preserve hydrophobic interactions associated with tyrosine but eliminate phosphorylation, perhaps acting similarly to a non-phosphorylatable tyrosine residue (Chen et al., 2006; Xu et al., 2010). The tyrosine (Y) to alanine substitution (A) in the NPxY motif of pat-3(kq8041) animals is predicted to disrupt interactions requiring the hydrophobic aromatic ring of tyrosine as well as phosphorylation at this site (Chen et al., 2006). Surprisingly, we found that spine number was not significantly different in either of these mutants compared to wild-type animals (Figure 1B,C). Although work to date suggests the membrane-proximal and -distal NPxY motifs have independent binding partners, we can't rule out the possibility that redundancy across the motifs contributes to these findings.
Prior analysis of membrane distal NPxY substitutions revealed that all three substitutions produced defects in the migration of gonadal distal tip cells (Hanna et al., 2020). In contrast, our finding that solely the phosphomimetic Y/E substitution disrupts dendritic spines is more consistent with recent studies of neuronal function in these strains, where the phosphomimetic E substitution produced severe effects, while the A and F substitutions did not (Bumm et al., 2025). Together, our results argue that tyrosine phosphorylation at the distal NPxY motif of PAT-3 is not essential for spine outgrowth, but may instead have a modulatory role, perhaps by influencing integrin interaction with kindlin/UNC-112 (Bledzka et al., 2010; Qadota et al., 2012).
","references":[{"reference":"Anthis NJ, Haling JR, Oxley CL, Memo M, Wegener KL, Lim CJ, Ginsberg MH, Campbell ID. 2009. Beta integrin tyrosine phosphorylation is a conserved mechanism for regulating talin-induced integrin activation. J Biol Chem 284(52): 36700-36710.
","pubmedId":"19843520","doi":""},{"reference":"Baum PD, Garriga G. 1997. Neuronal migrations and axon fasciculation are disrupted in ina-1 integrin mutants. Neuron. 19: 51-62. 1047.","pubmedId":"9247263","doi":""},{"reference":"Bledzka K, Bialkowska K, Nie H, Qin J, Byzova T, Wu C, Plow EF, Ma YQ. 2010. Tyrosine phosphorylation of integrin beta3 regulates kindlin-2 binding and integrin activation. J Biol Chem 285(40): 30370-4.
","pubmedId":"20702409","doi":""},{"reference":"Bumm JH, Lee DD, Qiu Z, Choi AH, Kolluri M, Olsen MJ, Wang L, Lee M. 2025. The beta integrin modulates serotonin sensitivity via NPxY motifs to regulate egg laying and mechanosensation behaviors in Caenorhabditis elegans. Dev Dyn 1442.","pubmedId":"41117756","doi":"10.1002/dvdy.70090"},{"reference":"Calderwood DA. 2004. Talin controls integrin activation. Biochem Soc Trans. 32: 434-7. 675.","pubmedId":"15157154","doi":"10.1042/BST0320434"},{"reference":"Calderwood DA. 2004. Integrin activation. J Cell Sci. 117: 657-66. 676.","pubmedId":"14754902","doi":"10.1242/jcs.01014"},{"reference":"Calderwood DA, Campbell ID, Critchley DR. 2013. Talins and kindlins: partners in integrin-mediated adhesion. Nat Rev Mol Cell Biol 14(8): 503-17.
","pubmedId":"23860236","doi":""},{"reference":"Calderwood DA, Yan B, de Pereda JM, Alvarez BG, Fujioka Y, Liddington RC, Ginsberg MH. 2002. The phosphotyrosine binding-like domain of talin activates integrins. J Biol Chem 277(24): 21749-58.
","pubmedId":"11932255","doi":""},{"reference":"Campbell ID, Humphries MJ. 2011. Integrin structure, activation, and interactions. Cold Spring Harb Perspect Biol 3(3): 10.1101/cshperspect.a004994.
","pubmedId":"21421922","doi":""},{"reference":"Chen H, Zou Z, Sarratt KL, Zhou D, Zhang M, Sebzda E, Hammer DA, Kahn ML. 2006. In vivo beta1 integrin function requires phosphorylation-independent regulation by cytoplasmic tyrosines. Genes Dev 20(8): 927-32.
","pubmedId":"16618804","doi":""},{"reference":"Chisholm AD, Hutter H, Jin Y, Wadsworth WG. 2016. The Genetics of Axon Guidance and Axon Regeneration in Caenorhabditis elegans. Genetics. 204: 849-882. 1406.","pubmedId":"28114100","doi":"10.1534/genetics.115.186262"},{"reference":"Cuentas-Condori A, Mulcahy B, He S, Palumbos S, Zhen M, Miller DM 3rd. 2019. C. elegans neurons have functional dendritic spines. Elife 8: 10.7554/eLife.47918.
","pubmedId":"31584430","doi":""},{"reference":"Czuchra A, Meyer H, Legate KR, Brakebusch C, Fässler R. 2006. Genetic analysis of beta1 integrin \"activation motifs\" in mice. J Cell Biol 174(6): 889-99.
","pubmedId":"16954348","doi":""},{"reference":"de Wit J, Ghosh A. 2016. Specification of synaptic connectivity by cell surface interactions. Nat Rev Neurosci 17(1): 22-35.
","pubmedId":"26656254","doi":""},{"reference":"Dityatev A, Schachner M, Sonderegger P. 2010. The dual role of the extracellular matrix in synaptic plasticity and homeostasis. Nat Rev Neurosci. 11: 735-46. 1242.","pubmedId":"20944663","doi":"10.1038/nrn2898"},{"reference":"Drapeau P, Catarsi S, Merz DC. 1995. Signalling synapse formation between identified neurons. J Physiol Paris 89(3): 115-23.
","pubmedId":"7581300","doi":""},{"reference":"Fässler R, Meyer M. 1995. Consequences of lack of beta 1 integrin gene expression in mice. Genes Dev 9(15): 1896-908.
","pubmedId":"7544313","doi":""},{"reference":"Forrester WC, Garriga G. 1997. Genes necessary for C. elegans cell and growth cone migrations. Development. 124: 1831-43. 1053.","pubmedId":"9165130","doi":""},{"reference":"Gettner SN, Kenyon C, Reichardt LF. 1995. Characterization of beta pat-3 heterodimers, a family of essential integrin receptors in C. elegans. J Cell Biol. 129: 1127-41. 1080.","pubmedId":"7744961","doi":""},{"reference":"Giancotti FG, Ruoslahti E. 1999. Integrin signaling. Science. 285: 1028-32. 363.","pubmedId":"10446041","doi":""},{"reference":"Ginsberg MH. 2014. Integrin activation. BMB Rep. 47: 655-9. 1163.","pubmedId":"25388208","doi":""},{"reference":"Hanna J, Ramani S, Williams T, Anaya R, Campion N, Lopez E, et al., Lee M. 2020. Three alleles in the pat-3 locus of Caenorhabditis elegans: mutations in the membrane-distal NPxY phosphotyrosine motif. MicroPubl Biol. 2020 1441.","pubmedId":"32821887","doi":"10.17912/micropub.biology.000291"},{"reference":"He S, Philbrook A, Mc Whirter R, Gabel CV, Taub DG, Carter MH, et al., Miller DM. 2015. Transcriptional Control of Synaptic Remodeling through Regulated Expression of an Immunoglobulin Superfamily Protein. Curr Biol. 25: 2541-8. 1161.","pubmedId":"26387713","doi":"10.1016/j.cub.2015.08.022"},{"reference":"Humphries JD, Byron A, Humphries MJ. 2006. Integrin ligands at a glance. J Cell Sci. 119: 3901-3. 856.","pubmedId":"16988024","doi":"119/19/3901 [pii] 10.1242/jcs.03098"},{"reference":"Hynes RO. 1992. Integrins: versatility, modulation, and signaling in cell adhesion. Cell. 69: 11-25.. 97.","pubmedId":"","doi":""},{"reference":"Hynes RO. 2002. Integrins: bidirectional, allosteric signaling machines. Cell. 110: 673-87. 865.","pubmedId":"12297042","doi":"S0092867402009716"},{"reference":"Jannuzi AL, Bunch TA, Brabant MC, Miller SW, Mukai L, Zavortink M, Brower DL. 2002. Disruption of C-terminal cytoplasmic domain of betaPS integrin subunit has dominant negative properties in developing Drosophila. Mol Biol Cell 13(4): 1352-65.
","pubmedId":"11950944","doi":""},{"reference":"Jannuzi AL, Bunch TA, West RF, Brower DL. 2004. Identification of integrin beta subunit mutations that alter heterodimer function in situ. Mol Biol Cell 15(8): 3829-40.
","pubmedId":"15194810","doi":""},{"reference":"Kääpä A, Peter K, Ylänne J. 1999. Effects of mutations in the cytoplasmic domain of integrin beta(1) to talin binding and cell spreading. Exp Cell Res 250(2): 524-34.
","pubmedId":"10413605","doi":""},{"reference":"Kim C, Ye F, Ginsberg MH. 2011. Regulation of integrin activation. Annu Rev Cell Dev Biol. 27: 321-45. 1152.","pubmedId":"21663444","doi":"10.1146/annurev-cellbio-100109-104104"},{"reference":"Kramer JM. 2005. Basement membranes. WormBook: 1-15.
","pubmedId":"18050423","doi":""},{"reference":"Lee M, Cram EJ, Shen B, Schwarzbauer JE. 2001. Roles for beta(pat-3) integrins in development and function of Caenorhabditis elegans muscles and gonads. J Biol Chem. 276: 36404-10. 1167.","pubmedId":"11473126","doi":"10.1074/jbc.M105795200"},{"reference":"Lemons L M, McKillop H, Genao N, Francis M M. 2024. The extracellular matrix molecule Collagen XVIII/CLE-1 affects neuronal dendritic spines. MicroPubl Biol 2024: 10.17912/micropub.biology.001331.
","pubmedId":"39568805","doi":""},{"reference":"Liddington RC, Ginsberg MH. 2002. Integrin activation takes shape. J Cell Biol. 158: 833-9. 688.","pubmedId":"12213832","doi":"10.1083/jcb.200206011 cb.200206011 [pii]"},{"reference":"Lilja J, Ivaska J. 2018. Integrin activity in neuronal connectivity. J Cell Sci 131(12): pii: jcs212803. 10.1242/jcs.212803.
","pubmedId":"29907643","doi":""},{"reference":"Mello CC, Kramer JM, Stinchcomb D, Ambros V. 1991. Efficient gene transfer in C.elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J. 10: 3959-70. 1413.","pubmedId":"1935914","doi":""},{"reference":"Morse EM, Brahme NN, Calderwood DA. 2014. Integrin Cytoplasmic\nTail Interactions. Biochemistry 53: 810-820.
","pubmedId":"","doi":"10.1021/bi401596q"},{"reference":"Moser M, Legate KR, Zent R, Fassler R. 2009. The tail of integrins, talin, and kindlins. Science. 324: 895-9. 689.","pubmedId":"19443776","doi":"324/5929/895 [pii]10.1126/science.1163865"},{"reference":"Nakamoto T, Kain KH, Ginsberg MH. 2004. Neurobiology: New connections between integrins and axon guidance. Curr Biol. 14: R121-3. 412.","pubmedId":"14986683","doi":""},{"reference":"Oliver D, Norman E, Bates H, Avard R, Rettler M, Bénard CY, Francis MM, Lemons ML. 2019. Integrins Have Cell-Type-Specific Roles in the Development of Motor Neuron Connectivity. J Dev Biol 7(3): 10.3390/jdb7030017.
","pubmedId":"31461926","doi":""},{"reference":"Oliver D, Ramachandran S, Philbrook A, Lambert CM, Nguyen KCQ, Hall DH, Francis MM. 2022. Kinesin-3 mediated axonal delivery of presynaptic neurexin stabilizes dendritic spines and postsynaptic components. PLoS Genet 18(1): e1010016.
","pubmedId":"35089924","doi":""},{"reference":"Oliver DB, Ramachandran S, Biswas K, Bénard CY, Doitsidou M, McKillop H, et al., Francis MM. 2026. Genome-wide analysis reveals pathways important for the development and maturation of excitatory synaptic connections to GABAergic neurons. G3 (Bethesda) 16(4): 10.1093/g3journal/jkag028.
","pubmedId":"41655250","doi":""},{"reference":"Park YK, Goda Y. 2016. Integrins in synapse regulation. Nat Rev Neurosci. 17: 745-756. 1226.","pubmedId":"27811927","doi":"10.1038/nrn.2016.138"},{"reference":"Philbrook A, Ramachandran S, Lambert CM, Oliver D, Florman J, Alkema MJ, Lemons M, Francis MM. 2018. Neurexin directs partner-specific synaptic connectivity in C. elegans. Elife. 7 1401.","pubmedId":"30039797","doi":"10.7554/eLife.35692"},{"reference":"Poinat P, De Arcangelis A, Sookhareea S, Zhu X, Hedgecock EM, Labouesse M, Georges Labouesse E. 2002. A conserved interaction between beta1 integrin/PAT-3 and Nck-interacting kinase/MIG-15 that mediates commissural axon navigation in C. elegans. Curr Biol. 12: 622-31. 1055.","pubmedId":"11967148","doi":""},{"reference":"Qadota H, Moerman DG, Benian GM. 2012. A Molecular Mechanism for the Requirement of PAT-4 (Integrin-linked Kinase (ILK)) for the Localization of UNC-112 (Kindlin) to Integrin Adhesion Sites. Journal of Biological Chemistry 287: 28537-28551.
","pubmedId":"","doi":"10.1074/jbc.M112.354852"},{"reference":"Qiu Z, Sheesley P, Ahn JH, Yu EJ, Lee M. 2019. A Novel Mutation in an NPXY Motif of β Integrin Reveals Phenotypes Similar to him-4/hemicentin. Front Cell Dev Biol 7: 247.
","pubmedId":"31720287","doi":""},{"reference":"Reszka AA, Hayashi Y, Horwitz AF. 1992. Identification of amino acid sequences in the integrin beta 1 cytoplasmic domain implicated in cytoskeletal association. J Cell Biol 117(6): 1321-30.
","pubmedId":"1376731","doi":""},{"reference":"Sakai T, Zhang Q, Fässler R, Mosher DF. 1998. Modulation of beta1A integrin functions by tyrosine residues in the beta1 cytoplasmic domain. J Cell Biol 141(2): 527-38.
","pubmedId":"9548729","doi":""},{"reference":"Sonnenberg A. 1993. Integrins and their ligands. Curr Top Microbiol Immunol. 184: 7-35. 1414.","pubmedId":"8313723","doi":""},{"reference":"Waites CL, Craig AM, Garner CC. 2005. Mechanisms of vertebrate synaptogenesis. Annu Rev Neurosci 28: 251-74.
","pubmedId":"16022596","doi":""},{"reference":"Wang JH. 2012. Pull and push: talin activation for integrin signaling. Cell Res 22(11): 1512-4.
","pubmedId":"22777425","doi":""},{"reference":"Xu X, Ahn JH, Tam P, Yu EJ, Batra S, Cram EJ, Lee M. 2010. Analysis of conserved residues in the betapat-3 cytoplasmic tail reveals important functions of integrin in multiple tissues. Dev Dyn 239(3): 763-72.
","pubmedId":"20063417","doi":""},{"reference":"Xuan Z, Manning L, Nelson J, Richmond JE, Colón-Ramos DA, Shen K, Kurshan PT. 2017. Clarinet (CLA-1), a novel active zone protein required for synaptic vesicle clustering and release. Elife 6: 10.7554/eLife.29276.
","pubmedId":"29160205","doi":""},{"reference":"Ye F, Snider AK, Ginsberg MH. 2014. Talin and kindlin: the one-two punch in integrin activation. Front Med 8(1): 6-16.
","pubmedId":"24477625","doi":""}],"title":"A mutation in the conserved NPxY motif of β integrin PAT-3 alters outgrowth of neuronal dendritic spines
","reviews":[],"curatorReviews":[{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":"1790208297157"},{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":"1791264902947"}]},{"id":"1cbbb0dc-5a6c-4021-8e21-0bc84972abc1","decision":"accept","abstract":"Integrins are heterodimeric transmembrane receptors that are critical in many biological processes, including neuronal development. Here we investigate integrin signaling in the outgrowth of dendritic spines on C. elegans GABAergic neurons using mutations engineered within the membrane-distal NPxY motif of the β integrin subunit PAT-3. We found a Y/E substitution, but not Y/A or Y/F substitutions, reduced dendritic spine number and misoriented spines. The Y/E substitution in the NPxY motif also altered the distribution of the presynaptic scaffold CLA-1, suggesting roles in both pre- and postsynaptic development. Our findings implicate integrin activation through the NPxY motif in synapse formation/maturation.
","acknowledgements":"We thank Dr. Shankar Ramachandran for technical assistance. We also thank Emily Norman for helpful comments and suggestions.
","authors":[{"affiliations":["Assumption University","University of Massachusetts Chan Medical School"],"departments":["Biological and Physical Sciences","Neurobiology"],"credit":["conceptualization","investigation","fundingAcquisition","supervision","writing_originalDraft","methodology","dataCuration","formalAnalysis"],"email":"mlemons@assumption.edu","firstName":"Michele L","lastName":"Lemons","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-8459-4130"},{"affiliations":["Assumption University"],"departments":["Biological and Physical Sciences"],"credit":["dataCuration","visualization","investigation"],"email":"Noelia.GenaoGarcia@umassmed.edu","firstName":"Noelia","lastName":"Genao","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0007-1611-452X"},{"affiliations":["Assumption University"],"departments":["Biological and Physical Sciences"],"credit":["investigation","validation","visualization","dataCuration"],"email":"hailey.mckillop@umassmed.edu","firstName":"Hailey","lastName":"McKillop","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0001-5582-6964"},{"affiliations":["University of Massachusetts Chan Medical School"],"departments":["Neurobiology"],"credit":["conceptualization","methodology","project","supervision","writing_reviewEditing","fundingAcquisition","investigation","resources"],"email":"michael.francis@umassmed.edu","firstName":"Michael M","lastName":"Francis","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-8076-6668"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work was supported by a collaborative RUI grant from the National Science Foundation, Division of Integrative Organismal Systems IOS1754986 (M.L.L.) and IOS1755019 (M.M.F.)
","image":{"url":"https://portal.micropublication.org/uploads/7280e660e59ce41f5cad570b8de5cb52.png"},"imageCaption":"A) Maximum projection confocal image of the C. elegans GABAergic DD1 neuron dendritic shaft (inverted LUT grey scale) labeled by transcriptional expression of myristoylated GFP (myrGFP). pGABA::myrGFP in top image refers to cell specific transcriptional expression of myrGFP in DD GABAergic neurons using the flp-13 promoter. Bottom panel is a cartoon representation of the top image and includes red carets pointing to ventrally directed spines protruding from the dendritic shaft. All images are from larval stage 4 animals and oriented with anterior to the left and ventral towards the bottom, as indicated by arrows. Scale bar, 5 μm. B) Inverted maximal projection images showing DD1 dendritic spines of wildtype, pat-3(kq8041), pat-3(kq8042) and pat-3(kq8043) animals. Scale bar, 5 μm. C) Scatterplot of the total number of spines within a 15 μm region of DD1 neurons in wild-type animals and pat-3 mutants. The number of spines in pat-3(kq8042) animals is significantly decreased compared to wildtype, pat-3(kq8041), and pat-3(kq8043) animals. Each data point represents a measurement from an independent animal. Red horizontal bar indicates the mean. *p<0.05, **p<0.005, *** p<0.0005, Kruskal Wallis test. D) Number of dorsally directed spines per animal shown as a scatterplot. Dorsally directed spines are significantly increased in pat-3(kq8042) compared to wild type. Red horizontal bar indicates the mean. Inset image of pat-3(kq8042) animal with carets pointing to dorsally directed spines. *p<0.05, **p<0.005, ***p<0.0005, Kruskal Wallis test. Scale bar, 2 μm. E) Maximum projection confocal images of C. elegans GABAergic DD1 neuron dendritic shaft and spines (red) and presynaptic protein CLA-1 (green). pGABA::mCherry refers to transgenic expression of the red fluorescent marker mCherry in GABAergic DD neurons (flp-13 promoter). pACh::CLA-1::GFP refers to expression of the active zone protein CLA-1 tagged with green fluorescent protein (GFP) in cholinergic neurons (unc-17 beta promoter), including those that are presynaptic to GABAergic DD motor neurons. Representative images of wild type (left) and pat-3(kq8042) mutants (right) are shown. Scale bar, 5 μm. Scatterplots showing the average number (F) and size (G) of CLA-1::GFP puncta per animal within a 50 μm anterior most portion of ventral nerve cord. Each dot represents a single animal. The number of CLA-1::GFP clusters is decreased and the size of CLA-1::GFP clusters is increased in pat-3(kq8042) animals compared to wild-type controls. ***p<0.0005, **p<0.005, Mann Whitney test.
","imageTitle":"
A Y/E substitution in the membrane distal NPxY motif of the cytoplasmic tail of β integrin/pat-3 disrupts dendritic spines
","methods":"Strains
All strains used in these experiments are listed in Table 1. Strains are N2 Bristol strain derivatives (wildtype) and were maintained at room temperature on nematode growth media plates seeded with E. coli strain OP50. Some strains were kindly shared by the Lee lab at Baylor University (Hanna et al., 2020). Transgenic strains were obtained by microinjection to achieve transformation (Mello et al., 1991) and identified by using co-injection markers. Integrated lines were produced with X-ray irradiation and outcrossed to wild type/N2 Bristol eight times. Only larval stage 4 (L4) hermaphrodites were used in this study.
Confocal microscopy and analysis
Animals were immobilized in sodium azide (0.3 M) on a 2% agarose pad. Images of dendrites of the DD1 neuron shown in Panels A, B and D were obtained using a Yokogawa CSU-10 spinning disk confocal system on an upright Olympus BX51WI microscope equipped with a Hammamatsu C9100-13 EMCCD camera and 63X oil immersion objective. A Cobolt Calypso 491 nm laser was used for excitation, and images were acquired using Volocity 4.3 software (Perkin-Elmer). All images were obtained using identical imaging and laser settings. Z stack volumes were acquired using an objective-coupled Piezo. Image analysis was conducted using Fiji software (open source) as described previously (He et al., 2015; Lemons et al., 2024; Oliver et al., 2022; Philbrook et al., 2018). Briefly, spines that were at least 0.2 μm in length were counted within a 15 µm region of interest (ROI) anterior to the DD1 cell soma.
Images in Panel E were obtained on a Yokogawa CSU-Z1 spinning disk confocal mounted on a Nikon NiE upright motorized microscope equipped with a Nikon 60x oil immersion objective and a Prime BSI Express CMOS camera (Teledyne Vision Solutions). Z stack images were acquired using Nikon Elements software, using identical imaging and laser settings. CLA-1::GFP puncta number and size were measured within a 50 µm region of the anterior ventral nerve cord using the analyze particles function in Image J.
","reagents":"Primers used to confirm pat-3 (kq8041), pat-3 (kq8042) and pat-3 (kq8043).
Forward primer OMF 3153 (primer in Exon 7 in pat-3 transcript): ggccacagataatgcaacag. Reverse primer OMF3141: (primer in downstream UTR): acaatttatcgctaaatactcgtt. PCR generated 436bp product. Product was sequenced using forward primer OMF3140 (in exon 7): catgatagatccgaatacgc
Table 1. Worm strains
Strain | Genotype | Description | Plasmid | Shortened name |
DD-specific myristoylated (myr) GFP transcriptional reporter (green) | pGABA::myrGFP = ufIs175 | |||
CRISPR engineered pat-3 mutation changes NPVY to NPVA (Hanna et al., 2020) |
| |||
CRISPR engineered pat-3 mutation changes NPVY to NPVE (Hanna et al., 2020) |
| |||
CRISPR engineered pat-3 mutation changes NPVY to NPVF (Hanna et al., 2020) |
| |||
DD-specific myrGFP transcriptional reporter (green) | pGABA::myrGFP = ufIs175 | |||
DD-specific myrGFP transcriptional reporter (green) | pGABA::myrGFP = ufIs175 | |||
DD-specific myrGFP transcriptional reporter (green) | pGABA::myrGFP = ufIs175 | |||
DD-specific mCherry transcriptional reporter (red), extrachromosomal array with cholinergic promoter driving CLA-1::green fluorescent protein (GFP) expression | ufIs128 [Pflp-13::mCherry+ Plgc-11::mCherry]; ufEx1679 [Punc-17β::GFPnovo2::cla-1 + Plgc-11::GFP]
| pGABA::mCherry = ufIs128 | ||
DD-specific mCherry transcriptional reporter (red), extrachromosomal array with cholinergic promoter driving CLA-1::green fluorescent protein (GFP) expression | ufIs128 [Pflp-13::mCherry+ Plgc-11::mCherry]; ufEx1679 [Punc-17β::GFPnovo2::cla-1 + Plgc-11::GFP] | pGABA::mCherry = ufIs128 |
Synapse formation involves a sequence of carefully orchestrated molecular interactions to concentrate synaptic vesicles and release machinery at precisely defined sites opposite clusters of post-synaptic neurotransmitter receptors (Drapeau et al., 1995; Waites et al., 2005). Many studies have identified shared groups of proteins that form the core pre- and post-synaptic scaffolds, but the events that initiate synapse assembly and maturation often vary at the level of individual neurons and synapses. Mounting evidence indicates that integrin family members have key roles in synapse assembly and maturation (de Wit & Ghosh, 2016; Dityatev et al., 2010; Lilja & Ivaska, 2018; Park & Goda, 2016). Integrins are transmembrane extracellular matrix receptors that function as αβ heterodimers (Campbell & Humphries, 2011; Giancotti & Ruoslahti, 1999; Hynes, 1992, 2002). Integrins bind a variety of ligands including extracellular matrix, cell adhesion and axon guidance proteins, as well as intracellular signaling machinery such as talin and kindlin (Humphries et al., 2006; Moser et al., 2009; Nakamoto et al., 2004; Sonnenberg, 1993; Ye et al., 2014). At least 24 different integrin combinations are formed from 18 α and 8 β subunits in mammals, while the invertebrate model C. elegans forms only two integrin heterodimers (Fassler & Meyer, 1995) composed of one α subunit (INA-1 or PAT-2) and a sole β subunit (PAT-3)(Gettner et al., 1995; Kramer, 2005).
Integrin function is greatly influenced by conformational state, integrins shift between low- (inactivated) and high-ligand affinity (activated) states. Integrin activation can be triggered by cytoplasmic signaling, known as “inside-out” activation (Calderwood, 2004a; Ginsberg, 2014; Kim et al., 2011; Liddington & Ginsberg, 2002; Wang, 2012). Inside-out activation is mediated through interactions between phosphotyrosine binding (PTB) domain proteins (including talin, kindlin) and cytoplasmic NPxY (asp-pro-x-tyr) motifs in the β integrin cytoplasmic domain (Bumm et al., 2025; Czuchra et al., 2006; Hanna et al., 2020; Jannuzi et al., 2002; Jannuzi et al., 2004; Kaapa et al., 1999; Lee et al., 2001; Sakai et al., 1998). The cytoplasmic tail of β integrin has two NPxY motifs, the membrane-proximal motif is proposed to interact with talin while the membrane-distal motif has been shown to interact with kindlin (Morse et al., 2014). Tyrosine phosphorylation of the NPxY motifs regulates the binding of PTB domain containing proteins, implicating NPxY motifs as molecular switches for integrin activation and signaling (Bledzka et al., 2010; Calderwood, 2004a, 2004b; Calderwood et al., 2013; Calderwood et al., 2002; Liddington & Ginsberg, 2002). While null mutations in the gene encoding the C. elegans β integrin pat-3 are lethal, viable CRISPR-engineered mutations targeting the membrane-distal NPXY motif of PAT-3 were recently generated (Bumm et al., 2025; Hanna et al., 2020). Building upon previous studies from our lab and others that implicate integrins in the outgrowth of GABAergic axons (Baum & Garriga, 1997; Chisholm et al., 2016; Forrester & Garriga, 1997; Oliver et al., 2019; Poinat et al., 2002), we sought to employ these NPxY engineered mutants to investigate integrin signaling in the formation of previously characterized dendritic spines in C. elegans GABAergic neurons (Cuentas-Condori et al., 2019; Lemons et al., 2024; Oliver et al., 2022; Oliver et al., 2026; Philbrook et al., 2018).
To investigate the role of integrin activation through the β integrin/PAT-3 NPxY motif in spine outgrowth, we used cell-specific expression of myristoylated green fluorescent protein (myrGFP) to visualize GABAergic dendrites in 3 available strains carrying CRISPR-engineered mutations in the conserved tyrosine residue of the PAT-3 membrane distal NPxY motif: wild type 801NPVY804 to NPVA804 [alanine, pat-3(kq8041)], NPVE804 [glutamate, pat-3(kq8042)], or NPVF804 [phenylalanine, (pat-3(kq8043)] (Bumm et al., 2025; Hanna et al., 2020). These mutations are expected to disrupt the tyrosine residue (A), mimic tyrosine phosphorylation (E), or mimic non-phosphorylatable tyrosine (F), respectively. Consistent with previous studies (Lemons et al., 2024; Oliver et al., 2022; Philbrook et al., 2018), we observed roughly 8 dendritic spines in a 15 μm region anterior to the DD1 GABAergic neuron of wild-type larval stage 4 (L4) animals (Figure 1A-C). The number of dendritic spines on GABAergic DD1 neurons was significantly reduced by 43±6% in pat-3(kq8042) animals carrying a Y>E substitution (Figure 1B,C). Surprisingly, some spines appeared dorsally rather than ventrally oriented in these animals (Figure 1B, D), suggesting either misdirected spine growth or the possibility of ectopic synaptic contacts. Substitution of the negatively charged glutamic acid (E) for tyrosine (Y) in pat-3(kq8042) animals is predicted to mimic tyrosine phosphorylation (Anthis et al., 2009; Qiu et al., 2019; Reszka et al., 1992). Previous studies suggest phosphorylation of the distal NPxY motif disrupts kindlin binding, therefore disabling kindlin's ability to co-activate integrin (Bledzka et al., 2010; Harburger et al., 2009). Our findings suggest that constitutive tyrosine phosphorylation disrupts dendritic spines, perhaps by impacting interactions with kindlin/UNC-112 or other modulators of integrin activation that act through this motif.
To ask whether the effects of the PAT-3 Y/E substitution were specific to the post-synapse or affected both pre- and postsynaptic specializations, we examined the distribution of the GFP-tagged active zone marker CLA-1 (Xuan et al., 2017) in cholinergic neurons, which are presynaptic partners to GABAergic motor neurons. As expected, CLA-1::GFP puncta were observed on the ventral side of ventrally directed spines in wild-type controls (Figure 1E), indicating presynaptic specializations opposing the dendritic spines. We found that the number of CLA-1::GFP puncta within a 50 μm region of the anterior ventral nerve cord was significantly decreased in pat-3(kq8042) animals compared to controls (Figure 1F), while the size of CLA-1::GFP puncta slightly increased (Figure 1G). These findings demonstrate that both pre- and postsynaptic specializations are disrupted in pat-3(kq8042) animals.
We next examined dendritic spines in pat-3(kq8041) and pat-3(kq8043) animals. A tyrosine (Y) to phenylalanine substitution (F) in the NPxY motif in pat-3(kq8043) animals is predicted to preserve hydrophobic interactions associated with tyrosine but eliminate phosphorylation, perhaps acting similarly to a non-phosphorylatable tyrosine residue (Chen et al., 2006; Xu et al., 2010). The tyrosine (Y) to alanine substitution (A) in the NPxY motif of pat-3(kq8041) animals is predicted to disrupt interactions requiring the hydrophobic aromatic ring of tyrosine as well as phosphorylation at this site (Chen et al., 2006). Surprisingly, we found that spine number was not significantly different in either of these mutants compared to wild-type animals (Figure 1B,C). Although work to date suggests the membrane-proximal and -distal NPxY motifs have independent binding partners, we can't rule out the possibility that redundancy across the motifs contributes to these findings.
Prior analysis of membrane distal NPxY substitutions revealed that all three substitutions produced defects in the migration of gonadal distal tip cells (Hanna et al., 2020). In contrast, our finding that solely the phosphomimetic Y/E substitution disrupts dendritic spines is more consistent with recent studies of neuronal function in these strains, where the phosphomimetic E substitution produced severe effects, while the A and F substitutions did not (Bumm et al., 2025). Together, our results argue that tyrosine phosphorylation at the distal NPxY motif of PAT-3 is not essential for spine outgrowth, but may instead have a modulatory role, perhaps by influencing integrin interaction with kindlin/UNC-112 (Bledzka et al., 2010; Qadota et al., 2012).
","references":[{"reference":"Anthis NJ, Haling JR, Oxley CL, Memo M, Wegener KL, Lim CJ, Ginsberg MH, Campbell ID. 2009. Beta integrin tyrosine phosphorylation is a conserved mechanism for regulating talin-induced integrin activation. J Biol Chem 284(52): 36700-36710.
","pubmedId":"19843520","doi":""},{"reference":"Baum PD, Garriga G. 1997. Neuronal migrations and axon fasciculation are disrupted in ina-1 integrin mutants. Neuron. 19: 51-62. 1047.","pubmedId":"9247263","doi":""},{"reference":"Bledzka K, Bialkowska K, Nie H, Qin J, Byzova T, Wu C, Plow EF, Ma YQ. 2010. Tyrosine phosphorylation of integrin beta3 regulates kindlin-2 binding and integrin activation. J Biol Chem 285(40): 30370-4.
","pubmedId":"20702409","doi":""},{"reference":"Bumm JH, Lee DD, Qiu Z, Choi AH, Kolluri M, Olsen MJ, Wang L, Lee M. 2025. The beta integrin modulates serotonin sensitivity via NPxY motifs to regulate egg laying and mechanosensation behaviors in Caenorhabditis elegans. Dev Dyn 1442.","pubmedId":"41117756","doi":"10.1002/dvdy.70090"},{"reference":"Calderwood DA. 2004. Talin controls integrin activation. Biochem Soc Trans. 32: 434-7. 675.","pubmedId":"15157154","doi":"10.1042/BST0320434"},{"reference":"Calderwood DA. 2004. Integrin activation. J Cell Sci. 117: 657-66. 676.","pubmedId":"14754902","doi":"10.1242/jcs.01014"},{"reference":"Calderwood DA, Campbell ID, Critchley DR. 2013. Talins and kindlins: partners in integrin-mediated adhesion. Nat Rev Mol Cell Biol 14(8): 503-17.
","pubmedId":"23860236","doi":""},{"reference":"Calderwood DA, Yan B, de Pereda JM, Alvarez BG, Fujioka Y, Liddington RC, Ginsberg MH. 2002. The phosphotyrosine binding-like domain of talin activates integrins. J Biol Chem 277(24): 21749-58.
","pubmedId":"11932255","doi":""},{"reference":"Campbell ID, Humphries MJ. 2011. Integrin structure, activation, and interactions. Cold Spring Harb Perspect Biol 3(3): 10.1101/cshperspect.a004994.
","pubmedId":"21421922","doi":""},{"reference":"Chen H, Zou Z, Sarratt KL, Zhou D, Zhang M, Sebzda E, Hammer DA, Kahn ML. 2006. In vivo beta1 integrin function requires phosphorylation-independent regulation by cytoplasmic tyrosines. Genes Dev 20(8): 927-32.
","pubmedId":"16618804","doi":""},{"reference":"Chisholm AD, Hutter H, Jin Y, Wadsworth WG. 2016. The Genetics of Axon Guidance and Axon Regeneration in Caenorhabditis elegans. Genetics. 204: 849-882. 1406.","pubmedId":"28114100","doi":"10.1534/genetics.115.186262"},{"reference":"Cuentas-Condori A, Mulcahy B, He S, Palumbos S, Zhen M, Miller DM 3rd. 2019. C. elegans neurons have functional dendritic spines. Elife 8: 10.7554/eLife.47918.
","pubmedId":"31584430","doi":""},{"reference":"Czuchra A, Meyer H, Legate KR, Brakebusch C, Fässler R. 2006. Genetic analysis of beta1 integrin \"activation motifs\" in mice. J Cell Biol 174(6): 889-99.
","pubmedId":"16954348","doi":""},{"reference":"de Wit J, Ghosh A. 2016. Specification of synaptic connectivity by cell surface interactions. Nat Rev Neurosci 17(1): 22-35.
","pubmedId":"26656254","doi":""},{"reference":"Dityatev A, Schachner M, Sonderegger P. 2010. The dual role of the extracellular matrix in synaptic plasticity and homeostasis. Nat Rev Neurosci. 11: 735-46. 1242.","pubmedId":"20944663","doi":"10.1038/nrn2898"},{"reference":"Drapeau P, Catarsi S, Merz DC. 1995. Signalling synapse formation between identified neurons. J Physiol Paris 89(3): 115-23.
","pubmedId":"7581300","doi":""},{"reference":"Fässler R, Meyer M. 1995. Consequences of lack of beta 1 integrin gene expression in mice. Genes Dev 9(15): 1896-908.
","pubmedId":"7544313","doi":""},{"reference":"Forrester WC, Garriga G. 1997. Genes necessary for C. elegans cell and growth cone migrations. Development. 124: 1831-43. 1053.","pubmedId":"9165130","doi":""},{"reference":"Gettner SN, Kenyon C, Reichardt LF. 1995. Characterization of beta pat-3 heterodimers, a family of essential integrin receptors in C. elegans. J Cell Biol. 129: 1127-41. 1080.","pubmedId":"7744961","doi":""},{"reference":"Giancotti FG, Ruoslahti E. 1999. Integrin signaling. Science. 285: 1028-32. 363.","pubmedId":"10446041","doi":""},{"reference":"Ginsberg MH. 2014. Integrin activation. BMB Rep. 47: 655-9. 1163.","pubmedId":"25388208","doi":""},{"reference":"Hanna J, Ramani S, Williams T, Anaya R, Campion N, Lopez E, et al., Lee M. 2020. Three alleles in the pat-3 locus of Caenorhabditis elegans: mutations in the membrane-distal NPxY phosphotyrosine motif. MicroPubl Biol. 2020 1441.","pubmedId":"32821887","doi":"10.17912/micropub.biology.000291"},{"reference":"He S, Philbrook A, Mc Whirter R, Gabel CV, Taub DG, Carter MH, et al., Miller DM. 2015. Transcriptional Control of Synaptic Remodeling through Regulated Expression of an Immunoglobulin Superfamily Protein. Curr Biol. 25: 2541-8. 1161.","pubmedId":"26387713","doi":"10.1016/j.cub.2015.08.022"},{"reference":"Humphries JD, Byron A, Humphries MJ. 2006. Integrin ligands at a glance. J Cell Sci. 119: 3901-3. 856.","pubmedId":"16988024","doi":"119/19/3901 [pii] 10.1242/jcs.03098"},{"reference":"Hynes RO. 1992. Integrins: versatility, modulation, and signaling in cell adhesion. Cell. 69: 11-25.. 97.","pubmedId":"","doi":""},{"reference":"Hynes RO. 2002. Integrins: bidirectional, allosteric signaling machines. Cell. 110: 673-87. 865.","pubmedId":"12297042","doi":"S0092867402009716"},{"reference":"Jannuzi AL, Bunch TA, Brabant MC, Miller SW, Mukai L, Zavortink M, Brower DL. 2002. Disruption of C-terminal cytoplasmic domain of betaPS integrin subunit has dominant negative properties in developing Drosophila. Mol Biol Cell 13(4): 1352-65.
","pubmedId":"11950944","doi":""},{"reference":"Jannuzi AL, Bunch TA, West RF, Brower DL. 2004. Identification of integrin beta subunit mutations that alter heterodimer function in situ. Mol Biol Cell 15(8): 3829-40.
","pubmedId":"15194810","doi":""},{"reference":"Kääpä A, Peter K, Ylänne J. 1999. Effects of mutations in the cytoplasmic domain of integrin beta(1) to talin binding and cell spreading. Exp Cell Res 250(2): 524-34.
","pubmedId":"10413605","doi":""},{"reference":"Kim C, Ye F, Ginsberg MH. 2011. Regulation of integrin activation. Annu Rev Cell Dev Biol. 27: 321-45. 1152.","pubmedId":"21663444","doi":"10.1146/annurev-cellbio-100109-104104"},{"reference":"Kramer JM. 2005. Basement membranes. WormBook: 1-15.
","pubmedId":"18050423","doi":""},{"reference":"Lee M, Cram EJ, Shen B, Schwarzbauer JE. 2001. Roles for beta(pat-3) integrins in development and function of Caenorhabditis elegans muscles and gonads. J Biol Chem. 276: 36404-10. 1167.","pubmedId":"11473126","doi":"10.1074/jbc.M105795200"},{"reference":"Lemons L M, McKillop H, Genao N, Francis M M. 2024. The extracellular matrix molecule Collagen XVIII/CLE-1 affects neuronal dendritic spines. MicroPubl Biol 2024: 10.17912/micropub.biology.001331.
","pubmedId":"39568805","doi":""},{"reference":"Liddington RC, Ginsberg MH. 2002. Integrin activation takes shape. J Cell Biol. 158: 833-9. 688.","pubmedId":"12213832","doi":"10.1083/jcb.200206011 cb.200206011 [pii]"},{"reference":"Lilja J, Ivaska J. 2018. Integrin activity in neuronal connectivity. J Cell Sci 131(12): pii: jcs212803. 10.1242/jcs.212803.
","pubmedId":"29907643","doi":""},{"reference":"Mello CC, Kramer JM, Stinchcomb D, Ambros V. 1991. Efficient gene transfer in C.elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J. 10: 3959-70. 1413.","pubmedId":"1935914","doi":""},{"reference":"Morse EM, Brahme NN, Calderwood DA. 2014. Integrin Cytoplasmic\nTail Interactions. Biochemistry 53: 810-820.
","pubmedId":"","doi":"10.1021/bi401596q"},{"reference":"Moser M, Legate KR, Zent R, Fassler R. 2009. The tail of integrins, talin, and kindlins. Science. 324: 895-9. 689.","pubmedId":"19443776","doi":"324/5929/895 [pii]10.1126/science.1163865"},{"reference":"Nakamoto T, Kain KH, Ginsberg MH. 2004. Neurobiology: New connections between integrins and axon guidance. Curr Biol. 14: R121-3. 412.","pubmedId":"14986683","doi":""},{"reference":"Oliver D, Norman E, Bates H, Avard R, Rettler M, Bénard CY, Francis MM, Lemons ML. 2019. Integrins Have Cell-Type-Specific Roles in the Development of Motor Neuron Connectivity. J Dev Biol 7(3): 10.3390/jdb7030017.
","pubmedId":"31461926","doi":""},{"reference":"Oliver D, Ramachandran S, Philbrook A, Lambert CM, Nguyen KCQ, Hall DH, Francis MM. 2022. Kinesin-3 mediated axonal delivery of presynaptic neurexin stabilizes dendritic spines and postsynaptic components. PLoS Genet 18(1): e1010016.
","pubmedId":"35089924","doi":""},{"reference":"Oliver DB, Ramachandran S, Biswas K, Bénard CY, Doitsidou M, McKillop H, et al., Francis MM. 2026. Genome-wide analysis reveals pathways important for the development and maturation of excitatory synaptic connections to GABAergic neurons. G3 (Bethesda) 16(4): 10.1093/g3journal/jkag028.
","pubmedId":"41655250","doi":""},{"reference":"Park YK, Goda Y. 2016. Integrins in synapse regulation. Nat Rev Neurosci. 17: 745-756. 1226.","pubmedId":"27811927","doi":"10.1038/nrn.2016.138"},{"reference":"Philbrook A, Ramachandran S, Lambert CM, Oliver D, Florman J, Alkema MJ, Lemons M, Francis MM. 2018. Neurexin directs partner-specific synaptic connectivity in C. elegans. Elife. 7 1401.","pubmedId":"30039797","doi":"10.7554/eLife.35692"},{"reference":"Poinat P, De Arcangelis A, Sookhareea S, Zhu X, Hedgecock EM, Labouesse M, Georges Labouesse E. 2002. A conserved interaction between beta1 integrin/PAT-3 and Nck-interacting kinase/MIG-15 that mediates commissural axon navigation in C. elegans. Curr Biol. 12: 622-31. 1055.","pubmedId":"11967148","doi":""},{"reference":"Qadota H, Moerman DG, Benian GM. 2012. A Molecular Mechanism for the Requirement of PAT-4 (Integrin-linked Kinase (ILK)) for the Localization of UNC-112 (Kindlin) to Integrin Adhesion Sites. Journal of Biological Chemistry 287: 28537-28551.
","pubmedId":"","doi":"10.1074/jbc.M112.354852"},{"reference":"Qiu Z, Sheesley P, Ahn JH, Yu EJ, Lee M. 2019. A Novel Mutation in an NPXY Motif of β Integrin Reveals Phenotypes Similar to him-4/hemicentin. Front Cell Dev Biol 7: 247.
","pubmedId":"31720287","doi":""},{"reference":"Reszka AA, Hayashi Y, Horwitz AF. 1992. Identification of amino acid sequences in the integrin beta 1 cytoplasmic domain implicated in cytoskeletal association. J Cell Biol 117(6): 1321-30.
","pubmedId":"1376731","doi":""},{"reference":"Sakai T, Zhang Q, Fässler R, Mosher DF. 1998. Modulation of beta1A integrin functions by tyrosine residues in the beta1 cytoplasmic domain. J Cell Biol 141(2): 527-38.
","pubmedId":"9548729","doi":""},{"reference":"Sonnenberg A. 1993. Integrins and their ligands. Curr Top Microbiol Immunol. 184: 7-35. 1414.","pubmedId":"8313723","doi":""},{"reference":"Waites CL, Craig AM, Garner CC. 2005. Mechanisms of vertebrate synaptogenesis. Annu Rev Neurosci 28: 251-74.
","pubmedId":"16022596","doi":""},{"reference":"Wang JH. 2012. Pull and push: talin activation for integrin signaling. Cell Res 22(11): 1512-4.
","pubmedId":"22777425","doi":""},{"reference":"Xu X, Ahn JH, Tam P, Yu EJ, Batra S, Cram EJ, Lee M. 2010. Analysis of conserved residues in the betapat-3 cytoplasmic tail reveals important functions of integrin in multiple tissues. Dev Dyn 239(3): 763-72.
","pubmedId":"20063417","doi":""},{"reference":"Xuan Z, Manning L, Nelson J, Richmond JE, Colón-Ramos DA, Shen K, Kurshan PT. 2017. Clarinet (CLA-1), a novel active zone protein required for synaptic vesicle clustering and release. Elife 6: 10.7554/eLife.29276.
","pubmedId":"29160205","doi":""},{"reference":"Ye F, Snider AK, Ginsberg MH. 2014. Talin and kindlin: the one-two punch in integrin activation. Front Med 8(1): 6-16.
","pubmedId":"24477625","doi":""}],"title":"A mutation in the conserved NPxY motif of β integrin PAT-3 alters outgrowth of neuronal dendritic spines
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":"1793064019269"},{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":"1793134669382"}]},{"id":"6cf1399f-d153-4e32-8f5d-eda9e68de6a4","decision":"revise","abstract":"Integrins are heterodimeric transmembrane receptors that are critical in many biological processes, including neuronal development. Here we investigate integrin signaling in the outgrowth of dendritic spines on C. elegans GABAergic neurons using mutations engineered within the membrane-distal NPxY motif of the β integrin subunit PAT-3. We found a Y/E substitution, but not Y/A or Y/F substitutions, reduced dendritic spine number and misoriented spines. The Y/E substitution in the NPxY motif also altered the distribution of the presynaptic scaffold CLA-1, suggesting roles in both pre- and postsynaptic development. Our findings implicate integrin activation through the NPxY motif in synapse formation/maturation.
","acknowledgements":"We thank Dr. Shankar Ramachandran for technical assistance. We also thank Emily Norman for helpful comments and suggestions.
","authors":[{"affiliations":["Assumption University","University of Massachusetts Chan Medical School"],"departments":["Biological and Physical Sciences","Neurobiology"],"credit":["conceptualization","investigation","fundingAcquisition","supervision","writing_originalDraft","methodology","dataCuration","formalAnalysis"],"email":"mlemons@assumption.edu","firstName":"Michele L","lastName":"Lemons","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-8459-4130"},{"affiliations":["Assumption University"],"departments":["Biological and Physical Sciences"],"credit":["dataCuration","visualization","investigation"],"email":"Noelia.GenaoGarcia@umassmed.edu","firstName":"Noelia","lastName":"Genao","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0007-1611-452X"},{"affiliations":["Assumption University"],"departments":["Biological and Physical Sciences"],"credit":["investigation","validation","visualization","dataCuration"],"email":"hailey.mckillop@umassmed.edu","firstName":"Hailey","lastName":"McKillop","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0001-5582-6964"},{"affiliations":["University of Massachusetts Chan Medical School"],"departments":["Neurobiology"],"credit":["conceptualization","methodology","project","supervision","writing_reviewEditing","fundingAcquisition","investigation","resources"],"email":"michael.francis@umassmed.edu","firstName":"Michael M","lastName":"Francis","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-8076-6668"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work was supported by a collaborative RUI grant from the National Science Foundation, Division of Integrative Organismal Systems IOS1754986 (M.L.L.) and IOS1755019 (M.M.F.)
","image":{"url":"https://portal.micropublication.org/uploads/7280e660e59ce41f5cad570b8de5cb52.png"},"imageCaption":"A) Maximum projection confocal image of the C. elegans GABAergic DD1 neuron dendritic shaft (inverted LUT grey scale) labeled by transcriptional expression of myristoylated GFP (myrGFP). pGABA::myrGFP in top image refers to cell specific transcriptional expression of myrGFP in DD GABAergic neurons using the flp-13 promoter. Bottom panel is a cartoon representation of the top image and includes red carets pointing to ventrally directed spines protruding from the dendritic shaft. All images are from larval stage 4 animals and oriented with anterior to the left and ventral towards the bottom, as indicated by arrows. Scale bar, 5 μm. B) Inverted maximal projection images showing DD1 dendritic spines of wildtype, pat-3(kq8041), pat-3(kq8042) and pat-3(kq8043) animals. Scale bar, 5 μm. C) Scatterplot of the total number of spines within a 15 μm region of DD1 neurons in wild-type animals and pat-3 mutants. The number of spines in pat-3(kq8042) animals is significantly decreased compared to wildtype, pat-3(kq8041), and pat-3(kq8043) animals. Each data point represents a measurement from an independent animal. Red horizontal bar indicates the mean. *p<0.05, **p<0.005, *** p<0.0005, Kruskal Wallis test. D) Number of dorsally directed spines per animal shown as a scatterplot. Dorsally directed spines are significantly increased in pat-3(kq8042) compared to wild type. Red horizontal bar indicates the mean. Inset image of pat-3(kq8042) animal with carets pointing to dorsally directed spines. *p<0.05, **p<0.005, ***p<0.0005, Kruskal Wallis test. Scale bar, 2 μm. E) Maximum projection confocal images of C. elegans GABAergic DD1 neuron dendritic shaft and spines (red) and presynaptic protein CLA-1 (green). pGABA::mCherry refers to transgenic expression of the red fluorescent marker mCherry in GABAergic DD neurons (flp-13 promoter). pACh::CLA-1::GFP refers to expression of the active zone protein CLA-1 tagged with green fluorescent protein (GFP) in cholinergic neurons (unc-17 beta promoter), including those that are presynaptic to GABAergic DD motor neurons. Representative images of wild type (left) and pat-3(kq8042) mutants (right) are shown. Scale bar, 5 μm. Scatterplots showing the average number (F) and size (G) of CLA-1::GFP puncta per animal within a 50 μm anterior most portion of ventral nerve cord. Each dot represents a single animal. The number of CLA-1::GFP clusters is decreased and the size of CLA-1::GFP clusters is increased in pat-3(kq8042) animals compared to wild-type controls. ***p<0.0005, **p<0.005, Mann Whitney test.
","imageTitle":"
A Y/E substitution in the membrane distal NPxY motif of the cytoplasmic tail of β integrin/pat-3 disrupts dendritic spines
","methods":"Strains
All strains used in these experiments are listed in Table 1. Strains are N2 Bristol strain derivatives (wildtype) and were maintained at room temperature on nematode growth media plates seeded with E. coli strain OP50. Some strains were kindly shared by the Lee lab at Baylor University (Hanna et al., 2020). Transgenic strains were obtained by microinjection to achieve transformation (Mello et al., 1991) and identified by using co-injection markers. Integrated lines were produced with X-ray irradiation and outcrossed to wild type/N2 Bristol eight times. Only larval stage 4 (L4) hermaphrodites were used in this study.
Confocal microscopy and analysis
Animals were immobilized in sodium azide (0.3 M) on a 2% agarose pad. Images of dendrites of the DD1 neuron shown in Panels A, B and D were obtained using a Yokogawa CSU-10 spinning disk confocal system on an upright Olympus BX51WI microscope equipped with a Hammamatsu C9100-13 EMCCD camera and 63X oil immersion objective. A Cobolt Calypso 491 nm laser was used for excitation, and images were acquired using Volocity 4.3 software (Perkin-Elmer). All images were obtained using identical imaging and laser settings. Z stack volumes were acquired using an objective-coupled Piezo. Image analysis was conducted using Fiji software (open source) as described previously (He et al., 2015; Lemons et al., 2024; Oliver et al., 2022; Philbrook et al., 2018). Briefly, spines that were at least 0.2 μm in length were counted within a 15 µm region of interest (ROI) anterior to the DD1 cell soma.
Images in Panel E were obtained on a Yokogawa CSU-Z1 spinning disk confocal mounted on a Nikon NiE upright motorized microscope equipped with a Nikon 60x oil immersion objective and a Prime BSI Express CMOS camera (Teledyne Vision Solutions). Z stack images were acquired using Nikon Elements software, using identical imaging and laser settings. CLA-1::GFP puncta number and size were measured within a 50 µm region of the anterior ventral nerve cord using the analyze particles function in Image J.
","reagents":"Primers used to confirm pat-3 (kq8041), pat-3 (kq8042) and pat-3 (kq8043).
Forward primer OMF 3153 (primer in Exon 7 in pat-3 transcript): ggccacagataatgcaacag. Reverse primer OMF3141: (primer in downstream UTR): acaatttatcgctaaatactcgtt. PCR generated 436bp product. Product was sequenced using forward primer OMF3140 (in exon 7): catgatagatccgaatacgc
Table 1. Worm strains
Strain | Genotype | Description | Plasmid | Shortened name |
DD-specific myristoylated (myr) GFP transcriptional reporter (green) | pGABA::myrGFP = ufIs175 | |||
CRISPR engineered pat-3 mutation changes NPVY to NPVA (Hanna et al., 2020) |
| |||
CRISPR engineered pat-3 mutation changes NPVY to NPVE (Hanna et al., 2020) |
| |||
CRISPR engineered pat-3 mutation changes NPVY to NPVF (Hanna et al., 2020) |
| |||
DD-specific myrGFP transcriptional reporter (green) | pGABA::myrGFP = ufIs175 | |||
DD-specific myrGFP transcriptional reporter (green) | pGABA::myrGFP = ufIs175 | |||
DD-specific myrGFP transcriptional reporter (green) | pGABA::myrGFP = ufIs175 | |||
DD-specific mCherry transcriptional reporter (red), extrachromosomal array with cholinergic promoter driving CLA-1::green fluorescent protein (GFP) expression | ufIs128 [Pflp-13::mCherry+ Plgc-11::mCherry]; ufEx1679 [Punc-17β::GFPnovo2::cla-1 + Plgc-11::GFP]
| pGABA::mCherry = ufIs128 | ||
DD-specific mCherry transcriptional reporter (red), extrachromosomal array with cholinergic promoter driving CLA-1::green fluorescent protein (GFP) expression | ufIs128 [Pflp-13::mCherry+ Plgc-11::mCherry]; ufEx1679 [Punc-17β::GFPnovo2::cla-1 + Plgc-11::GFP] | pGABA::mCherry = ufIs128 |
Synapse formation involves a sequence of carefully orchestrated molecular interactions to concentrate synaptic vesicles and release machinery at precisely defined sites opposite clusters of post-synaptic neurotransmitter receptors (Drapeau et al., 1995; Waites et al., 2005). Many studies have identified shared groups of proteins that form the core pre- and post-synaptic scaffolds, but the events that initiate synapse assembly and maturation often vary at the level of individual neurons and synapses. Mounting evidence indicates that integrin family members have key roles in synapse assembly and maturation (de Wit & Ghosh, 2016; Dityatev et al., 2010; Lilja & Ivaska, 2018; Park & Goda, 2016). Integrins are transmembrane extracellular matrix receptors that function as αβ heterodimers (Campbell & Humphries, 2011; Giancotti & Ruoslahti, 1999; Hynes, 1992, 2002). Integrins bind a variety of ligands including extracellular matrix, cell adhesion and axon guidance proteins, as well as intracellular signaling machinery such as talin and kindlin (Humphries et al., 2006; Moser et al., 2009; Nakamoto et al., 2004; Sonnenberg, 1993; Ye et al., 2014). At least 24 different integrin combinations are formed from 18 α and 8 β subunits in mammals, while the invertebrate model C. elegans forms only two integrin heterodimers (Fassler & Meyer, 1995) composed of one α subunit (INA-1 or PAT-2) and a sole β subunit (PAT-3)(Gettner et al., 1995; Kramer, 2005).
Integrin function is greatly influenced by conformational state, integrins shift between low- (inactivated) and high-ligand affinity (activated) states. Integrin activation can be triggered by cytoplasmic signaling, known as “inside-out” activation (Calderwood, 2004a; Ginsberg, 2014; Kim et al., 2011; Liddington & Ginsberg, 2002; Wang, 2012). Inside-out activation is mediated through interactions between phosphotyrosine binding (PTB) domain proteins (including talin, kindlin) and cytoplasmic NPxY (asp-pro-x-tyr) motifs in the β integrin cytoplasmic domain (Bumm et al., 2025; Czuchra et al., 2006; Hanna et al., 2020; Jannuzi et al., 2002; Jannuzi et al., 2004; Kaapa et al., 1999; Lee et al., 2001; Sakai et al., 1998). The cytoplasmic tail of β integrin has two NPxY motifs, the membrane-proximal motif is proposed to interact with talin while the membrane-distal motif has been shown to interact with kindlin (Morse et al., 2014). Tyrosine phosphorylation of the NPxY motifs regulates the binding of PTB domain containing proteins, implicating NPxY motifs as molecular switches for integrin activation and signaling (Bledzka et al., 2010; Calderwood, 2004a, 2004b; Calderwood et al., 2013; Calderwood et al., 2002; Liddington & Ginsberg, 2002). While null mutations in the gene encoding the C. elegans β integrin pat-3 are lethal, viable CRISPR-engineered mutations targeting the membrane-distal NPXY motif of PAT-3 were recently generated (Bumm et al., 2025; Hanna et al., 2020). Building upon previous studies from our lab and others that implicate integrins in the outgrowth of GABAergic axons (Baum & Garriga, 1997; Chisholm et al., 2016; Forrester & Garriga, 1997; Oliver et al., 2019; Poinat et al., 2002), we sought to employ these NPxY engineered mutants to investigate integrin signaling in the formation of previously characterized dendritic spines in C. elegans GABAergic neurons (Cuentas-Condori et al., 2019; Lemons et al., 2024; Oliver et al., 2022; Oliver et al., 2026; Philbrook et al., 2018).
To investigate the role of integrin activation through the β integrin/PAT-3 NPxY motif in spine outgrowth, we used cell-specific expression of myristoylated green fluorescent protein (myrGFP) to visualize GABAergic dendrites in 3 available strains carrying CRISPR-engineered mutations in the conserved tyrosine residue of the PAT-3 membrane distal NPxY motif: wild type 801NPVY804 to NPVA804 [alanine, pat-3(kq8041)], NPVE804 [glutamate, pat-3(kq8042)], or NPVF804 [phenylalanine, (pat-3(kq8043)] (Bumm et al., 2025; Hanna et al., 2020). These mutations are expected to disrupt the tyrosine residue (A), mimic tyrosine phosphorylation (E), or mimic non-phosphorylatable tyrosine (F), respectively. Consistent with previous studies (Lemons et al., 2024; Oliver et al., 2022; Philbrook et al., 2018), we observed roughly 8 dendritic spines in a 15 μm region anterior to the DD1 GABAergic neuron cell body of wild-type larval stage 4 (L4) animals (Figure 1A-C). The number of dendritic spines on GABAergic DD1 neurons was significantly reduced by 43±6% in pat-3(kq8042) animals carrying a Y>E substitution (Figure 1B,C). Surprisingly, some spines appeared dorsally rather than ventrally oriented in these animals (Figure 1B, D), suggesting either misdirected spine growth or the possibility of ectopic synaptic contacts. Substitution of the negatively charged glutamic acid (E) for tyrosine (Y) in pat-3(kq8042) animals is predicted to mimic tyrosine phosphorylation (Anthis et al., 2009; Qiu et al., 2019; Reszka et al., 1992). Previous studies suggest phosphorylation of the distal NPxY motif disrupts kindlin binding, therefore disabling kindlin's ability to co-activate integrin (Bledzka et al., 2010; Harburger et al., 2009). Our findings suggest that constitutive tyrosine phosphorylation disrupts dendritic spines, perhaps by impacting interactions with kindlin/UNC-112 or other modulators of integrin activation that act through this motif.
To ask whether the effects of the PAT-3 Y/E substitution were specific to the post-synapse or affected both pre- and postsynaptic specializations, we examined the distribution of the GFP-tagged active zone marker CLA-1 (Xuan et al., 2017) in cholinergic neurons, which are presynaptic partners to GABAergic motor neurons. As expected, CLA-1::GFP puncta were observed on the ventral side of ventrally directed spines in wild-type controls (Figure 1E), indicating presynaptic specializations opposing the dendritic spines. We found that the number of CLA-1::GFP puncta within a 50 μm region of the anterior ventral nerve cord was significantly decreased in pat-3(kq8042) animals compared to controls (Figure 1F), while the size of CLA-1::GFP puncta slightly increased (Figure 1G). These findings demonstrate that both pre- and postsynaptic specializations are disrupted in pat-3(kq8042) animals.
We next examined dendritic spines in pat-3(kq8041) and pat-3(kq8043) animals. A tyrosine (Y) to phenylalanine substitution (F) in the NPxY motif in pat-3(kq8043) animals is predicted to preserve hydrophobic interactions associated with tyrosine but eliminate phosphorylation, perhaps acting similarly to a non-phosphorylatable tyrosine residue (Chen et al., 2006; Xu et al., 2010). The tyrosine (Y) to alanine substitution (A) in the NPxY motif of pat-3(kq8041) animals is predicted to disrupt interactions requiring the hydrophobic aromatic ring of tyrosine as well as phosphorylation at this site (Chen et al., 2006). Surprisingly, we found that spine number was not significantly different in either of these mutants compared to wild-type animals (Figure 1B,C). Although work to date suggests the membrane-proximal and -distal NPxY motifs have independent binding partners, we can't rule out the possibility that redundancy across the motifs contributes to these findings.
Prior analysis of membrane distal NPxY substitutions revealed that all three substitutions produced defects in the migration of gonadal distal tip cells (Hanna et al., 2020). In contrast, our finding that solely the phosphomimetic Y/E substitution disrupts dendritic spines is more consistent with recent studies of neuronal function in these strains, where the phosphomimetic E substitution produced severe effects, while the A and F substitutions did not (Bumm et al., 2025). Together, our results argue that tyrosine phosphorylation at the distal NPxY motif of PAT-3 is not essential for spine outgrowth, but may instead have a modulatory role, perhaps by influencing integrin interaction with kindlin/UNC-112 (Bledzka et al., 2010; Qadota et al., 2012).
","references":[{"reference":"Anthis NJ, Haling JR, Oxley CL, Memo M, Wegener KL, Lim CJ, Ginsberg MH, Campbell ID. 2009. Beta integrin tyrosine phosphorylation is a conserved mechanism for regulating talin-induced integrin activation. J Biol Chem 284(52): 36700-36710.
","pubmedId":"19843520","doi":""},{"reference":"Baum PD, Garriga G. 1997. Neuronal migrations and axon fasciculation are disrupted in ina-1 integrin mutants. Neuron. 19: 51-62. 1047.","pubmedId":"9247263","doi":""},{"reference":"Bledzka K, Bialkowska K, Nie H, Qin J, Byzova T, Wu C, Plow EF, Ma YQ. 2010. Tyrosine phosphorylation of integrin beta3 regulates kindlin-2 binding and integrin activation. J Biol Chem 285(40): 30370-4.
","pubmedId":"20702409","doi":""},{"reference":"Bumm JH, Lee DD, Qiu Z, Choi AH, Kolluri M, Olsen MJ, Wang L, Lee M. 2025. The beta integrin modulates serotonin sensitivity via NPxY motifs to regulate egg laying and mechanosensation behaviors in Caenorhabditis elegans. Dev Dyn 1442.","pubmedId":"41117756","doi":"10.1002/dvdy.70090"},{"reference":"Calderwood DA. 2004. Talin controls integrin activation. Biochem Soc Trans. 32: 434-7. 675.","pubmedId":"15157154","doi":"10.1042/BST0320434"},{"reference":"Calderwood DA. 2004. Integrin activation. J Cell Sci. 117: 657-66. 676.","pubmedId":"14754902","doi":"10.1242/jcs.01014"},{"reference":"Calderwood DA, Campbell ID, Critchley DR. 2013. Talins and kindlins: partners in integrin-mediated adhesion. Nat Rev Mol Cell Biol 14(8): 503-17.
","pubmedId":"23860236","doi":""},{"reference":"Calderwood DA, Yan B, de Pereda JM, Alvarez BG, Fujioka Y, Liddington RC, Ginsberg MH. 2002. The phosphotyrosine binding-like domain of talin activates integrins. J Biol Chem 277(24): 21749-58.
","pubmedId":"11932255","doi":""},{"reference":"Campbell ID, Humphries MJ. 2011. Integrin structure, activation, and interactions. Cold Spring Harb Perspect Biol 3(3): 10.1101/cshperspect.a004994.
","pubmedId":"21421922","doi":""},{"reference":"Chen H, Zou Z, Sarratt KL, Zhou D, Zhang M, Sebzda E, Hammer DA, Kahn ML. 2006. In vivo beta1 integrin function requires phosphorylation-independent regulation by cytoplasmic tyrosines. Genes Dev 20(8): 927-32.
","pubmedId":"16618804","doi":""},{"reference":"Chisholm AD, Hutter H, Jin Y, Wadsworth WG. 2016. The Genetics of Axon Guidance and Axon Regeneration in Caenorhabditis elegans. Genetics. 204: 849-882. 1406.","pubmedId":"28114100","doi":"10.1534/genetics.115.186262"},{"reference":"Cuentas-Condori A, Mulcahy B, He S, Palumbos S, Zhen M, Miller DM 3rd. 2019. C. elegans neurons have functional dendritic spines. Elife 8: 10.7554/eLife.47918.
","pubmedId":"31584430","doi":""},{"reference":"Czuchra A, Meyer H, Legate KR, Brakebusch C, Fässler R. 2006. Genetic analysis of beta1 integrin \"activation motifs\" in mice. J Cell Biol 174(6): 889-99.
","pubmedId":"16954348","doi":""},{"reference":"de Wit J, Ghosh A. 2016. Specification of synaptic connectivity by cell surface interactions. Nat Rev Neurosci 17(1): 22-35.
","pubmedId":"26656254","doi":""},{"reference":"Dityatev A, Schachner M, Sonderegger P. 2010. The dual role of the extracellular matrix in synaptic plasticity and homeostasis. Nat Rev Neurosci. 11: 735-46. 1242.","pubmedId":"20944663","doi":"10.1038/nrn2898"},{"reference":"Drapeau P, Catarsi S, Merz DC. 1995. Signalling synapse formation between identified neurons. J Physiol Paris 89(3): 115-23.
","pubmedId":"7581300","doi":""},{"reference":"Fässler R, Meyer M. 1995. Consequences of lack of beta 1 integrin gene expression in mice. Genes Dev 9(15): 1896-908.
","pubmedId":"7544313","doi":""},{"reference":"Forrester WC, Garriga G. 1997. Genes necessary for C. elegans cell and growth cone migrations. Development. 124: 1831-43. 1053.","pubmedId":"9165130","doi":""},{"reference":"Gettner SN, Kenyon C, Reichardt LF. 1995. Characterization of beta pat-3 heterodimers, a family of essential integrin receptors in C. elegans. J Cell Biol. 129: 1127-41. 1080.","pubmedId":"7744961","doi":""},{"reference":"Giancotti FG, Ruoslahti E. 1999. Integrin signaling. Science. 285: 1028-32. 363.","pubmedId":"10446041","doi":""},{"reference":"Ginsberg MH. 2014. Integrin activation. BMB Rep. 47: 655-9. 1163.","pubmedId":"25388208","doi":""},{"reference":"Hanna J, Ramani S, Williams T, Anaya R, Campion N, Lopez E, et al., Lee M. 2020. Three alleles in the pat-3 locus of Caenorhabditis elegans: mutations in the membrane-distal NPxY phosphotyrosine motif. MicroPubl Biol. 2020 1441.","pubmedId":"32821887","doi":"10.17912/micropub.biology.000291"},{"reference":"He S, Philbrook A, Mc Whirter R, Gabel CV, Taub DG, Carter MH, et al., Miller DM. 2015. Transcriptional Control of Synaptic Remodeling through Regulated Expression of an Immunoglobulin Superfamily Protein. Curr Biol. 25: 2541-8. 1161.","pubmedId":"26387713","doi":"10.1016/j.cub.2015.08.022"},{"reference":"Humphries JD, Byron A, Humphries MJ. 2006. Integrin ligands at a glance. J Cell Sci. 119: 3901-3. 856.","pubmedId":"16988024","doi":"119/19/3901 [pii] 10.1242/jcs.03098"},{"reference":"Hynes RO. 1992. Integrins: versatility, modulation, and signaling in cell adhesion. Cell. 69: 11-25.. 97.","pubmedId":"","doi":""},{"reference":"Hynes RO. 2002. Integrins: bidirectional, allosteric signaling machines. Cell. 110: 673-87. 865.","pubmedId":"12297042","doi":"S0092867402009716"},{"reference":"Jannuzi AL, Bunch TA, Brabant MC, Miller SW, Mukai L, Zavortink M, Brower DL. 2002. Disruption of C-terminal cytoplasmic domain of betaPS integrin subunit has dominant negative properties in developing Drosophila. Mol Biol Cell 13(4): 1352-65.
","pubmedId":"11950944","doi":""},{"reference":"Jannuzi AL, Bunch TA, West RF, Brower DL. 2004. Identification of integrin beta subunit mutations that alter heterodimer function in situ. Mol Biol Cell 15(8): 3829-40.
","pubmedId":"15194810","doi":""},{"reference":"Kääpä A, Peter K, Ylänne J. 1999. Effects of mutations in the cytoplasmic domain of integrin beta(1) to talin binding and cell spreading. Exp Cell Res 250(2): 524-34.
","pubmedId":"10413605","doi":""},{"reference":"Kim C, Ye F, Ginsberg MH. 2011. Regulation of integrin activation. Annu Rev Cell Dev Biol. 27: 321-45. 1152.","pubmedId":"21663444","doi":"10.1146/annurev-cellbio-100109-104104"},{"reference":"Kramer JM. 2005. Basement membranes. WormBook: 1-15.
","pubmedId":"18050423","doi":""},{"reference":"Lee M, Cram EJ, Shen B, Schwarzbauer JE. 2001. Roles for beta(pat-3) integrins in development and function of Caenorhabditis elegans muscles and gonads. J Biol Chem. 276: 36404-10. 1167.","pubmedId":"11473126","doi":"10.1074/jbc.M105795200"},{"reference":"Lemons M L, McKillop H, Genao N, Francis M M. 2024. The extracellular matrix molecule Collagen XVIII/CLE-1 affects neuronal dendritic spines. MicroPubl Biol 2024: 10.17912/micropub.biology.001331.
","pubmedId":"39568805","doi":""},{"reference":"Liddington RC, Ginsberg MH. 2002. Integrin activation takes shape. J Cell Biol. 158: 833-9. 688.","pubmedId":"12213832","doi":"10.1083/jcb.200206011 cb.200206011 [pii]"},{"reference":"Lilja J, Ivaska J. 2018. Integrin activity in neuronal connectivity. J Cell Sci 131(12): pii: jcs212803. 10.1242/jcs.212803.
","pubmedId":"29907643","doi":""},{"reference":"Mello CC, Kramer JM, Stinchcomb D, Ambros V. 1991. Efficient gene transfer in C.elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J. 10: 3959-70. 1413.","pubmedId":"1935914","doi":""},{"reference":"Morse EM, Brahme NN, Calderwood DA. 2014. Integrin Cytoplasmic\nTail Interactions. Biochemistry 53: 810-820.
","pubmedId":"","doi":"10.1021/bi401596q"},{"reference":"Moser M, Legate KR, Zent R, Fassler R. 2009. The tail of integrins, talin, and kindlins. Science. 324: 895-9. 689.","pubmedId":"19443776","doi":"324/5929/895 [pii]10.1126/science.1163865"},{"reference":"Nakamoto T, Kain KH, Ginsberg MH. 2004. Neurobiology: New connections between integrins and axon guidance. Curr Biol. 14: R121-3. 412.","pubmedId":"14986683","doi":""},{"reference":"Oliver D, Norman E, Bates H, Avard R, Rettler M, Bénard CY, Francis MM, Lemons ML. 2019. Integrins Have Cell-Type-Specific Roles in the Development of Motor Neuron Connectivity. J Dev Biol 7(3): 10.3390/jdb7030017.
","pubmedId":"31461926","doi":""},{"reference":"Oliver D, Ramachandran S, Philbrook A, Lambert CM, Nguyen KCQ, Hall DH, Francis MM. 2022. Kinesin-3 mediated axonal delivery of presynaptic neurexin stabilizes dendritic spines and postsynaptic components. PLoS Genet 18(1): e1010016.
","pubmedId":"35089924","doi":""},{"reference":"Oliver DB, Ramachandran S, Biswas K, Bénard CY, Doitsidou M, McKillop H, et al., Francis MM. 2026. Genome-wide analysis reveals pathways important for the development and maturation of excitatory synaptic connections to GABAergic neurons. G3 (Bethesda) 16(4): 10.1093/g3journal/jkag028.
","pubmedId":"41655250","doi":""},{"reference":"Park YK, Goda Y. 2016. Integrins in synapse regulation. Nat Rev Neurosci. 17: 745-756. 1226.","pubmedId":"27811927","doi":"10.1038/nrn.2016.138"},{"reference":"Philbrook A, Ramachandran S, Lambert CM, Oliver D, Florman J, Alkema MJ, Lemons M, Francis MM. 2018. Neurexin directs partner-specific synaptic connectivity in C. elegans. Elife. 7 1401.","pubmedId":"30039797","doi":"10.7554/eLife.35692"},{"reference":"Poinat P, De Arcangelis A, Sookhareea S, Zhu X, Hedgecock EM, Labouesse M, Georges Labouesse E. 2002. A conserved interaction between beta1 integrin/PAT-3 and Nck-interacting kinase/MIG-15 that mediates commissural axon navigation in C. elegans. Curr Biol. 12: 622-31. 1055.","pubmedId":"11967148","doi":""},{"reference":"Qadota H, Moerman DG, Benian GM. 2012. A Molecular Mechanism for the Requirement of PAT-4 (Integrin-linked Kinase (ILK)) for the Localization of UNC-112 (Kindlin) to Integrin Adhesion Sites. Journal of Biological Chemistry 287: 28537-28551.
","pubmedId":"","doi":"10.1074/jbc.M112.354852"},{"reference":"Qiu Z, Sheesley P, Ahn JH, Yu EJ, Lee M. 2019. A Novel Mutation in an NPXY Motif of β Integrin Reveals Phenotypes Similar to him-4/hemicentin. Front Cell Dev Biol 7: 247.
","pubmedId":"31720287","doi":""},{"reference":"Reszka AA, Hayashi Y, Horwitz AF. 1992. Identification of amino acid sequences in the integrin beta 1 cytoplasmic domain implicated in cytoskeletal association. J Cell Biol 117(6): 1321-30.
","pubmedId":"1376731","doi":""},{"reference":"Sakai T, Zhang Q, Fässler R, Mosher DF. 1998. Modulation of beta1A integrin functions by tyrosine residues in the beta1 cytoplasmic domain. J Cell Biol 141(2): 527-38.
","pubmedId":"9548729","doi":""},{"reference":"Sonnenberg A. 1993. Integrins and their ligands. Curr Top Microbiol Immunol. 184: 7-35. 1414.","pubmedId":"8313723","doi":""},{"reference":"Waites CL, Craig AM, Garner CC. 2005. Mechanisms of vertebrate synaptogenesis. Annu Rev Neurosci 28: 251-74.
","pubmedId":"16022596","doi":""},{"reference":"Wang JH. 2012. Pull and push: talin activation for integrin signaling. Cell Res 22(11): 1512-4.
","pubmedId":"22777425","doi":""},{"reference":"Xu X, Ahn JH, Tam P, Yu EJ, Batra S, Cram EJ, Lee M. 2010. Analysis of conserved residues in the betapat-3 cytoplasmic tail reveals important functions of integrin in multiple tissues. Dev Dyn 239(3): 763-72.
","pubmedId":"20063417","doi":""},{"reference":"Xuan Z, Manning L, Nelson J, Richmond JE, Colón-Ramos DA, Shen K, Kurshan PT. 2017. Clarinet (CLA-1), a novel active zone protein required for synaptic vesicle clustering and release. Elife 6: 10.7554/eLife.29276.
","pubmedId":"29160205","doi":""},{"reference":"Ye F, Snider AK, Ginsberg MH. 2014. Talin and kindlin: the one-two punch in integrin activation. Front Med 8(1): 6-16.
","pubmedId":"24477625","doi":""}],"title":"A mutation in the conserved NPxY motif of β integrin PAT-3 alters outgrowth of neuronal dendritic spines
","reviews":[],"curatorReviews":[{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":"1793383029408"}]},{"id":"3ded31bf-4777-48d6-9115-073af70c5c9b","decision":"edit","abstract":"Integrins are heterodimeric transmembrane receptors that are critical in many biological processes, including neuronal development. Here we investigate integrin signaling in the outgrowth of dendritic spines on C. elegans GABAergic neurons using mutations engineered within the membrane-distal NPxY motif of the β integrin subunit PAT-3. We found a Y/E substitution, but not Y/A or Y/F substitutions, reduced dendritic spine number and misoriented spines. The Y/E substitution in the NPxY motif also altered the distribution of the presynaptic scaffold CLA-1, suggesting roles in both pre- and postsynaptic development. Our findings implicate integrin activation through the NPxY motif in synapse formation/maturation.
","acknowledgements":"We thank Dr. Shankar Ramachandran for technical assistance. We also thank Emily Norman for helpful comments and suggestions.
","authors":[{"affiliations":["Assumption University, Windsor, ON, Canada","University of Massachusetts Chan Medical School"],"departments":["Department of Biological and Physical Sciences, Worcester, MA, USA","Department of Neurobiology, Worcester, MA, USA"],"credit":["conceptualization","investigation","fundingAcquisition","supervision","writing_originalDraft","methodology","dataCuration","formalAnalysis"],"email":"mlemons@assumption.edu","firstName":"Michele L","lastName":"Lemons","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-8459-4130"},{"affiliations":["Assumption University"],"departments":["Department of Biological and Physical Sciences, Worcester, MA, USA"],"credit":["dataCuration","visualization","investigation"],"email":"Noelia.GenaoGarcia@umassmed.edu","firstName":"Noelia","lastName":"Genao","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0007-1611-452X"},{"affiliations":["Assumption University"],"departments":["Department of Biological and Physical Sciences, Worcester, MA, USA"],"credit":["investigation","validation","visualization","dataCuration"],"email":"hailey.mckillop@umassmed.edu","firstName":"Hailey","lastName":"McKillop","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0001-5582-6964"},{"affiliations":["University of Massachusetts Chan Medical School"],"departments":["Department of Neurobiology, Worcester, MA, USA"],"credit":["conceptualization","methodology","project","supervision","writing_reviewEditing","fundingAcquisition","investigation","resources"],"email":"michael.francis@umassmed.edu","firstName":"Michael M","lastName":"Francis","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-8076-6668"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work was supported by a collaborative RUI grant from the National Science Foundation, Division of Integrative Organismal Systems IOS1754986 (M.L.L.) and IOS1755019 (M.M.F.)
","image":{"url":"https://portal.micropublication.org/uploads/7280e660e59ce41f5cad570b8de5cb52.png"},"imageCaption":"A) Maximum projection confocal image of the C. elegans GABAergic DD1 neuron dendritic shaft (inverted LUT grey scale) labeled by transcriptional expression of myristoylated GFP (myrGFP). pGABA::myrGFP in top image refers to cell specific transcriptional expression of myrGFP in DD GABAergic neurons using the flp-13 promoter. Bottom panel is a cartoon representation of the top image and includes red carets pointing to ventrally directed spines protruding from the dendritic shaft. All images are from larval stage 4 animals and oriented with anterior to the left and ventral towards the bottom, as indicated by arrows. Scale bar, 5 μm. B) Inverted maximal projection images showing DD1 dendritic spines of wildtype, pat-3(kq8041), pat-3(kq8042) and pat-3(kq8043) animals. Scale bar, 5 μm. C) Scatterplot of the total number of spines within a 15 μm region of DD1 neurons in wild-type animals and pat-3 mutants. The number of spines in pat-3(kq8042) animals is significantly decreased compared to wildtype, pat-3(kq8041), and pat-3(kq8043) animals. Each data point represents a measurement from an independent animal. Red horizontal bar indicates the mean. *p<0.05, **p<0.005, *** p<0.0005, Kruskal Wallis test. D) Number of dorsally directed spines per animal shown as a scatterplot. Dorsally directed spines are significantly increased in pat-3(kq8042) compared to wild type. Red horizontal bar indicates the mean. Inset image of pat-3(kq8042) animal with carets pointing to dorsally directed spines. *p<0.05, **p<0.005, ***p<0.0005, Kruskal Wallis test. Scale bar, 2 μm. E) Maximum projection confocal images of C. elegans GABAergic DD1 neuron dendritic shaft and spines (red) and presynaptic protein CLA-1 (green). pGABA::mCherry refers to transgenic expression of the red fluorescent marker mCherry in GABAergic DD neurons (flp-13 promoter). pACh::CLA-1::GFP refers to expression of the active zone protein CLA-1 tagged with green fluorescent protein (GFP) in cholinergic neurons (unc-17 beta promoter), including those that are presynaptic to GABAergic DD motor neurons. Representative images of wild type (left) and pat-3(kq8042) mutants (right) are shown. Scale bar, 5 μm. Scatterplots showing the average number (F) and size (G) of CLA-1::GFP puncta per animal within a 50 μm anterior most portion of ventral nerve cord. Each dot represents a single animal. The number of CLA-1::GFP clusters is decreased and the size of CLA-1::GFP clusters is increased in pat-3(kq8042) animals compared to wild-type controls. ***p<0.0005, **p<0.005, Mann Whitney test.
","imageTitle":"
A Y/E substitution in the membrane distal NPxY motif of the cytoplasmic tail of β integrin/pat-3 disrupts dendritic spines
","methods":"Strains
All strains used in these experiments are listed in Table 1. Strains are N2 Bristol strain derivatives (wildtype) and were maintained at room temperature on nematode growth media plates seeded with E. coli strain OP50. Some strains were kindly shared by the Lee lab at Baylor University (Hanna et al., 2020). Transgenic strains were obtained by microinjection to achieve transformation (Mello et al., 1991) and identified by using co-injection markers. Integrated lines were produced with X-ray irradiation and outcrossed to wild type/N2 Bristol eight times. Only larval stage 4 (L4) hermaphrodites were used in this study.
Confocal microscopy and analysis
Animals were immobilized in sodium azide (0.3 M) on a 2% agarose pad. Images of dendrites of the DD1 neuron shown in Panels A, B and D were obtained using a Yokogawa CSU-10 spinning disk confocal system on an upright Olympus BX51WI microscope equipped with a Hammamatsu C9100-13 EMCCD camera and 63X oil immersion objective. A Cobolt Calypso 491 nm laser was used for excitation, and images were acquired using Volocity 4.3 software (Perkin-Elmer). All images were obtained using identical imaging and laser settings. Z stack volumes were acquired using an objective-coupled Piezo. Image analysis was conducted using Fiji software (open source) as described previously (He et al., 2015; Lemons et al., 2024; Oliver et al., 2022; Philbrook et al., 2018). Briefly, spines that were at least 0.2 μm in length were counted within a 15 µm region of interest (ROI) anterior to the DD1 cell soma.
Images in Panel E were obtained on a Yokogawa CSU-Z1 spinning disk confocal mounted on a Nikon NiE upright motorized microscope equipped with a Nikon 60x oil immersion objective and a Prime BSI Express CMOS camera (Teledyne Vision Solutions). Z stack images were acquired using Nikon Elements software, using identical imaging and laser settings. CLA-1::GFP puncta number and size were measured within a 50 µm region of the anterior ventral nerve cord using the analyze particles function in Image J.
","reagents":"Primers used to confirm pat-3 (kq8041), pat-3 (kq8042) and pat-3 (kq8043).
Forward primer OMF 3153 (primer in Exon 7 in pat-3 transcript): ggccacagataatgcaacag. Reverse primer OMF3141: (primer in downstream UTR): acaatttatcgctaaatactcgtt. PCR generated 436bp product. Product was sequenced using forward primer OMF3140 (in exon 7): catgatagatccgaatacgc
Table 1. Worm strains
Strain | Genotype | Description | Plasmid | Shortened name |
DD-specific myristoylated (myr) GFP transcriptional reporter (green) | pGABA::myrGFP = ufIs175 | |||
CRISPR engineered pat-3 mutation changes NPVY to NPVA (Hanna et al., 2020) |
| |||
CRISPR engineered pat-3 mutation changes NPVY to NPVE (Hanna et al., 2020) |
| |||
CRISPR engineered pat-3 mutation changes NPVY to NPVF (Hanna et al., 2020) |
| |||
DD-specific myrGFP transcriptional reporter (green) | pGABA::myrGFP = ufIs175 | |||
DD-specific myrGFP transcriptional reporter (green) | pGABA::myrGFP = ufIs175 | |||
DD-specific myrGFP transcriptional reporter (green) | pGABA::myrGFP = ufIs175 | |||
DD-specific mCherry transcriptional reporter (red), extrachromosomal array with cholinergic promoter driving CLA-1::green fluorescent protein (GFP) expression | ufIs128 [Pflp-13::mCherry+ Plgc-11::mCherry]; ufEx1679 [Punc-17β::GFPnovo2::cla-1 + Plgc-11::GFP]
| pGABA::mCherry = ufIs128 | ||
DD-specific mCherry transcriptional reporter (red), extrachromosomal array with cholinergic promoter driving CLA-1::green fluorescent protein (GFP) expression | ufIs128 [Pflp-13::mCherry+ Plgc-11::mCherry]; ufEx1679 [Punc-17β::GFPnovo2::cla-1 + Plgc-11::GFP] | pGABA::mCherry = ufIs128 |
Synapse formation involves a sequence of carefully orchestrated molecular interactions to concentrate synaptic vesicles and release machinery at precisely defined sites opposite clusters of post-synaptic neurotransmitter receptors (Drapeau et al., 1995; Waites et al., 2005). Many studies have identified shared groups of proteins that form the core pre- and post-synaptic scaffolds, but the events that initiate synapse assembly and maturation often vary at the level of individual neurons and synapses. Mounting evidence indicates that integrin family members have key roles in synapse assembly and maturation (de Wit & Ghosh, 2016; Dityatev et al., 2010; Lilja & Ivaska, 2018; Park & Goda, 2016). Integrins are transmembrane extracellular matrix receptors that function as αβ heterodimers (Campbell & Humphries, 2011; Giancotti & Ruoslahti, 1999; Hynes, 1992, 2002). Integrins bind a variety of ligands including extracellular matrix, cell adhesion and axon guidance proteins, as well as intracellular signaling machinery such as talin and kindlin (Humphries et al., 2006; Moser et al., 2009; Nakamoto et al., 2004; Sonnenberg, 1993; Ye et al., 2014). At least 24 different integrin combinations are formed from 18 α and 8 β subunits in mammals, while the invertebrate model C. elegans forms only two integrin heterodimers (Fassler & Meyer, 1995) composed of one α subunit (INA-1 or PAT-2) and a sole β subunit (PAT-3)(Gettner et al., 1995; Kramer, 2005).
Integrin function is greatly influenced by conformational state, integrins shift between low- (inactivated) and high-ligand affinity (activated) states. Integrin activation can be triggered by cytoplasmic signaling, known as “inside-out” activation (Calderwood, 2004a; Ginsberg, 2014; Kim et al., 2011; Liddington & Ginsberg, 2002; Wang, 2012). Inside-out activation is mediated through interactions between phosphotyrosine binding (PTB) domain proteins (including talin, kindlin) and cytoplasmic NPxY (asp-pro-x-tyr) motifs in the β integrin cytoplasmic domain (Bumm et al., 2025; Czuchra et al., 2006; Hanna et al., 2020; Jannuzi et al., 2002; Jannuzi et al., 2004; Kaapa et al., 1999; Lee et al., 2001; Sakai et al., 1998). The cytoplasmic tail of β integrin has two NPxY motifs, the membrane-proximal motif is proposed to interact with talin while the membrane-distal motif has been shown to interact with kindlin (Morse et al., 2014). Tyrosine phosphorylation of the NPxY motifs regulates the binding of PTB domain containing proteins, implicating NPxY motifs as molecular switches for integrin activation and signaling (Bledzka et al., 2010; Calderwood, 2004a, 2004b; Calderwood et al., 2013; Calderwood et al., 2002; Liddington & Ginsberg, 2002). While null mutations in the gene encoding the C. elegans β integrin pat-3 are lethal, viable CRISPR-engineered mutations targeting the membrane-distal NPXY motif of PAT-3 were recently generated (Bumm et al., 2025; Hanna et al., 2020). Building upon previous studies from our lab and others that implicate integrins in the outgrowth of GABAergic axons (Baum & Garriga, 1997; Chisholm et al., 2016; Forrester & Garriga, 1997; Oliver et al., 2019; Poinat et al., 2002), we sought to employ these NPxY engineered mutants to investigate integrin signaling in the formation of previously characterized dendritic spines in C. elegans GABAergic neurons (Cuentas-Condori et al., 2019; Lemons et al., 2024; Oliver et al., 2022; Oliver et al., 2026; Philbrook et al., 2018).
To investigate the role of integrin activation through the β integrin/PAT-3 NPxY motif in spine outgrowth, we used cell-specific expression of myristoylated green fluorescent protein (myrGFP) to visualize GABAergic dendrites in 3 available strains carrying CRISPR-engineered mutations in the conserved tyrosine residue of the PAT-3 membrane distal NPxY motif: wild type 801NPVY804 to NPVA804 [alanine, pat-3(kq8041)], NPVE804 [glutamate, pat-3(kq8042)], or NPVF804 [phenylalanine, (pat-3(kq8043)] (Bumm et al., 2025; Hanna et al., 2020). These mutations are expected to disrupt the tyrosine residue (A), mimic tyrosine phosphorylation (E), or mimic non-phosphorylatable tyrosine (F), respectively. Consistent with previous studies (Lemons et al., 2024; Oliver et al., 2022; Philbrook et al., 2018), we observed roughly 8 dendritic spines in a 15 μm region anterior to the DD1 GABAergic neuron cell body of wild-type larval stage 4 (L4) animals (Figure 1A-C). The number of dendritic spines on GABAergic DD1 neurons was significantly reduced by 43±6% in pat-3(kq8042) animals carrying a Y>E substitution (Figure 1B,C). Surprisingly, some spines appeared dorsally rather than ventrally oriented in these animals (Figure 1B, D), suggesting either misdirected spine growth or the possibility of ectopic synaptic contacts. Substitution of the negatively charged glutamic acid (E) for tyrosine (Y) in pat-3(kq8042) animals is predicted to mimic tyrosine phosphorylation (Anthis et al., 2009; Qiu et al., 2019; Reszka et al., 1992). Previous studies suggest phosphorylation of the distal NPxY motif disrupts kindlin binding, therefore disabling kindlin's ability to co-activate integrin (Bledzka et al., 2010; Harburger et al., 2009). Our findings suggest that constitutive tyrosine phosphorylation disrupts dendritic spines, perhaps by impacting interactions with kindlin/UNC-112 or other modulators of integrin activation that act through this motif.
To ask whether the effects of the PAT-3 Y/E substitution were specific to the post-synapse or affected both pre- and postsynaptic specializations, we examined the distribution of the GFP-tagged active zone marker CLA-1 (Xuan et al., 2017) in cholinergic neurons, which are presynaptic partners to GABAergic motor neurons. As expected, CLA-1::GFP puncta were observed on the ventral side of ventrally directed spines in wild-type controls (Figure 1E), indicating presynaptic specializations opposing the dendritic spines. We found that the number of CLA-1::GFP puncta within a 50 μm region of the anterior ventral nerve cord was significantly decreased in pat-3(kq8042) animals compared to controls (Figure 1F), while the size of CLA-1::GFP puncta slightly increased (Figure 1G). These findings demonstrate that both pre- and postsynaptic specializations are disrupted in pat-3(kq8042) animals.
We next examined dendritic spines in pat-3(kq8041) and pat-3(kq8043) animals. A tyrosine (Y) to phenylalanine substitution (F) in the NPxY motif in pat-3(kq8043) animals is predicted to preserve hydrophobic interactions associated with tyrosine but eliminate phosphorylation, perhaps acting similarly to a non-phosphorylatable tyrosine residue (Chen et al., 2006; Xu et al., 2010). The tyrosine (Y) to alanine substitution (A) in the NPxY motif of pat-3(kq8041) animals is predicted to disrupt interactions requiring the hydrophobic aromatic ring of tyrosine as well as phosphorylation at this site (Chen et al., 2006). Surprisingly, we found that spine number was not significantly different in either of these mutants compared to wild-type animals (Figure 1B,C). Although work to date suggests the membrane-proximal and -distal NPxY motifs have independent binding partners, we can't rule out the possibility that redundancy across the motifs contributes to these findings.
Prior analysis of membrane distal NPxY substitutions revealed that all three substitutions produced defects in the migration of gonadal distal tip cells (Hanna et al., 2020). In contrast, our finding that solely the phosphomimetic Y/E substitution disrupts dendritic spines is more consistent with recent studies of neuronal function in these strains, where the phosphomimetic E substitution produced severe effects, while the A and F substitutions did not (Bumm et al., 2025). Together, our results argue that tyrosine phosphorylation at the distal NPxY motif of PAT-3 is not essential for spine outgrowth, but may instead have a modulatory role, perhaps by influencing integrin interaction with kindlin/UNC-112 (Bledzka et al., 2010; Qadota et al., 2012).
","references":[{"reference":"Anthis NJ, Haling JR, Oxley CL, Memo M, Wegener KL, Lim CJ, Ginsberg MH, Campbell ID. 2009. Beta integrin tyrosine phosphorylation is a conserved mechanism for regulating talin-induced integrin activation. J Biol Chem 284(52): 36700-36710.
","pubmedId":"19843520","doi":""},{"reference":"Baum PD, Garriga G. 1997. Neuronal migrations and axon fasciculation are disrupted in ina-1 integrin mutants. Neuron. 19: 51-62. 1047.","pubmedId":"9247263","doi":""},{"reference":"Bledzka K, Bialkowska K, Nie H, Qin J, Byzova T, Wu C, Plow EF, Ma YQ. 2010. Tyrosine phosphorylation of integrin beta3 regulates kindlin-2 binding and integrin activation. J Biol Chem 285(40): 30370-4.
","pubmedId":"20702409","doi":""},{"reference":"Bumm JH, Lee DD, Qiu Z, Choi AH, Kolluri M, Olsen MJ, Wang L, Lee M. 2025. The beta integrin modulates serotonin sensitivity via NPxY motifs to regulate egg laying and mechanosensation behaviors in Caenorhabditis elegans. Dev Dyn 1442.","pubmedId":"41117756","doi":"10.1002/dvdy.70090"},{"reference":"Calderwood DA. 2004. Talin controls integrin activation. Biochem Soc Trans. 32: 434-7. 675.","pubmedId":"15157154","doi":"10.1042/BST0320434"},{"reference":"Calderwood DA. 2004. Integrin activation. J Cell Sci. 117: 657-66. 676.","pubmedId":"14754902","doi":"10.1242/jcs.01014"},{"reference":"Calderwood DA, Campbell ID, Critchley DR. 2013. Talins and kindlins: partners in integrin-mediated adhesion. Nat Rev Mol Cell Biol 14(8): 503-17.
","pubmedId":"23860236","doi":""},{"reference":"Calderwood DA, Yan B, de Pereda JM, Alvarez BG, Fujioka Y, Liddington RC, Ginsberg MH. 2002. The phosphotyrosine binding-like domain of talin activates integrins. J Biol Chem 277(24): 21749-58.
","pubmedId":"11932255","doi":""},{"reference":"Campbell ID, Humphries MJ. 2011. Integrin structure, activation, and interactions. Cold Spring Harb Perspect Biol 3(3): 10.1101/cshperspect.a004994.
","pubmedId":"21421922","doi":""},{"reference":"Chen H, Zou Z, Sarratt KL, Zhou D, Zhang M, Sebzda E, Hammer DA, Kahn ML. 2006. In vivo beta1 integrin function requires phosphorylation-independent regulation by cytoplasmic tyrosines. Genes Dev 20(8): 927-32.
","pubmedId":"16618804","doi":""},{"reference":"Chisholm AD, Hutter H, Jin Y, Wadsworth WG. 2016. The Genetics of Axon Guidance and Axon Regeneration in Caenorhabditis elegans. Genetics. 204: 849-882. 1406.","pubmedId":"28114100","doi":"10.1534/genetics.115.186262"},{"reference":"Cuentas-Condori A, Mulcahy B, He S, Palumbos S, Zhen M, Miller DM 3rd. 2019. C. elegans neurons have functional dendritic spines. Elife 8: 10.7554/eLife.47918.
","pubmedId":"31584430","doi":""},{"reference":"Czuchra A, Meyer H, Legate KR, Brakebusch C, Fässler R. 2006. Genetic analysis of beta1 integrin \"activation motifs\" in mice. J Cell Biol 174(6): 889-99.
","pubmedId":"16954348","doi":""},{"reference":"de Wit J, Ghosh A. 2016. Specification of synaptic connectivity by cell surface interactions. Nat Rev Neurosci 17(1): 22-35.
","pubmedId":"26656254","doi":""},{"reference":"Dityatev A, Schachner M, Sonderegger P. 2010. The dual role of the extracellular matrix in synaptic plasticity and homeostasis. Nat Rev Neurosci. 11: 735-46. 1242.","pubmedId":"20944663","doi":"10.1038/nrn2898"},{"reference":"Drapeau P, Catarsi S, Merz DC. 1995. Signalling synapse formation between identified neurons. J Physiol Paris 89(3): 115-23.
","pubmedId":"7581300","doi":""},{"reference":"Fässler R, Meyer M. 1995. Consequences of lack of beta 1 integrin gene expression in mice. Genes Dev 9(15): 1896-908.
","pubmedId":"7544313","doi":""},{"reference":"Forrester WC, Garriga G. 1997. Genes necessary for C. elegans cell and growth cone migrations. Development. 124: 1831-43. 1053.","pubmedId":"9165130","doi":""},{"reference":"Gettner SN, Kenyon C, Reichardt LF. 1995. Characterization of beta pat-3 heterodimers, a family of essential integrin receptors in C. elegans. J Cell Biol. 129: 1127-41. 1080.","pubmedId":"7744961","doi":""},{"reference":"Giancotti FG, Ruoslahti E. 1999. Integrin signaling. Science. 285: 1028-32. 363.","pubmedId":"10446041","doi":""},{"reference":"Ginsberg MH. 2014. Integrin activation. BMB Rep. 47: 655-9. 1163.","pubmedId":"25388208","doi":""},{"reference":"Hanna J, Ramani S, Williams T, Anaya R, Campion N, Lopez E, et al., Lee M. 2020. Three alleles in the pat-3 locus of Caenorhabditis elegans: mutations in the membrane-distal NPxY phosphotyrosine motif. MicroPubl Biol. 2020 1441.","pubmedId":"32821887","doi":"10.17912/micropub.biology.000291"},{"reference":"He S, Philbrook A, Mc Whirter R, Gabel CV, Taub DG, Carter MH, et al., Miller DM. 2015. Transcriptional Control of Synaptic Remodeling through Regulated Expression of an Immunoglobulin Superfamily Protein. Curr Biol. 25: 2541-8. 1161.","pubmedId":"26387713","doi":"10.1016/j.cub.2015.08.022"},{"reference":"Humphries JD, Byron A, Humphries MJ. 2006. Integrin ligands at a glance. J Cell Sci. 119: 3901-3. 856.","pubmedId":"16988024","doi":"119/19/3901 [pii] 10.1242/jcs.03098"},{"reference":"Hynes RO. 1992. Integrins: versatility, modulation, and signaling in cell adhesion. Cell. 69: 11-25.. 97.","pubmedId":"","doi":""},{"reference":"Hynes RO. 2002. Integrins: bidirectional, allosteric signaling machines. Cell. 110: 673-87. 865.","pubmedId":"12297042","doi":"S0092867402009716"},{"reference":"Jannuzi AL, Bunch TA, Brabant MC, Miller SW, Mukai L, Zavortink M, Brower DL. 2002. Disruption of C-terminal cytoplasmic domain of betaPS integrin subunit has dominant negative properties in developing Drosophila. Mol Biol Cell 13(4): 1352-65.
","pubmedId":"11950944","doi":""},{"reference":"Jannuzi AL, Bunch TA, West RF, Brower DL. 2004. Identification of integrin beta subunit mutations that alter heterodimer function in situ. Mol Biol Cell 15(8): 3829-40.
","pubmedId":"15194810","doi":""},{"reference":"Kääpä A, Peter K, Ylänne J. 1999. Effects of mutations in the cytoplasmic domain of integrin beta(1) to talin binding and cell spreading. Exp Cell Res 250(2): 524-34.
","pubmedId":"10413605","doi":""},{"reference":"Kim C, Ye F, Ginsberg MH. 2011. Regulation of integrin activation. Annu Rev Cell Dev Biol. 27: 321-45. 1152.","pubmedId":"21663444","doi":"10.1146/annurev-cellbio-100109-104104"},{"reference":"Kramer JM. 2005. Basement membranes. WormBook: 1-15.
","pubmedId":"18050423","doi":""},{"reference":"Lee M, Cram EJ, Shen B, Schwarzbauer JE. 2001. Roles for beta(pat-3) integrins in development and function of Caenorhabditis elegans muscles and gonads. J Biol Chem. 276: 36404-10. 1167.","pubmedId":"11473126","doi":"10.1074/jbc.M105795200"},{"reference":"Lemons M L, McKillop H, Genao N, Francis M M. 2024. The extracellular matrix molecule Collagen XVIII/CLE-1 affects neuronal dendritic spines. MicroPubl Biol 2024: 10.17912/micropub.biology.001331.
","pubmedId":"39568805","doi":""},{"reference":"Liddington RC, Ginsberg MH. 2002. Integrin activation takes shape. J Cell Biol. 158: 833-9. 688.","pubmedId":"12213832","doi":"10.1083/jcb.200206011 cb.200206011 [pii]"},{"reference":"Lilja J, Ivaska J. 2018. Integrin activity in neuronal connectivity. J Cell Sci 131(12): pii: jcs212803. 10.1242/jcs.212803.
","pubmedId":"29907643","doi":""},{"reference":"Mello CC, Kramer JM, Stinchcomb D, Ambros V. 1991. Efficient gene transfer in C.elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J. 10: 3959-70. 1413.","pubmedId":"1935914","doi":""},{"reference":"Morse EM, Brahme NN, Calderwood DA. 2014. Integrin Cytoplasmic\nTail Interactions. Biochemistry 53: 810-820.
","pubmedId":"","doi":"10.1021/bi401596q"},{"reference":"Moser M, Legate KR, Zent R, Fassler R. 2009. The tail of integrins, talin, and kindlins. Science. 324: 895-9. 689.","pubmedId":"19443776","doi":"324/5929/895 [pii]10.1126/science.1163865"},{"reference":"Nakamoto T, Kain KH, Ginsberg MH. 2004. Neurobiology: New connections between integrins and axon guidance. Curr Biol. 14: R121-3. 412.","pubmedId":"14986683","doi":""},{"reference":"Oliver D, Norman E, Bates H, Avard R, Rettler M, Bénard CY, Francis MM, Lemons ML. 2019. Integrins Have Cell-Type-Specific Roles in the Development of Motor Neuron Connectivity. J Dev Biol 7(3): 10.3390/jdb7030017.
","pubmedId":"31461926","doi":""},{"reference":"Oliver D, Ramachandran S, Philbrook A, Lambert CM, Nguyen KCQ, Hall DH, Francis MM. 2022. Kinesin-3 mediated axonal delivery of presynaptic neurexin stabilizes dendritic spines and postsynaptic components. PLoS Genet 18(1): e1010016.
","pubmedId":"35089924","doi":""},{"reference":"Oliver DB, Ramachandran S, Biswas K, Bénard CY, Doitsidou M, McKillop H, et al., Francis MM. 2026. Genome-wide analysis reveals pathways important for the development and maturation of excitatory synaptic connections to GABAergic neurons. G3 (Bethesda) 16(4): 10.1093/g3journal/jkag028.
","pubmedId":"41655250","doi":""},{"reference":"Park YK, Goda Y. 2016. Integrins in synapse regulation. Nat Rev Neurosci. 17: 745-756. 1226.","pubmedId":"27811927","doi":"10.1038/nrn.2016.138"},{"reference":"Philbrook A, Ramachandran S, Lambert CM, Oliver D, Florman J, Alkema MJ, Lemons M, Francis MM. 2018. Neurexin directs partner-specific synaptic connectivity in C. elegans. Elife. 7 1401.","pubmedId":"30039797","doi":"10.7554/eLife.35692"},{"reference":"Poinat P, De Arcangelis A, Sookhareea S, Zhu X, Hedgecock EM, Labouesse M, Georges Labouesse E. 2002. A conserved interaction between beta1 integrin/PAT-3 and Nck-interacting kinase/MIG-15 that mediates commissural axon navigation in C. elegans. Curr Biol. 12: 622-31. 1055.","pubmedId":"11967148","doi":""},{"reference":"Qadota H, Moerman DG, Benian GM. 2012. A Molecular Mechanism for the Requirement of PAT-4 (Integrin-linked Kinase (ILK)) for the Localization of UNC-112 (Kindlin) to Integrin Adhesion Sites. Journal of Biological Chemistry 287: 28537-28551.
","pubmedId":"","doi":"10.1074/jbc.M112.354852"},{"reference":"Qiu Z, Sheesley P, Ahn JH, Yu EJ, Lee M. 2019. A Novel Mutation in an NPXY Motif of β Integrin Reveals Phenotypes Similar to him-4/hemicentin. Front Cell Dev Biol 7: 247.
","pubmedId":"31720287","doi":""},{"reference":"Reszka AA, Hayashi Y, Horwitz AF. 1992. Identification of amino acid sequences in the integrin beta 1 cytoplasmic domain implicated in cytoskeletal association. J Cell Biol 117(6): 1321-30.
","pubmedId":"1376731","doi":""},{"reference":"Sakai T, Zhang Q, Fässler R, Mosher DF. 1998. Modulation of beta1A integrin functions by tyrosine residues in the beta1 cytoplasmic domain. J Cell Biol 141(2): 527-38.
","pubmedId":"9548729","doi":""},{"reference":"Sonnenberg A. 1993. Integrins and their ligands. Curr Top Microbiol Immunol. 184: 7-35. 1414.","pubmedId":"8313723","doi":""},{"reference":"Waites CL, Craig AM, Garner CC. 2005. Mechanisms of vertebrate synaptogenesis. Annu Rev Neurosci 28: 251-74.
","pubmedId":"16022596","doi":""},{"reference":"Wang JH. 2012. Pull and push: talin activation for integrin signaling. Cell Res 22(11): 1512-4.
","pubmedId":"22777425","doi":""},{"reference":"Xu X, Ahn JH, Tam P, Yu EJ, Batra S, Cram EJ, Lee M. 2010. Analysis of conserved residues in the betapat-3 cytoplasmic tail reveals important functions of integrin in multiple tissues. Dev Dyn 239(3): 763-72.
","pubmedId":"20063417","doi":""},{"reference":"Xuan Z, Manning L, Nelson J, Richmond JE, Colón-Ramos DA, Shen K, Kurshan PT. 2017. Clarinet (CLA-1), a novel active zone protein required for synaptic vesicle clustering and release. Elife 6: 10.7554/eLife.29276.
","pubmedId":"29160205","doi":""},{"reference":"Ye F, Snider AK, Ginsberg MH. 2014. Talin and kindlin: the one-two punch in integrin activation. Front Med 8(1): 6-16.
","pubmedId":"24477625","doi":""}],"title":"A mutation in the conserved NPxY motif of β integrin PAT-3 alters outgrowth of neuronal dendritic spines
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null}]},{"id":"3441ec3a-fcc4-448d-9629-c64b0a68d10a","decision":"edit","abstract":"Integrins are heterodimeric transmembrane receptors that are critical in many biological processes, including neuronal development. Here we investigate integrin signaling in the outgrowth of dendritic spines on C. elegans GABAergic neurons using mutations engineered within the membrane-distal NPxY motif of the β integrin subunit PAT-3. We found a Y/E substitution, but not Y/A or Y/F substitutions, reduced dendritic spine number and misoriented spines. The Y/E substitution in the NPxY motif also altered the distribution of the presynaptic scaffold CLA-1, suggesting roles in both pre- and postsynaptic development. Our findings implicate integrin activation through the NPxY motif in synapse formation/maturation.
","acknowledgements":"We thank Dr. Shankar Ramachandran for technical assistance. We also thank Emily Norman for helpful comments and suggestions.
","authors":[{"affiliations":["Assumption University, Windsor, ON, Canada","University of Massachusetts Chan Medical School, Worcester, MA, USA"],"departments":["Department of Biological and Physical Sciences","Department of Neurobiology"],"credit":["conceptualization","investigation","fundingAcquisition","supervision","writing_originalDraft","methodology","dataCuration","formalAnalysis"],"email":"mlemons@assumption.edu","firstName":"Michele L","lastName":"Lemons","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-8459-4130"},{"affiliations":["Assumption University, Worcester, MA, USA"],"departments":["Department of Biological and Physical Sciences"],"credit":["dataCuration","visualization","investigation"],"email":"Noelia.GenaoGarcia@umassmed.edu","firstName":"Noelia","lastName":"Genao","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0007-1611-452X"},{"affiliations":["Assumption University, Worcester, MA, USA"],"departments":["Department of Biological and Physical Sciences"],"credit":["investigation","validation","visualization","dataCuration"],"email":"hailey.mckillop@umassmed.edu","firstName":"Hailey","lastName":"McKillop","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0001-5582-6964"},{"affiliations":["University of Massachusetts Chan Medical School, Worcester, MA, USA"],"departments":["Department of Neurobiology"],"credit":["conceptualization","methodology","project","supervision","writing_reviewEditing","fundingAcquisition","investigation","resources"],"email":"michael.francis@umassmed.edu","firstName":"Michael M","lastName":"Francis","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-8076-6668"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work was supported by a collaborative RUI grant from the National Science Foundation, Division of Integrative Organismal Systems IOS1754986 (M.L.L.) and IOS1755019 (M.M.F.)
","image":{"url":"https://portal.micropublication.org/uploads/7280e660e59ce41f5cad570b8de5cb52.png"},"imageCaption":"A) Maximum projection confocal image of the C. elegans GABAergic DD1 neuron dendritic shaft (inverted LUT grey scale) labeled by transcriptional expression of myristoylated GFP (myrGFP). pGABA::myrGFP in top image refers to cell specific transcriptional expression of myrGFP in DD GABAergic neurons using the flp-13 promoter. Bottom panel is a cartoon representation of the top image and includes red carets pointing to ventrally directed spines protruding from the dendritic shaft. All images are from larval stage 4 animals and oriented with anterior to the left and ventral towards the bottom, as indicated by arrows. Scale bar, 5 μm. B) Inverted maximal projection images showing DD1 dendritic spines of wildtype, pat-3(kq8041), pat-3(kq8042) and pat-3(kq8043) animals. Scale bar, 5 μm. C) Scatterplot of the total number of spines within a 15 μm region of DD1 neurons in wild-type animals and pat-3 mutants. The number of spines in pat-3(kq8042) animals is significantly decreased compared to wildtype, pat-3(kq8041), and pat-3(kq8043) animals. Each data point represents a measurement from an independent animal. Red horizontal bar indicates the mean. *p<0.05, **p<0.005, *** p<0.0005, Kruskal Wallis test. D) Number of dorsally directed spines per animal shown as a scatterplot. Dorsally directed spines are significantly increased in pat-3(kq8042) compared to wild type. Red horizontal bar indicates the mean. Inset image of pat-3(kq8042) animal with carets pointing to dorsally directed spines. *p<0.05, **p<0.005, ***p<0.0005, Kruskal Wallis test. Scale bar, 2 μm. E) Maximum projection confocal images of C. elegans GABAergic DD1 neuron dendritic shaft and spines (red) and presynaptic protein CLA-1 (green). pGABA::mCherry refers to transgenic expression of the red fluorescent marker mCherry in GABAergic DD neurons (flp-13 promoter). pACh::CLA-1::GFP refers to expression of the active zone protein CLA-1 tagged with green fluorescent protein (GFP) in cholinergic neurons (unc-17 beta promoter), including those that are presynaptic to GABAergic DD motor neurons. Representative images of wild type (left) and pat-3(kq8042) mutants (right) are shown. Scale bar, 5 μm. Scatterplots showing the average number (F) and size (G) of CLA-1::GFP puncta per animal within a 50 μm anterior most portion of ventral nerve cord. Each dot represents a single animal. The number of CLA-1::GFP clusters is decreased and the size of CLA-1::GFP clusters is increased in pat-3(kq8042) animals compared to wild-type controls. ***p<0.0005, **p<0.005, Mann Whitney test.
","imageTitle":"
A Y/E substitution in the membrane distal NPxY motif of the cytoplasmic tail of β integrin/pat-3 disrupts dendritic spines
","methods":"Strains
All strains used in these experiments are listed in Table 1. Strains are N2 Bristol strain derivatives (wildtype) and were maintained at room temperature on nematode growth media plates seeded with E. coli strain OP50. Some strains were kindly shared by the Lee lab at Baylor University (Hanna et al., 2020). Transgenic strains were obtained by microinjection to achieve transformation (Mello et al., 1991) and identified by using co-injection markers. Integrated lines were produced with X-ray irradiation and outcrossed to wild type/N2 Bristol eight times. Only larval stage 4 (L4) hermaphrodites were used in this study.
Confocal microscopy and analysis
Animals were immobilized in sodium azide (0.3 M) on a 2% agarose pad. Images of dendrites of the DD1 neuron shown in Panels A, B and D were obtained using a Yokogawa CSU-10 spinning disk confocal system on an upright Olympus BX51WI microscope equipped with a Hammamatsu C9100-13 EMCCD camera and 63X oil immersion objective. A Cobolt Calypso 491 nm laser was used for excitation, and images were acquired using Volocity 4.3 software (Perkin-Elmer). All images were obtained using identical imaging and laser settings. Z stack volumes were acquired using an objective-coupled Piezo. Image analysis was conducted using Fiji software (open source) as described previously (He et al., 2015; Lemons et al., 2024; Oliver et al., 2022; Philbrook et al., 2018). Briefly, spines that were at least 0.2 μm in length were counted within a 15 µm region of interest (ROI) anterior to the DD1 cell soma.
Images in Panel E were obtained on a Yokogawa CSU-Z1 spinning disk confocal mounted on a Nikon NiE upright motorized microscope equipped with a Nikon 60x oil immersion objective and a Prime BSI Express CMOS camera (Teledyne Vision Solutions). Z stack images were acquired using Nikon Elements software, using identical imaging and laser settings. CLA-1::GFP puncta number and size were measured within a 50 µm region of the anterior ventral nerve cord using the analyze particles function in Image J.
","reagents":"Primers used to confirm pat-3 (kq8041), pat-3 (kq8042) and pat-3 (kq8043).
Forward primer OMF 3153 (primer in Exon 7 in pat-3 transcript): ggccacagataatgcaacag. Reverse primer OMF3141: (primer in downstream UTR): acaatttatcgctaaatactcgtt. PCR generated 436bp product. Product was sequenced using forward primer OMF3140 (in exon 7): catgatagatccgaatacgc
Table 1. Worm strains
Strain | Genotype | Description | Plasmid | Shortened name |
DD-specific myristoylated (myr) GFP transcriptional reporter (green) | pGABA::myrGFP = ufIs175 | |||
CRISPR engineered pat-3 mutation changes NPVY to NPVA (Hanna et al., 2020) |
| |||
CRISPR engineered pat-3 mutation changes NPVY to NPVE (Hanna et al., 2020) |
| |||
CRISPR engineered pat-3 mutation changes NPVY to NPVF (Hanna et al., 2020) |
| |||
DD-specific myrGFP transcriptional reporter (green) | pGABA::myrGFP = ufIs175 | |||
DD-specific myrGFP transcriptional reporter (green) | pGABA::myrGFP = ufIs175 | |||
DD-specific myrGFP transcriptional reporter (green) | pGABA::myrGFP = ufIs175 | |||
DD-specific mCherry transcriptional reporter (red), extrachromosomal array with cholinergic promoter driving CLA-1::green fluorescent protein (GFP) expression | ufIs128 [Pflp-13::mCherry+ Plgc-11::mCherry]; ufEx1679 [Punc-17β::GFPnovo2::cla-1 + Plgc-11::GFP]
| pGABA::mCherry = ufIs128 | ||
DD-specific mCherry transcriptional reporter (red), extrachromosomal array with cholinergic promoter driving CLA-1::green fluorescent protein (GFP) expression | ufIs128 [Pflp-13::mCherry+ Plgc-11::mCherry]; ufEx1679 [Punc-17β::GFPnovo2::cla-1 + Plgc-11::GFP] | pGABA::mCherry = ufIs128 |
Synapse formation involves a sequence of carefully orchestrated molecular interactions to concentrate synaptic vesicles and release machinery at precisely defined sites opposite clusters of post-synaptic neurotransmitter receptors (Drapeau et al., 1995; Waites et al., 2005). Many studies have identified shared groups of proteins that form the core pre- and post-synaptic scaffolds, but the events that initiate synapse assembly and maturation often vary at the level of individual neurons and synapses. Mounting evidence indicates that integrin family members have key roles in synapse assembly and maturation (de Wit & Ghosh, 2016; Dityatev et al., 2010; Lilja & Ivaska, 2018; Park & Goda, 2016). Integrins are transmembrane extracellular matrix receptors that function as αβ heterodimers (Campbell & Humphries, 2011; Giancotti & Ruoslahti, 1999; Hynes, 1992, 2002). Integrins bind a variety of ligands including extracellular matrix, cell adhesion and axon guidance proteins, as well as intracellular signaling machinery such as talin and kindlin (Humphries et al., 2006; Moser et al., 2009; Nakamoto et al., 2004; Sonnenberg, 1993; Ye et al., 2014). At least 24 different integrin combinations are formed from 18 α and 8 β subunits in mammals, while the invertebrate model C. elegans forms only two integrin heterodimers (Fassler & Meyer, 1995) composed of one α subunit (INA-1 or PAT-2) and a sole β subunit (PAT-3)(Gettner et al., 1995; Kramer, 2005).
Integrin function is greatly influenced by conformational state, integrins shift between low- (inactivated) and high-ligand affinity (activated) states. Integrin activation can be triggered by cytoplasmic signaling, known as “inside-out” activation (Calderwood, 2004a; Ginsberg, 2014; Kim et al., 2011; Liddington & Ginsberg, 2002; Wang, 2012). Inside-out activation is mediated through interactions between phosphotyrosine binding (PTB) domain proteins (including talin, kindlin) and cytoplasmic NPxY (asp-pro-x-tyr) motifs in the β integrin cytoplasmic domain (Bumm et al., 2025; Czuchra et al., 2006; Hanna et al., 2020; Jannuzi et al., 2002; Jannuzi et al., 2004; Kaapa et al., 1999; Lee et al., 2001; Sakai et al., 1998). The cytoplasmic tail of β integrin has two NPxY motifs, the membrane-proximal motif is proposed to interact with talin while the membrane-distal motif has been shown to interact with kindlin (Morse et al., 2014). Tyrosine phosphorylation of the NPxY motifs regulates the binding of PTB domain containing proteins, implicating NPxY motifs as molecular switches for integrin activation and signaling (Bledzka et al., 2010; Calderwood, 2004a, 2004b; Calderwood et al., 2013; Calderwood et al., 2002; Liddington & Ginsberg, 2002). While null mutations in the gene encoding the C. elegans β integrin pat-3 are lethal, viable CRISPR-engineered mutations targeting the membrane-distal NPXY motif of PAT-3 were recently generated (Bumm et al., 2025; Hanna et al., 2020). Building upon previous studies from our lab and others that implicate integrins in the outgrowth of GABAergic axons (Baum & Garriga, 1997; Chisholm et al., 2016; Forrester & Garriga, 1997; Oliver et al., 2019; Poinat et al., 2002), we sought to employ these NPxY engineered mutants to investigate integrin signaling in the formation of previously characterized dendritic spines in C. elegans GABAergic neurons (Cuentas-Condori et al., 2019; Lemons et al., 2024; Oliver et al., 2022; Oliver et al., 2026; Philbrook et al., 2018).
To investigate the role of integrin activation through the β integrin/PAT-3 NPxY motif in spine outgrowth, we used cell-specific expression of myristoylated green fluorescent protein (myrGFP) to visualize GABAergic dendrites in 3 available strains carrying CRISPR-engineered mutations in the conserved tyrosine residue of the PAT-3 membrane distal NPxY motif: wild type 801NPVY804 to NPVA804 [alanine, pat-3(kq8041)], NPVE804 [glutamate, pat-3(kq8042)], or NPVF804 [phenylalanine, (pat-3(kq8043)] (Bumm et al., 2025; Hanna et al., 2020). These mutations are expected to disrupt the tyrosine residue (A), mimic tyrosine phosphorylation (E), or mimic non-phosphorylatable tyrosine (F), respectively. Consistent with previous studies (Lemons et al., 2024; Oliver et al., 2022; Philbrook et al., 2018), we observed roughly 8 dendritic spines in a 15 μm region anterior to the DD1 GABAergic neuron cell body of wild-type larval stage 4 (L4) animals (Figure 1A-C). The number of dendritic spines on GABAergic DD1 neurons was significantly reduced by 43±6% in pat-3(kq8042) animals carrying a Y>E substitution (Figure 1B,C). Surprisingly, some spines appeared dorsally rather than ventrally oriented in these animals (Figure 1B, D), suggesting either misdirected spine growth or the possibility of ectopic synaptic contacts. Substitution of the negatively charged glutamic acid (E) for tyrosine (Y) in pat-3(kq8042) animals is predicted to mimic tyrosine phosphorylation (Anthis et al., 2009; Qiu et al., 2019; Reszka et al., 1992). Previous studies suggest phosphorylation of the distal NPxY motif disrupts kindlin binding, therefore disabling kindlin's ability to co-activate integrin (Bledzka et al., 2010; Harburger et al., 2009). Our findings suggest that constitutive tyrosine phosphorylation disrupts dendritic spines, perhaps by impacting interactions with kindlin/UNC-112 or other modulators of integrin activation that act through this motif.
To ask whether the effects of the PAT-3 Y/E substitution were specific to the post-synapse or affected both pre- and postsynaptic specializations, we examined the distribution of the GFP-tagged active zone marker CLA-1 (Xuan et al., 2017) in cholinergic neurons, which are presynaptic partners to GABAergic motor neurons. As expected, CLA-1::GFP puncta were observed on the ventral side of ventrally directed spines in wild-type controls (Figure 1E), indicating presynaptic specializations opposing the dendritic spines. We found that the number of CLA-1::GFP puncta within a 50 μm region of the anterior ventral nerve cord was significantly decreased in pat-3(kq8042) animals compared to controls (Figure 1F), while the size of CLA-1::GFP puncta slightly increased (Figure 1G). These findings demonstrate that both pre- and postsynaptic specializations are disrupted in pat-3(kq8042) animals.
We next examined dendritic spines in pat-3(kq8041) and pat-3(kq8043) animals. A tyrosine (Y) to phenylalanine substitution (F) in the NPxY motif in pat-3(kq8043) animals is predicted to preserve hydrophobic interactions associated with tyrosine but eliminate phosphorylation, perhaps acting similarly to a non-phosphorylatable tyrosine residue (Chen et al., 2006; Xu et al., 2010). The tyrosine (Y) to alanine substitution (A) in the NPxY motif of pat-3(kq8041) animals is predicted to disrupt interactions requiring the hydrophobic aromatic ring of tyrosine as well as phosphorylation at this site (Chen et al., 2006). Surprisingly, we found that spine number was not significantly different in either of these mutants compared to wild-type animals (Figure 1B,C). Although work to date suggests the membrane-proximal and -distal NPxY motifs have independent binding partners, we can't rule out the possibility that redundancy across the motifs contributes to these findings.
Prior analysis of membrane distal NPxY substitutions revealed that all three substitutions produced defects in the migration of gonadal distal tip cells (Hanna et al., 2020). In contrast, our finding that solely the phosphomimetic Y/E substitution disrupts dendritic spines is more consistent with recent studies of neuronal function in these strains, where the phosphomimetic E substitution produced severe effects, while the A and F substitutions did not (Bumm et al., 2025). Together, our results argue that tyrosine phosphorylation at the distal NPxY motif of PAT-3 is not essential for spine outgrowth, but may instead have a modulatory role, perhaps by influencing integrin interaction with kindlin/UNC-112 (Bledzka et al., 2010; Qadota et al., 2012).
","references":[{"reference":"Anthis NJ, Haling JR, Oxley CL, Memo M, Wegener KL, Lim CJ, Ginsberg MH, Campbell ID. 2009. Beta integrin tyrosine phosphorylation is a conserved mechanism for regulating talin-induced integrin activation. J Biol Chem 284(52): 36700-36710.
","pubmedId":"19843520","doi":""},{"reference":"Baum PD, Garriga G. 1997. Neuronal migrations and axon fasciculation are disrupted in ina-1 integrin mutants. Neuron. 19: 51-62. 1047.","pubmedId":"9247263","doi":""},{"reference":"Bledzka K, Bialkowska K, Nie H, Qin J, Byzova T, Wu C, Plow EF, Ma YQ. 2010. Tyrosine phosphorylation of integrin beta3 regulates kindlin-2 binding and integrin activation. J Biol Chem 285(40): 30370-4.
","pubmedId":"20702409","doi":""},{"reference":"Bumm JH, Lee DD, Qiu Z, Choi AH, Kolluri M, Olsen MJ, Wang L, Lee M. 2025. The beta integrin modulates serotonin sensitivity via NPxY motifs to regulate egg laying and mechanosensation behaviors in Caenorhabditis elegans. Dev Dyn 1442.","pubmedId":"41117756","doi":"10.1002/dvdy.70090"},{"reference":"Calderwood DA. 2004. Talin controls integrin activation. Biochem Soc Trans. 32: 434-7. 675.","pubmedId":"15157154","doi":"10.1042/BST0320434"},{"reference":"Calderwood DA. 2004. Integrin activation. J Cell Sci. 117: 657-66. 676.","pubmedId":"14754902","doi":"10.1242/jcs.01014"},{"reference":"Calderwood DA, Campbell ID, Critchley DR. 2013. Talins and kindlins: partners in integrin-mediated adhesion. Nat Rev Mol Cell Biol 14(8): 503-17.
","pubmedId":"23860236","doi":""},{"reference":"Calderwood DA, Yan B, de Pereda JM, Alvarez BG, Fujioka Y, Liddington RC, Ginsberg MH. 2002. The phosphotyrosine binding-like domain of talin activates integrins. J Biol Chem 277(24): 21749-58.
","pubmedId":"11932255","doi":""},{"reference":"Campbell ID, Humphries MJ. 2011. Integrin structure, activation, and interactions. Cold Spring Harb Perspect Biol 3(3): 10.1101/cshperspect.a004994.
","pubmedId":"21421922","doi":""},{"reference":"Chen H, Zou Z, Sarratt KL, Zhou D, Zhang M, Sebzda E, Hammer DA, Kahn ML. 2006. In vivo beta1 integrin function requires phosphorylation-independent regulation by cytoplasmic tyrosines. Genes Dev 20(8): 927-32.
","pubmedId":"16618804","doi":""},{"reference":"Chisholm AD, Hutter H, Jin Y, Wadsworth WG. 2016. The Genetics of Axon Guidance and Axon Regeneration in Caenorhabditis elegans. Genetics. 204: 849-882. 1406.","pubmedId":"28114100","doi":"10.1534/genetics.115.186262"},{"reference":"Cuentas-Condori A, Mulcahy B, He S, Palumbos S, Zhen M, Miller DM 3rd. 2019. C. elegans neurons have functional dendritic spines. Elife 8: 10.7554/eLife.47918.
","pubmedId":"31584430","doi":""},{"reference":"Czuchra A, Meyer H, Legate KR, Brakebusch C, Fässler R. 2006. Genetic analysis of beta1 integrin \"activation motifs\" in mice. J Cell Biol 174(6): 889-99.
","pubmedId":"16954348","doi":""},{"reference":"de Wit J, Ghosh A. 2016. Specification of synaptic connectivity by cell surface interactions. Nat Rev Neurosci 17(1): 22-35.
","pubmedId":"26656254","doi":""},{"reference":"Dityatev A, Schachner M, Sonderegger P. 2010. The dual role of the extracellular matrix in synaptic plasticity and homeostasis. Nat Rev Neurosci. 11: 735-46. 1242.","pubmedId":"20944663","doi":"10.1038/nrn2898"},{"reference":"Drapeau P, Catarsi S, Merz DC. 1995. Signalling synapse formation between identified neurons. J Physiol Paris 89(3): 115-23.
","pubmedId":"7581300","doi":""},{"reference":"Fässler R, Meyer M. 1995. Consequences of lack of beta 1 integrin gene expression in mice. Genes Dev 9(15): 1896-908.
","pubmedId":"7544313","doi":""},{"reference":"Forrester WC, Garriga G. 1997. Genes necessary for C. elegans cell and growth cone migrations. Development. 124: 1831-43. 1053.","pubmedId":"9165130","doi":""},{"reference":"Gettner SN, Kenyon C, Reichardt LF. 1995. Characterization of beta pat-3 heterodimers, a family of essential integrin receptors in C. elegans. J Cell Biol. 129: 1127-41. 1080.","pubmedId":"7744961","doi":""},{"reference":"Giancotti FG, Ruoslahti E. 1999. Integrin signaling. Science. 285: 1028-32. 363.","pubmedId":"10446041","doi":""},{"reference":"Ginsberg MH. 2014. Integrin activation. BMB Rep. 47: 655-9. 1163.","pubmedId":"25388208","doi":""},{"reference":"Hanna J, Ramani S, Williams T, Anaya R, Campion N, Lopez E, et al., Lee M. 2020. Three alleles in the pat-3 locus of Caenorhabditis elegans: mutations in the membrane-distal NPxY phosphotyrosine motif. MicroPubl Biol. 2020 1441.","pubmedId":"32821887","doi":"10.17912/micropub.biology.000291"},{"reference":"He S, Philbrook A, Mc Whirter R, Gabel CV, Taub DG, Carter MH, et al., Miller DM. 2015. Transcriptional Control of Synaptic Remodeling through Regulated Expression of an Immunoglobulin Superfamily Protein. Curr Biol. 25: 2541-8. 1161.","pubmedId":"26387713","doi":"10.1016/j.cub.2015.08.022"},{"reference":"Humphries JD, Byron A, Humphries MJ. 2006. Integrin ligands at a glance. J Cell Sci. 119: 3901-3. 856.","pubmedId":"16988024","doi":"119/19/3901 [pii] 10.1242/jcs.03098"},{"reference":"Hynes RO. 1992. Integrins: versatility, modulation, and signaling in cell adhesion. Cell. 69: 11-25.. 97.","pubmedId":"","doi":""},{"reference":"Hynes RO. 2002. Integrins: bidirectional, allosteric signaling machines. Cell. 110: 673-87. 865.","pubmedId":"12297042","doi":"S0092867402009716"},{"reference":"Jannuzi AL, Bunch TA, Brabant MC, Miller SW, Mukai L, Zavortink M, Brower DL. 2002. Disruption of C-terminal cytoplasmic domain of betaPS integrin subunit has dominant negative properties in developing Drosophila. Mol Biol Cell 13(4): 1352-65.
","pubmedId":"11950944","doi":""},{"reference":"Jannuzi AL, Bunch TA, West RF, Brower DL. 2004. Identification of integrin beta subunit mutations that alter heterodimer function in situ. Mol Biol Cell 15(8): 3829-40.
","pubmedId":"15194810","doi":""},{"reference":"Kääpä A, Peter K, Ylänne J. 1999. Effects of mutations in the cytoplasmic domain of integrin beta(1) to talin binding and cell spreading. Exp Cell Res 250(2): 524-34.
","pubmedId":"10413605","doi":""},{"reference":"Kim C, Ye F, Ginsberg MH. 2011. Regulation of integrin activation. Annu Rev Cell Dev Biol. 27: 321-45. 1152.","pubmedId":"21663444","doi":"10.1146/annurev-cellbio-100109-104104"},{"reference":"Kramer JM. 2005. Basement membranes. WormBook: 1-15.
","pubmedId":"18050423","doi":""},{"reference":"Lee M, Cram EJ, Shen B, Schwarzbauer JE. 2001. Roles for beta(pat-3) integrins in development and function of Caenorhabditis elegans muscles and gonads. J Biol Chem. 276: 36404-10. 1167.","pubmedId":"11473126","doi":"10.1074/jbc.M105795200"},{"reference":"Lemons M L, McKillop H, Genao N, Francis M M. 2024. The extracellular matrix molecule Collagen XVIII/CLE-1 affects neuronal dendritic spines. MicroPubl Biol 2024: 10.17912/micropub.biology.001331.
","pubmedId":"39568805","doi":""},{"reference":"Liddington RC, Ginsberg MH. 2002. Integrin activation takes shape. J Cell Biol. 158: 833-9. 688.","pubmedId":"12213832","doi":"10.1083/jcb.200206011 cb.200206011 [pii]"},{"reference":"Lilja J, Ivaska J. 2018. Integrin activity in neuronal connectivity. J Cell Sci 131(12): pii: jcs212803. 10.1242/jcs.212803.
","pubmedId":"29907643","doi":""},{"reference":"Mello CC, Kramer JM, Stinchcomb D, Ambros V. 1991. Efficient gene transfer in C.elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J. 10: 3959-70. 1413.","pubmedId":"1935914","doi":""},{"reference":"Morse EM, Brahme NN, Calderwood DA. 2014. Integrin Cytoplasmic\nTail Interactions. Biochemistry 53: 810-820.
","pubmedId":"","doi":"10.1021/bi401596q"},{"reference":"Moser M, Legate KR, Zent R, Fassler R. 2009. The tail of integrins, talin, and kindlins. Science. 324: 895-9. 689.","pubmedId":"19443776","doi":"324/5929/895 [pii]10.1126/science.1163865"},{"reference":"Nakamoto T, Kain KH, Ginsberg MH. 2004. Neurobiology: New connections between integrins and axon guidance. Curr Biol. 14: R121-3. 412.","pubmedId":"14986683","doi":""},{"reference":"Oliver D, Norman E, Bates H, Avard R, Rettler M, Bénard CY, Francis MM, Lemons ML. 2019. Integrins Have Cell-Type-Specific Roles in the Development of Motor Neuron Connectivity. J Dev Biol 7(3): 10.3390/jdb7030017.
","pubmedId":"31461926","doi":""},{"reference":"Oliver D, Ramachandran S, Philbrook A, Lambert CM, Nguyen KCQ, Hall DH, Francis MM. 2022. Kinesin-3 mediated axonal delivery of presynaptic neurexin stabilizes dendritic spines and postsynaptic components. PLoS Genet 18(1): e1010016.
","pubmedId":"35089924","doi":""},{"reference":"Oliver DB, Ramachandran S, Biswas K, Bénard CY, Doitsidou M, McKillop H, et al., Francis MM. 2026. Genome-wide analysis reveals pathways important for the development and maturation of excitatory synaptic connections to GABAergic neurons. G3 (Bethesda) 16(4): 10.1093/g3journal/jkag028.
","pubmedId":"41655250","doi":""},{"reference":"Park YK, Goda Y. 2016. Integrins in synapse regulation. Nat Rev Neurosci. 17: 745-756. 1226.","pubmedId":"27811927","doi":"10.1038/nrn.2016.138"},{"reference":"Philbrook A, Ramachandran S, Lambert CM, Oliver D, Florman J, Alkema MJ, Lemons M, Francis MM. 2018. Neurexin directs partner-specific synaptic connectivity in C. elegans. Elife. 7 1401.","pubmedId":"30039797","doi":"10.7554/eLife.35692"},{"reference":"Poinat P, De Arcangelis A, Sookhareea S, Zhu X, Hedgecock EM, Labouesse M, Georges Labouesse E. 2002. A conserved interaction between beta1 integrin/PAT-3 and Nck-interacting kinase/MIG-15 that mediates commissural axon navigation in C. elegans. Curr Biol. 12: 622-31. 1055.","pubmedId":"11967148","doi":""},{"reference":"Qadota H, Moerman DG, Benian GM. 2012. A Molecular Mechanism for the Requirement of PAT-4 (Integrin-linked Kinase (ILK)) for the Localization of UNC-112 (Kindlin) to Integrin Adhesion Sites. Journal of Biological Chemistry 287: 28537-28551.
","pubmedId":"","doi":"10.1074/jbc.M112.354852"},{"reference":"Qiu Z, Sheesley P, Ahn JH, Yu EJ, Lee M. 2019. A Novel Mutation in an NPXY Motif of β Integrin Reveals Phenotypes Similar to him-4/hemicentin. Front Cell Dev Biol 7: 247.
","pubmedId":"31720287","doi":""},{"reference":"Reszka AA, Hayashi Y, Horwitz AF. 1992. Identification of amino acid sequences in the integrin beta 1 cytoplasmic domain implicated in cytoskeletal association. J Cell Biol 117(6): 1321-30.
","pubmedId":"1376731","doi":""},{"reference":"Sakai T, Zhang Q, Fässler R, Mosher DF. 1998. Modulation of beta1A integrin functions by tyrosine residues in the beta1 cytoplasmic domain. J Cell Biol 141(2): 527-38.
","pubmedId":"9548729","doi":""},{"reference":"Sonnenberg A. 1993. Integrins and their ligands. Curr Top Microbiol Immunol. 184: 7-35. 1414.","pubmedId":"8313723","doi":""},{"reference":"Waites CL, Craig AM, Garner CC. 2005. Mechanisms of vertebrate synaptogenesis. Annu Rev Neurosci 28: 251-74.
","pubmedId":"16022596","doi":""},{"reference":"Wang JH. 2012. Pull and push: talin activation for integrin signaling. Cell Res 22(11): 1512-4.
","pubmedId":"22777425","doi":""},{"reference":"Xu X, Ahn JH, Tam P, Yu EJ, Batra S, Cram EJ, Lee M. 2010. Analysis of conserved residues in the betapat-3 cytoplasmic tail reveals important functions of integrin in multiple tissues. Dev Dyn 239(3): 763-72.
","pubmedId":"20063417","doi":""},{"reference":"Xuan Z, Manning L, Nelson J, Richmond JE, Colón-Ramos DA, Shen K, Kurshan PT. 2017. Clarinet (CLA-1), a novel active zone protein required for synaptic vesicle clustering and release. Elife 6: 10.7554/eLife.29276.
","pubmedId":"29160205","doi":""},{"reference":"Ye F, Snider AK, Ginsberg MH. 2014. Talin and kindlin: the one-two punch in integrin activation. Front Med 8(1): 6-16.
","pubmedId":"24477625","doi":""}],"title":"A mutation in the conserved NPxY motif of β integrin PAT-3 alters outgrowth of neuronal dendritic spines
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null}]},{"id":"2b0da4dd-e602-48b8-b857-d605bf0cfc39","decision":"publish","abstract":"Integrins are heterodimeric transmembrane receptors that are critical in many biological processes, including neuronal development. Here we investigate integrin signaling in the outgrowth of dendritic spines on C. elegans GABAergic neurons using mutations engineered within the membrane-distal NPxY motif of the β integrin subunit PAT-3. We found a Y/E substitution, but not Y/A or Y/F substitutions, reduced dendritic spine number and misoriented spines. The Y/E substitution in the NPxY motif also altered the distribution of the presynaptic scaffold CLA-1, suggesting roles in both pre- and postsynaptic development. Our findings implicate integrin activation through the NPxY motif in synapse formation/maturation.
","acknowledgements":"We thank Dr. Shankar Ramachandran for technical assistance. We also thank Emily Norman for helpful comments and suggestions.
","authors":[{"affiliations":["Assumption University, Windsor, ON, Canada","University of Massachusetts Chan Medical School, Worcester, MA, USA"],"departments":["Department of Biological and Physical Sciences","Department of Neurobiology"],"credit":["conceptualization","investigation","fundingAcquisition","supervision","writing_originalDraft","methodology","dataCuration","formalAnalysis"],"email":"mlemons@assumption.edu","firstName":"Michele L","lastName":"Lemons","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-8459-4130"},{"affiliations":["Assumption University, Worcester, MA, USA"],"departments":["Department of Biological and Physical Sciences"],"credit":["dataCuration","visualization","investigation"],"email":"Noelia.GenaoGarcia@umassmed.edu","firstName":"Noelia","lastName":"Genao","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0007-1611-452X"},{"affiliations":["Assumption University, Worcester, MA, USA"],"departments":["Department of Biological and Physical Sciences"],"credit":["investigation","validation","visualization","dataCuration"],"email":"hailey.mckillop@umassmed.edu","firstName":"Hailey","lastName":"McKillop","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0001-5582-6964"},{"affiliations":["University of Massachusetts Chan Medical School, Worcester, MA, USA"],"departments":["Department of Neurobiology"],"credit":["conceptualization","methodology","project","supervision","writing_reviewEditing","fundingAcquisition","investigation","resources"],"email":"michael.francis@umassmed.edu","firstName":"Michael M","lastName":"Francis","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-8076-6668"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work was supported by a collaborative RUI grant from the National Science Foundation, Division of Integrative Organismal Systems IOS1754986 (M.L.L.) and IOS1755019 (M.M.F.)
","image":{"url":"https://portal.micropublication.org/uploads/7280e660e59ce41f5cad570b8de5cb52.png"},"imageCaption":"A) Maximum projection confocal image of the C. elegans GABAergic DD1 neuron dendritic shaft (inverted LUT grey scale) labeled by transcriptional expression of myristoylated GFP (myrGFP). pGABA::myrGFP in top image refers to cell specific transcriptional expression of myrGFP in DD GABAergic neurons using the flp-13 promoter. Bottom panel is a cartoon representation of the top image and includes red carets pointing to ventrally directed spines protruding from the dendritic shaft. All images are from larval stage 4 animals and oriented with anterior to the left and ventral towards the bottom, as indicated by arrows. Scale bar, 5 μm. B) Inverted maximal projection images showing DD1 dendritic spines of wildtype, pat-3(kq8041), pat-3(kq8042) and pat-3(kq8043) animals. Scale bar, 5 μm. C) Scatterplot of the total number of spines within a 15 μm region of DD1 neurons in wild-type animals and pat-3 mutants. The number of spines in pat-3(kq8042) animals is significantly decreased compared to wildtype, pat-3(kq8041), and pat-3(kq8043) animals. Each data point represents a measurement from an independent animal. Red horizontal bar indicates the mean. *p<0.05, **p<0.005, *** p<0.0005, Kruskal Wallis test. D) Number of dorsally directed spines per animal shown as a scatterplot. Dorsally directed spines are significantly increased in pat-3(kq8042) compared to wild type. Red horizontal bar indicates the mean. Inset image of pat-3(kq8042) animal with carets pointing to dorsally directed spines. *p<0.05, **p<0.005, ***p<0.0005, Kruskal Wallis test. Scale bar, 2 μm. E) Maximum projection confocal images of C. elegans GABAergic DD1 neuron dendritic shaft and spines (red) and presynaptic protein CLA-1 (green). pGABA::mCherry refers to transgenic expression of the red fluorescent marker mCherry in GABAergic DD neurons (flp-13 promoter). pACh::CLA-1::GFP refers to expression of the active zone protein CLA-1 tagged with green fluorescent protein (GFP) in cholinergic neurons (unc-17 beta promoter), including those that are presynaptic to GABAergic DD motor neurons. Representative images of wild type (left) and pat-3(kq8042) mutants (right) are shown. Scale bar, 5 μm. Scatterplots showing the average number (F) and size (G) of CLA-1::GFP puncta per animal within a 50 μm anterior most portion of ventral nerve cord. Each dot represents a single animal. The number of CLA-1::GFP clusters is decreased and the size of CLA-1::GFP clusters is increased in pat-3(kq8042) animals compared to wild-type controls. ***p<0.0005, **p<0.005, Mann Whitney test.
","imageTitle":"
A Y/E substitution in the membrane distal NPxY motif of the cytoplasmic tail of β integrin/pat-3 disrupts dendritic spines
","methods":"Strains
All strains used in these experiments are listed in Table 1. Strains are N2 Bristol strain derivatives (wildtype) and were maintained at room temperature on nematode growth media plates seeded with E. coli strain OP50. Some strains were kindly shared by the Lee lab at Baylor University (Hanna et al., 2020). Transgenic strains were obtained by microinjection to achieve transformation (Mello et al., 1991) and identified by using co-injection markers. Integrated lines were produced with X-ray irradiation and outcrossed to wild type/N2 Bristol eight times. Only larval stage 4 (L4) hermaphrodites were used in this study.
Confocal microscopy and analysis
Animals were immobilized in sodium azide (0.3 M) on a 2% agarose pad. Images of dendrites of the DD1 neuron shown in Panels A, B and D were obtained using a Yokogawa CSU-10 spinning disk confocal system on an upright Olympus BX51WI microscope equipped with a Hammamatsu C9100-13 EMCCD camera and 63X oil immersion objective. A Cobolt Calypso 491 nm laser was used for excitation, and images were acquired using Volocity 4.3 software (Perkin-Elmer). All images were obtained using identical imaging and laser settings. Z stack volumes were acquired using an objective-coupled Piezo. Image analysis was conducted using Fiji software (open source) as described previously (He et al., 2015; Lemons et al., 2024; Oliver et al., 2022; Philbrook et al., 2018). Briefly, spines that were at least 0.2 μm in length were counted within a 15 µm region of interest (ROI) anterior to the DD1 cell soma.
Images in Panel E were obtained on a Yokogawa CSU-Z1 spinning disk confocal mounted on a Nikon NiE upright motorized microscope equipped with a Nikon 60x oil immersion objective and a Prime BSI Express CMOS camera (Teledyne Vision Solutions). Z stack images were acquired using Nikon Elements software, using identical imaging and laser settings. CLA-1::GFP puncta number and size were measured within a 50 µm region of the anterior ventral nerve cord using the analyze particles function in Image J.
","reagents":"Primers used to confirm pat-3 (kq8041), pat-3 (kq8042) and pat-3 (kq8043).
Forward primer OMF 3153 (primer in Exon 7 in pat-3 transcript): ggccacagataatgcaacag. Reverse primer OMF3141: (primer in downstream UTR): acaatttatcgctaaatactcgtt. PCR generated 436bp product. Product was sequenced using forward primer OMF3140 (in exon 7): catgatagatccgaatacgc
Table 1. Worm strains
Strain | Genotype | Description | Plasmid | Shortened name |
DD-specific myristoylated (myr) GFP transcriptional reporter (green) | pGABA::myrGFP = ufIs175 | |||
CRISPR engineered pat-3 mutation changes NPVY to NPVA (Hanna et al., 2020) |
| |||
CRISPR engineered pat-3 mutation changes NPVY to NPVE (Hanna et al., 2020) |
| |||
CRISPR engineered pat-3 mutation changes NPVY to NPVF (Hanna et al., 2020) |
| |||
DD-specific myrGFP transcriptional reporter (green) | pGABA::myrGFP = ufIs175 | |||
DD-specific myrGFP transcriptional reporter (green) | pGABA::myrGFP = ufIs175 | |||
DD-specific myrGFP transcriptional reporter (green) | pGABA::myrGFP = ufIs175 | |||
DD-specific mCherry transcriptional reporter (red), extrachromosomal array with cholinergic promoter driving CLA-1::green fluorescent protein (GFP) expression | ufIs128 [Pflp-13::mCherry+ Plgc-11::mCherry]; ufEx1679 [Punc-17β::GFPnovo2::cla-1 + Plgc-11::GFP]
| pGABA::mCherry = ufIs128 | ||
DD-specific mCherry transcriptional reporter (red), extrachromosomal array with cholinergic promoter driving CLA-1::green fluorescent protein (GFP) expression | ufIs128 [Pflp-13::mCherry+ Plgc-11::mCherry]; ufEx1679 [Punc-17β::GFPnovo2::cla-1 + Plgc-11::GFP] | pGABA::mCherry = ufIs128 |
Synapse formation involves a sequence of carefully orchestrated molecular interactions to concentrate synaptic vesicles and release machinery at precisely defined sites opposite clusters of post-synaptic neurotransmitter receptors (Drapeau et al., 1995; Waites et al., 2005). Many studies have identified shared groups of proteins that form the core pre- and post-synaptic scaffolds, but the events that initiate synapse assembly and maturation often vary at the level of individual neurons and synapses. Mounting evidence indicates that integrin family members have key roles in synapse assembly and maturation (de Wit & Ghosh, 2016; Dityatev et al., 2010; Lilja & Ivaska, 2018; Park & Goda, 2016). Integrins are transmembrane extracellular matrix receptors that function as αβ heterodimers (Campbell & Humphries, 2011; Giancotti & Ruoslahti, 1999; Hynes, 1992, 2002). Integrins bind a variety of ligands including extracellular matrix, cell adhesion and axon guidance proteins, as well as intracellular signaling machinery such as talin and kindlin (Humphries et al., 2006; Moser et al., 2009; Nakamoto et al., 2004; Sonnenberg, 1993; Ye et al., 2014). At least 24 different integrin combinations are formed from 18 α and 8 β subunits in mammals, while the invertebrate model C. elegans forms only two integrin heterodimers (Fassler & Meyer, 1995) composed of one α subunit (INA-1 or PAT-2) and a sole β subunit (PAT-3)(Gettner et al., 1995; Kramer, 2005).
Integrin function is greatly influenced by conformational state, integrins shift between low- (inactivated) and high-ligand affinity (activated) states. Integrin activation can be triggered by cytoplasmic signaling, known as “inside-out” activation (Calderwood, 2004a; Ginsberg, 2014; Kim et al., 2011; Liddington & Ginsberg, 2002; Wang, 2012). Inside-out activation is mediated through interactions between phosphotyrosine binding (PTB) domain proteins (including talin, kindlin) and cytoplasmic NPxY (asp-pro-x-tyr) motifs in the β integrin cytoplasmic domain (Bumm et al., 2025; Czuchra et al., 2006; Hanna et al., 2020; Jannuzi et al., 2002; Jannuzi et al., 2004; Kaapa et al., 1999; Lee et al., 2001; Sakai et al., 1998). The cytoplasmic tail of β integrin has two NPxY motifs, the membrane-proximal motif is proposed to interact with talin while the membrane-distal motif has been shown to interact with kindlin (Morse et al., 2014). Tyrosine phosphorylation of the NPxY motifs regulates the binding of PTB domain containing proteins, implicating NPxY motifs as molecular switches for integrin activation and signaling (Bledzka et al., 2010; Calderwood, 2004a, 2004b; Calderwood et al., 2013; Calderwood et al., 2002; Liddington & Ginsberg, 2002). While null mutations in the gene encoding the C. elegans β integrin pat-3 are lethal, viable CRISPR-engineered mutations targeting the membrane-distal NPXY motif of PAT-3 were recently generated (Bumm et al., 2025; Hanna et al., 2020). Building upon previous studies from our lab and others that implicate integrins in the outgrowth of GABAergic axons (Baum & Garriga, 1997; Chisholm et al., 2016; Forrester & Garriga, 1997; Oliver et al., 2019; Poinat et al., 2002), we sought to employ these NPxY engineered mutants to investigate integrin signaling in the formation of previously characterized dendritic spines in C. elegans GABAergic neurons (Cuentas-Condori et al., 2019; Lemons et al., 2024; Oliver et al., 2022; Oliver et al., 2026; Philbrook et al., 2018).
To investigate the role of integrin activation through the β integrin/PAT-3 NPxY motif in spine outgrowth, we used cell-specific expression of myristoylated green fluorescent protein (myrGFP) to visualize GABAergic dendrites in 3 available strains carrying CRISPR-engineered mutations in the conserved tyrosine residue of the PAT-3 membrane distal NPxY motif: wild type 801NPVY804 to NPVA804 [alanine, pat-3(kq8041)], NPVE804 [glutamate, pat-3(kq8042)], or NPVF804 [phenylalanine, (pat-3(kq8043)] (Bumm et al., 2025; Hanna et al., 2020). These mutations are expected to disrupt the tyrosine residue (A), mimic tyrosine phosphorylation (E), or mimic non-phosphorylatable tyrosine (F), respectively. Consistent with previous studies (Lemons et al., 2024; Oliver et al., 2022; Philbrook et al., 2018), we observed roughly 8 dendritic spines in a 15 μm region anterior to the DD1 GABAergic neuron cell body of wild-type larval stage 4 (L4) animals (Figure 1A-C). The number of dendritic spines on GABAergic DD1 neurons was significantly reduced by 43±6% in pat-3(kq8042) animals carrying a Y>E substitution (Figure 1B,C). Surprisingly, some spines appeared dorsally rather than ventrally oriented in these animals (Figure 1B, D), suggesting either misdirected spine growth or the possibility of ectopic synaptic contacts. Substitution of the negatively charged glutamic acid (E) for tyrosine (Y) in pat-3(kq8042) animals is predicted to mimic tyrosine phosphorylation (Anthis et al., 2009; Qiu et al., 2019; Reszka et al., 1992). Previous studies suggest phosphorylation of the distal NPxY motif disrupts kindlin binding, therefore disabling kindlin's ability to co-activate integrin (Bledzka et al., 2010; Harburger et al., 2009). Our findings suggest that constitutive tyrosine phosphorylation disrupts dendritic spines, perhaps by impacting interactions with kindlin/UNC-112 or other modulators of integrin activation that act through this motif.
To ask whether the effects of the PAT-3 Y/E substitution were specific to the post-synapse or affected both pre- and postsynaptic specializations, we examined the distribution of the GFP-tagged active zone marker CLA-1 (Xuan et al., 2017) in cholinergic neurons, which are presynaptic partners to GABAergic motor neurons. As expected, CLA-1::GFP puncta were observed on the ventral side of ventrally directed spines in wild-type controls (Figure 1E), indicating presynaptic specializations opposing the dendritic spines. We found that the number of CLA-1::GFP puncta within a 50 μm region of the anterior ventral nerve cord was significantly decreased in pat-3(kq8042) animals compared to controls (Figure 1F), while the size of CLA-1::GFP puncta slightly increased (Figure 1G). These findings demonstrate that both pre- and postsynaptic specializations are disrupted in pat-3(kq8042) animals.
We next examined dendritic spines in pat-3(kq8041) and pat-3(kq8043) animals. A tyrosine (Y) to phenylalanine substitution (F) in the NPxY motif in pat-3(kq8043) animals is predicted to preserve hydrophobic interactions associated with tyrosine but eliminate phosphorylation, perhaps acting similarly to a non-phosphorylatable tyrosine residue (Chen et al., 2006; Xu et al., 2010). The tyrosine (Y) to alanine substitution (A) in the NPxY motif of pat-3(kq8041) animals is predicted to disrupt interactions requiring the hydrophobic aromatic ring of tyrosine as well as phosphorylation at this site (Chen et al., 2006). Surprisingly, we found that spine number was not significantly different in either of these mutants compared to wild-type animals (Figure 1B,C). Although work to date suggests the membrane-proximal and -distal NPxY motifs have independent binding partners, we can't rule out the possibility that redundancy across the motifs contributes to these findings.
Prior analysis of membrane distal NPxY substitutions revealed that all three substitutions produced defects in the migration of gonadal distal tip cells (Hanna et al., 2020). In contrast, our finding that solely the phosphomimetic Y/E substitution disrupts dendritic spines is more consistent with recent studies of neuronal function in these strains, where the phosphomimetic E substitution produced severe effects, while the A and F substitutions did not (Bumm et al., 2025). Together, our results argue that tyrosine phosphorylation at the distal NPxY motif of PAT-3 is not essential for spine outgrowth, but may instead have a modulatory role, perhaps by influencing integrin interaction with kindlin/UNC-112 (Bledzka et al., 2010; Qadota et al., 2012).
","references":[{"reference":"Anthis NJ, Haling JR, Oxley CL, Memo M, Wegener KL, Lim CJ, Ginsberg MH, Campbell ID. 2009. Beta integrin tyrosine phosphorylation is a conserved mechanism for regulating talin-induced integrin activation. J Biol Chem 284(52): 36700-36710.
","pubmedId":"19843520","doi":""},{"reference":"Baum PD, Garriga G. 1997. Neuronal migrations and axon fasciculation are disrupted in ina-1 integrin mutants. Neuron. 19: 51-62. 1047.","pubmedId":"9247263","doi":""},{"reference":"Bledzka K, Bialkowska K, Nie H, Qin J, Byzova T, Wu C, Plow EF, Ma YQ. 2010. Tyrosine phosphorylation of integrin beta3 regulates kindlin-2 binding and integrin activation. J Biol Chem 285(40): 30370-4.
","pubmedId":"20702409","doi":""},{"reference":"Bumm JH, Lee DD, Qiu Z, Choi AH, Kolluri M, Olsen MJ, Wang L, Lee M. 2025. The beta integrin modulates serotonin sensitivity via NPxY motifs to regulate egg laying and mechanosensation behaviors in Caenorhabditis elegans. Dev Dyn 1442.","pubmedId":"41117756","doi":"10.1002/dvdy.70090"},{"reference":"Calderwood DA. 2004. Talin controls integrin activation. Biochem Soc Trans. 32: 434-7. 675.","pubmedId":"15157154","doi":"10.1042/BST0320434"},{"reference":"Calderwood DA. 2004. Integrin activation. J Cell Sci. 117: 657-66. 676.","pubmedId":"14754902","doi":"10.1242/jcs.01014"},{"reference":"Calderwood DA, Campbell ID, Critchley DR. 2013. Talins and kindlins: partners in integrin-mediated adhesion. Nat Rev Mol Cell Biol 14(8): 503-17.
","pubmedId":"23860236","doi":""},{"reference":"Calderwood DA, Yan B, de Pereda JM, Alvarez BG, Fujioka Y, Liddington RC, Ginsberg MH. 2002. The phosphotyrosine binding-like domain of talin activates integrins. J Biol Chem 277(24): 21749-58.
","pubmedId":"11932255","doi":""},{"reference":"Campbell ID, Humphries MJ. 2011. Integrin structure, activation, and interactions. Cold Spring Harb Perspect Biol 3(3): 10.1101/cshperspect.a004994.
","pubmedId":"21421922","doi":""},{"reference":"Chen H, Zou Z, Sarratt KL, Zhou D, Zhang M, Sebzda E, Hammer DA, Kahn ML. 2006. In vivo beta1 integrin function requires phosphorylation-independent regulation by cytoplasmic tyrosines. Genes Dev 20(8): 927-32.
","pubmedId":"16618804","doi":""},{"reference":"Chisholm AD, Hutter H, Jin Y, Wadsworth WG. 2016. The Genetics of Axon Guidance and Axon Regeneration in Caenorhabditis elegans. Genetics. 204: 849-882. 1406.","pubmedId":"28114100","doi":"10.1534/genetics.115.186262"},{"reference":"Cuentas-Condori A, Mulcahy B, He S, Palumbos S, Zhen M, Miller DM 3rd. 2019. C. elegans neurons have functional dendritic spines. Elife 8: 10.7554/eLife.47918.
","pubmedId":"31584430","doi":""},{"reference":"Czuchra A, Meyer H, Legate KR, Brakebusch C, Fässler R. 2006. Genetic analysis of beta1 integrin \"activation motifs\" in mice. J Cell Biol 174(6): 889-99.
","pubmedId":"16954348","doi":""},{"reference":"de Wit J, Ghosh A. 2016. Specification of synaptic connectivity by cell surface interactions. Nat Rev Neurosci 17(1): 22-35.
","pubmedId":"26656254","doi":""},{"reference":"Dityatev A, Schachner M, Sonderegger P. 2010. The dual role of the extracellular matrix in synaptic plasticity and homeostasis. Nat Rev Neurosci. 11: 735-46. 1242.","pubmedId":"20944663","doi":"10.1038/nrn2898"},{"reference":"Drapeau P, Catarsi S, Merz DC. 1995. Signalling synapse formation between identified neurons. J Physiol Paris 89(3): 115-23.
","pubmedId":"7581300","doi":""},{"reference":"Fässler R, Meyer M. 1995. Consequences of lack of beta 1 integrin gene expression in mice. Genes Dev 9(15): 1896-908.
","pubmedId":"7544313","doi":""},{"reference":"Forrester WC, Garriga G. 1997. Genes necessary for C. elegans cell and growth cone migrations. Development. 124: 1831-43. 1053.","pubmedId":"9165130","doi":""},{"reference":"Gettner SN, Kenyon C, Reichardt LF. 1995. Characterization of beta pat-3 heterodimers, a family of essential integrin receptors in C. elegans. J Cell Biol. 129: 1127-41. 1080.","pubmedId":"7744961","doi":""},{"reference":"Giancotti FG, Ruoslahti E. 1999. Integrin signaling. Science. 285: 1028-32. 363.","pubmedId":"10446041","doi":""},{"reference":"Ginsberg MH. 2014. Integrin activation. BMB Rep. 47: 655-9. 1163.","pubmedId":"25388208","doi":""},{"reference":"Hanna J, Ramani S, Williams T, Anaya R, Campion N, Lopez E, et al., Lee M. 2020. Three alleles in the pat-3 locus of Caenorhabditis elegans: mutations in the membrane-distal NPxY phosphotyrosine motif. MicroPubl Biol. 2020 1441.","pubmedId":"32821887","doi":"10.17912/micropub.biology.000291"},{"reference":"He S, Philbrook A, Mc Whirter R, Gabel CV, Taub DG, Carter MH, et al., Miller DM. 2015. Transcriptional Control of Synaptic Remodeling through Regulated Expression of an Immunoglobulin Superfamily Protein. Curr Biol. 25: 2541-8. 1161.","pubmedId":"26387713","doi":"10.1016/j.cub.2015.08.022"},{"reference":"Humphries JD, Byron A, Humphries MJ. 2006. Integrin ligands at a glance. J Cell Sci. 119: 3901-3. 856.","pubmedId":"16988024","doi":"119/19/3901 [pii] 10.1242/jcs.03098"},{"reference":"Hynes RO. 1992. Integrins: versatility, modulation, and signaling in cell adhesion. Cell. 69: 11-25.. 97.","pubmedId":"","doi":""},{"reference":"Hynes RO. 2002. Integrins: bidirectional, allosteric signaling machines. Cell. 110: 673-87. 865.","pubmedId":"12297042","doi":"S0092867402009716"},{"reference":"Jannuzi AL, Bunch TA, Brabant MC, Miller SW, Mukai L, Zavortink M, Brower DL. 2002. Disruption of C-terminal cytoplasmic domain of betaPS integrin subunit has dominant negative properties in developing Drosophila. Mol Biol Cell 13(4): 1352-65.
","pubmedId":"11950944","doi":""},{"reference":"Jannuzi AL, Bunch TA, West RF, Brower DL. 2004. Identification of integrin beta subunit mutations that alter heterodimer function in situ. Mol Biol Cell 15(8): 3829-40.
","pubmedId":"15194810","doi":""},{"reference":"Kääpä A, Peter K, Ylänne J. 1999. Effects of mutations in the cytoplasmic domain of integrin beta(1) to talin binding and cell spreading. Exp Cell Res 250(2): 524-34.
","pubmedId":"10413605","doi":""},{"reference":"Kim C, Ye F, Ginsberg MH. 2011. Regulation of integrin activation. Annu Rev Cell Dev Biol. 27: 321-45. 1152.","pubmedId":"21663444","doi":"10.1146/annurev-cellbio-100109-104104"},{"reference":"Kramer JM. 2005. Basement membranes. WormBook: 1-15.
","pubmedId":"18050423","doi":""},{"reference":"Lee M, Cram EJ, Shen B, Schwarzbauer JE. 2001. Roles for beta(pat-3) integrins in development and function of Caenorhabditis elegans muscles and gonads. J Biol Chem. 276: 36404-10. 1167.","pubmedId":"11473126","doi":"10.1074/jbc.M105795200"},{"reference":"Lemons M L, McKillop H, Genao N, Francis M M. 2024. The extracellular matrix molecule Collagen XVIII/CLE-1 affects neuronal dendritic spines. MicroPubl Biol 2024: 10.17912/micropub.biology.001331.
","pubmedId":"39568805","doi":""},{"reference":"Liddington RC, Ginsberg MH. 2002. Integrin activation takes shape. J Cell Biol. 158: 833-9. 688.","pubmedId":"12213832","doi":"10.1083/jcb.200206011 cb.200206011 [pii]"},{"reference":"Lilja J, Ivaska J. 2018. Integrin activity in neuronal connectivity. J Cell Sci 131(12): pii: jcs212803. 10.1242/jcs.212803.
","pubmedId":"29907643","doi":""},{"reference":"Mello CC, Kramer JM, Stinchcomb D, Ambros V. 1991. Efficient gene transfer in C.elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J. 10: 3959-70. 1413.","pubmedId":"1935914","doi":""},{"reference":"Morse EM, Brahme NN, Calderwood DA. 2014. Integrin Cytoplasmic\nTail Interactions. Biochemistry 53: 810-820.
","pubmedId":"","doi":"10.1021/bi401596q"},{"reference":"Moser M, Legate KR, Zent R, Fassler R. 2009. The tail of integrins, talin, and kindlins. Science. 324: 895-9. 689.","pubmedId":"19443776","doi":"324/5929/895 [pii]10.1126/science.1163865"},{"reference":"Nakamoto T, Kain KH, Ginsberg MH. 2004. Neurobiology: New connections between integrins and axon guidance. Curr Biol. 14: R121-3. 412.","pubmedId":"14986683","doi":""},{"reference":"Oliver D, Norman E, Bates H, Avard R, Rettler M, Bénard CY, Francis MM, Lemons ML. 2019. Integrins Have Cell-Type-Specific Roles in the Development of Motor Neuron Connectivity. J Dev Biol 7(3): 10.3390/jdb7030017.
","pubmedId":"31461926","doi":""},{"reference":"Oliver D, Ramachandran S, Philbrook A, Lambert CM, Nguyen KCQ, Hall DH, Francis MM. 2022. Kinesin-3 mediated axonal delivery of presynaptic neurexin stabilizes dendritic spines and postsynaptic components. PLoS Genet 18(1): e1010016.
","pubmedId":"35089924","doi":""},{"reference":"Oliver DB, Ramachandran S, Biswas K, Bénard CY, Doitsidou M, McKillop H, et al., Francis MM. 2026. Genome-wide analysis reveals pathways important for the development and maturation of excitatory synaptic connections to GABAergic neurons. G3 (Bethesda) 16(4): 10.1093/g3journal/jkag028.
","pubmedId":"41655250","doi":""},{"reference":"Park YK, Goda Y. 2016. Integrins in synapse regulation. Nat Rev Neurosci. 17: 745-756. 1226.","pubmedId":"27811927","doi":"10.1038/nrn.2016.138"},{"reference":"Philbrook A, Ramachandran S, Lambert CM, Oliver D, Florman J, Alkema MJ, Lemons M, Francis MM. 2018. Neurexin directs partner-specific synaptic connectivity in C. elegans. Elife. 7 1401.","pubmedId":"30039797","doi":"10.7554/eLife.35692"},{"reference":"Poinat P, De Arcangelis A, Sookhareea S, Zhu X, Hedgecock EM, Labouesse M, Georges Labouesse E. 2002. A conserved interaction between beta1 integrin/PAT-3 and Nck-interacting kinase/MIG-15 that mediates commissural axon navigation in C. elegans. Curr Biol. 12: 622-31. 1055.","pubmedId":"11967148","doi":""},{"reference":"Qadota H, Moerman DG, Benian GM. 2012. A Molecular Mechanism for the Requirement of PAT-4 (Integrin-linked Kinase (ILK)) for the Localization of UNC-112 (Kindlin) to Integrin Adhesion Sites. Journal of Biological Chemistry 287: 28537-28551.
","pubmedId":"","doi":"10.1074/jbc.M112.354852"},{"reference":"Qiu Z, Sheesley P, Ahn JH, Yu EJ, Lee M. 2019. A Novel Mutation in an NPXY Motif of β Integrin Reveals Phenotypes Similar to him-4/hemicentin. Front Cell Dev Biol 7: 247.
","pubmedId":"31720287","doi":""},{"reference":"Reszka AA, Hayashi Y, Horwitz AF. 1992. Identification of amino acid sequences in the integrin beta 1 cytoplasmic domain implicated in cytoskeletal association. J Cell Biol 117(6): 1321-30.
","pubmedId":"1376731","doi":""},{"reference":"Sakai T, Zhang Q, Fässler R, Mosher DF. 1998. Modulation of beta1A integrin functions by tyrosine residues in the beta1 cytoplasmic domain. J Cell Biol 141(2): 527-38.
","pubmedId":"9548729","doi":""},{"reference":"Sonnenberg A. 1993. Integrins and their ligands. Curr Top Microbiol Immunol. 184: 7-35. 1414.","pubmedId":"8313723","doi":""},{"reference":"Waites CL, Craig AM, Garner CC. 2005. Mechanisms of vertebrate synaptogenesis. Annu Rev Neurosci 28: 251-74.
","pubmedId":"16022596","doi":""},{"reference":"Wang JH. 2012. Pull and push: talin activation for integrin signaling. Cell Res 22(11): 1512-4.
","pubmedId":"22777425","doi":""},{"reference":"Xu X, Ahn JH, Tam P, Yu EJ, Batra S, Cram EJ, Lee M. 2010. Analysis of conserved residues in the betapat-3 cytoplasmic tail reveals important functions of integrin in multiple tissues. Dev Dyn 239(3): 763-72.
","pubmedId":"20063417","doi":""},{"reference":"Xuan Z, Manning L, Nelson J, Richmond JE, Colón-Ramos DA, Shen K, Kurshan PT. 2017. Clarinet (CLA-1), a novel active zone protein required for synaptic vesicle clustering and release. Elife 6: 10.7554/eLife.29276.
","pubmedId":"29160205","doi":""},{"reference":"Ye F, Snider AK, Ginsberg MH. 2014. Talin and kindlin: the one-two punch in integrin activation. Front Med 8(1): 6-16.
","pubmedId":"24477625","doi":""}],"title":"A mutation in the conserved NPxY motif of β integrin PAT-3 alters outgrowth of neuronal dendritic spines
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null}]}]}},"species":{"species":[{"value":"acer saccharum","label":"Acer saccharum","imageSrc":"","imageAlt":"","mod":"TreeGenes","modLink":"https://treegenesdb.org","linkVariable":""},{"value":"achillea millefolium","label":"Achillea millefolium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"acinetobacter baylyi","label":"Acinetobacter baylyi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"actinobacteria bacterium","label":"Actinobacteria bacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adelges tsugae","label":"Adelges tsugae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adenocaulon chilense","label":"Adenocaulon chilense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aedes japonicus","label":"Aedes japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aegorhinus vitulus","label":"Aegorhinus vitulus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aerococcus","label":"Aerococcus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alaimidae","label":"Alaimidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"allobates femoralis","label":"Allobates femoralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alnus glutinosa","label":"Alnus glutinosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa aestivalis","label":"Alosa aestivalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa pseudoharengus","label":"Alosa pseudoharengus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alternaria alternata","label":"Alternaria alternata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"amynthas agrestis","label":"Amynthas Agrestis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma caninum","label":"Ancylostoma caninum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma ceylanicum","label":"Ancylostoma ceylanicum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anemone multifida","label":"Anemone multifida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anguilla rostrata","label":"Anguilla rostrata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anisakis simplex","label":"Anisakis simplex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anomala albopilosa","label":"Anomala albopilosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arabidopsis","label":"Arabidopsis","imageSrc":"arabidopsis.png","imageAlt":"Arabidopsis graphic by Zoe Zorn CC BY 4.0","mod":"TAIR","modLink":"https://arabidopsis.org","linkVariable":""},{"value":"architeuthis dux","label":"Architeuthis dux","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arion vulgaris","label":"Arion vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"armeria","label":"Armeria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"artemia","label":"Artemia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arthrobacter sp.","label":"Arthrobacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia","label":"Ascaridia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia galli","label":"Ascaridia galli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"asparagopsis taxiformis","label":"Asparagopsis taxiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"astatotilapia burtoni","label":"Astatotilapia burtoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"avena sativa","label":"Avena sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aves","label":"Aves","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus","label":"Bacillus (firmicutes)","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus cereus","label":"Bacillus cereus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus mycoides","label":"Bacillus mycoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus subtilis","label":"Bacillus subtilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus thuringiensis","label":"Bacillus thuringiensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus toyonensis","label":"Bacillus toyonensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus wiedmannii","label":"Bacillus wiedmannii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteria","label":"Bacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteriophage","label":"Bacteriophage","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bactrocera","label":"Bactrocera sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"batrachospermum gelatinosum","label":"Batrachospermum gelatinosum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula lenta","label":"Betula lenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula nigra","label":"Betula nigra","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus dahlbohmii","label":"Bombus dahlbohmii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus terrestris","label":"Bombus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombyx mori","label":"Bombyx mori","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bos taurus","label":"Bos Taurus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brachygobius doriae","label":"Brachygobius doriae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica oleracea","label":"Brassica oleracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica rapa","label":"Brassica rapa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brugia malayi","label":"Brugia malayi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"burkholderia thailandensis","label":"Burkholderia thailandensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"buttiauxella","label":"Buttiauxella","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis brenneri","label":"Caenorhabditis brenneri","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis briggsae","label":"Caenorhabditis briggsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"c. elegans","label":"Caenorhabditis elegans","imageSrc":"c-elegans.jpg","imageAlt":"C. elegans graphic by Zoe Zorn CC BY 4.0","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"caenorhabditis inopinata","label":"Caenorhabditis inopinata","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis japonica","label":"Caenorhabditis japonica","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis nigoni","label":"Caenorhabditis nigoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis remanei","label":"Caenorhabditis remanei","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis tropicalis","label":"Caenorhabditis tropicalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus","label":"Calidifontibacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus erzuremensis","label":"Calidifontibacillus erzuremensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calliphora sp","label":"Calliphora sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caltha sagittata","label":"Caltha sagittata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cambarus latimanus","label":"Cambarus latimanus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"candida albicans","label":"Candida albicans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"canis familiaris","label":"Canis familiaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cannabis sativa","label":"Cannabis sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caretta caretta","label":"Caretta caretta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cassiopea xamachana","label":"Cassiopea xamachana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caulobacter vibrioides","label":"Caulobacter vibrioides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cephalopods","label":"Cephalopoda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cerastium arvense","label":"Cerastium arvense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceriodaphnia","label":"Ceriodaphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceroglossus suturalis","label":"Ceroglossus suturalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chaetoceros","label":"Chaetoceros","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chamaecrista fasciculata","label":"Chamaecrista fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chilicola chalcidiformis","label":"Chilicola chalcidiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chitinimonas","label":"Chitinimonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chlamydomonas reinhardtii","label":"Chlamydomonas reinhardtii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chromobacterium","label":"Chromobacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysemys picta","label":"Chrysemys picta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysoperla rufilabris","label":"Chrysoperla rufilabris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"citrus","label":"Citrus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"clavibacter sp.","label":"Clavibacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"colinus virginianus","label":"Colinus virginianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crassostrea virginica","label":"Crassostrea virginica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crithidia fasciculata","label":"Crithidia fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cutibacterium acnes","label":"Cutibacterium acnes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cyanobacteria","label":"Cyanobacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia","label":"Daphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia pulex","label":"Daphnia pulex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dermacoccus nishinomiyaensis","label":"Dermacoccus nishinomiyaensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera","label":"Diabrotica virgifera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera virgifera virus 1","label":"Diabrotica virgifera virgifera virus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"d. discoideum","label":"Dictyostelium discoideum","imageSrc":"dicty.png","imageAlt":"D. discoideum","mod":"dictyBase","modLink":"http://dictybase.org","linkVariable":""},{"value":"diptera","label":"Diptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dotocryptus bellicosus","label":"Dotocryptus bellicosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drechmeria coniospora","label":"Drechmeria coniospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drosophila","label":"Drosophila","imageSrc":"drosophila.png","imageAlt":"Drosophila graphic by Zoe Zorn CC BY 4.0","mod":"FlyBase","modLink":"https://flybase.org/doi/","linkVariable":"doi"},{"value":"dryopteris campyloptera","label":"Dryopteris campyloptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris expansa","label":"Dryopteris expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris intermedia","label":"Dryopteris intermedia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dugesia dorotocephala","label":"Dugesia dorotocephala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"elasmobranchii","label":"Elasmobranchii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"embryophyta","label":"Embryophyta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enoploteuthis chunii","label":"Enoploteuthis chunii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterobacter aerogenes","label":"Enterobacter aerogenes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterococcus raffinosus","label":"Enterococcus raffinosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"epichloë coenophiala","label":"Epichloë coenophiala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"equus caballus","label":"Equus caballus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erigeron sp","label":"Erigeron sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eristalis","label":"Eristalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eruca vesicaria","label":"Eruca vesicaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erwinia carotovora","label":"Erwinia carotovora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erythronium americanum","label":"Erythronium americanum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"escherichia coli","label":"Escherichia coli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eukaryota","label":"Eukaryotes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"felis catus","label":"Felis catus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella novicida","label":"Francisella novicida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella tularensis","label":"Francisella tularensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fraxinus americana","label":"Fraxinus americana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fucus distichus","label":"Fucus distichus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fungi","label":"Fungi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gasteropelecus sp.","label":"Gasteropelecus sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"geranium sp","label":"Geranium sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"girardia","label":"Girardia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glaucomys volans","label":"Glaucomys volans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glycine max","label":"Glycine max","imageSrc":"","imageAlt":"","mod":"Soybase","modLink":"https://soybase.org","linkVariable":""},{"value":"glyptemys insculpta","label":"Glyptemys insculpta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gossypium hirsutum","label":"Gossypium hirsutum","imageSrc":"","imageAlt":"","mod":"CottonGen","modLink":"https://www.cottongen.org/","linkVariable":""},{"value":"gromphadorhina portentosa","label":"Gromphadorhina portentosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gryllodes sigillatus","label":"Gryllodes sigillatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"haliotis rufescens","label":"Haliotis rufescens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hepacivirus hominis","label":"Hepatitis C Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"herpes simplex virus type 1","label":"Herpes simplex virus type 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human","label":"Human","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human coronavirus oc43","label":"Human coronavirus OC43","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydra vulgaris","label":"Hydra vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydropsyche sp","label":"Hydropsyche sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hymenoptera","label":"Hymenoptera","imageSrc":"","imageAlt":"","mod":"Hymenoptera Genome Database","modLink":"https://hymenoptera.elsiklab.missouri.edu/","linkVariable":""},{"value":"hypochaeris radicata","label":"Hypochaeris radicata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hypodynerus vespiformis","label":"Hypodynerus vespiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflaviridae","label":"Iflaviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflavuris","label":"Iflavirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ipomoea hederacea","label":"Ipomoea hederacea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera","label":"Ischnomera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera ruficollis","label":"Ischnomera ruficollis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"julidochromis marlieri","label":"Julidochromis marlieri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"juniperus virginiana","label":"Juniperus virginiana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"kluyveromyces marxianus","label":"Kluyveromyces marxianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"l. casei","label":"L. casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lacticaseibacillus casei","label":"Lacticaseibacillus casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lactobacillus","label":"Lactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"larentiinae sp","label":"Larentiinae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"laurus nobilis","label":"Laurus nobilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lepidoptera","label":"Lepidoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"leucanthemum vulgare","label":"Leucanthemum vulgare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ligilactobacillus","label":"Ligilactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ligilactobacillus salivarius","label":"Ligilactobacillus salivarius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"limosilactobacillus","label":"Limosilactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"linepithema humile","label":"Linepithema humile","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"liometopum occidentale","label":"Liometopum occidentale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lolium arundinaceum","label":"Lolium arundinaceum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lontra longicaudis","label":"Lontra longicaudis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbriculus variegatus","label":"Lumbriculus variegatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbricus terrestris","label":"Lumbricus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lupinus polyphyllus","label":"Lupinus polyphyllus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lycorma delicatula","label":"Lycorma delicatula","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lynx rufus","label":"Lynx rufus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"magnaporthe oryzae","label":"Magnaporthe oryzae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mammalia","label":"Mammalia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"manihot esculenta","label":"Manihot esculenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"medicago lupulina","label":"Medicago lupulina","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"meloidogyne","label":"Meloidogyne","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mimus polyglottos","label":"Mimus polyglottos","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bryophyta","label":"Mosses","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mouse","label":"Mouse","imageSrc":"","imageAlt":"","mod":"MGI","modLink":"https://informatics.jax.org","linkVariable":""},{"value":"m. minutoides","label":"Mus minutoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mycobacterium smegmatis","label":"Mycobacterium smegmatis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nakaseomyces glabratus","label":"Nakaseomyces glabratus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nauphoeta cinerea","label":"Nauphoeta cinerea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"neurospora","label":"Neurospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"n. benthamiana","label":"Nicotiana benthamiana","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/Nicotiana_benthamiana/genome","linkVariable":""},{"value":"nicotiana tabacum","label":"Nicotiana tabacum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae","label":"Noctuidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae sp","label":"Noctuidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nothobranchius furzeri","label":"Nothobranchius furzeri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"onchocerca volvulus","label":"Onchocerca volvulus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"orconectes virilis","label":"Orconectes virilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ormia ochracea","label":"Ormia ochracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"o. sativa","label":"Oryza sativa","imageSrc":"","imageAlt":"","mod":"Gramene","modLink":"https://www.gramene.org/","linkVariable":""},{"value":"other","label":"Other","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"oxalis enneaphylla","label":"Oxalis enneaphylla","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea","label":"Pantoea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea agglomerans","label":"Pantoea agglomerans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"papaver sp","label":"Papaver sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paramecium bursaria","label":"Paramecium bursaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"partitiviridae","label":"Partitiviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pelodiscus sinensis","label":"Pelodiscus sinensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"perezia recurvata","label":"Perezia recurvata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"petromyzon marinus","label":"Petromyzon marinus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis","label":"Photinus pyralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis associated partiti-like virus","label":"Photinus pyralis associated partiti-like virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis iflavirus 1","label":"Photinus pyralis iflavirus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"physcomitrium patens","label":"Physcomitrium patens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus strobus","label":"Pinus strobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus taeda","label":"Pinus taeda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"platycheirus","label":"Platycheirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"plectus sambesii","label":"Plectus sambesii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pogonomyrmex occidentalis","label":"Pogonomyrmex occidentalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"poncirus trifoliata","label":"Poncirus trifoliata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"populus deltoides","label":"Populus deltoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"potato virus y","label":"Potato virus Y","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"primula magellanica","label":"Primula magellanica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pristionchus pacificus","label":"Pristionchus pacificus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"prunus persica","label":"Prunus persica","imageSrc":"","imageAlt":"","mod":"Genome Database for Rosaceae","modLink":"https://www.rosaceae.org/","linkVariable":""},{"value":"psalmopoeus iriminia","label":"Psalmopoeus iriminia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudanabaena sp.","label":"Pseudanabaena sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas","label":"Pseudomonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas aeruginosa","label":"Pseudomonas aeruginosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas glycinae","label":"Pseudomonas glycinae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas putida","label":"Pseudomonas putida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas syringae","label":"Pseudomonas syringae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pterophyllum scalare","label":"Pterophyllum scalare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"python regius","label":"Python regius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"quercus macrocarpa","label":"Quercus macrocarpa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ralstonia solanacearum","label":"Ralstonia solanacearum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranitomeya imitator","label":"Ranitomeya imitator","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranunculus peduncularis","label":"Ranunculus peduncularis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"rat","label":"Rat","imageSrc":"","imageAlt":"","mod":"RGD","modLink":"https://rgd.mcw.edu","linkVariable":""},{"value":"rheinheimera","label":"Rheinheimera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ribes rubrum","label":"Ribes rubrum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"sars-cov-2","label":"SARS-CoV-2","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. cerevisiae","label":"Saccharomyces cerevisiae","imageSrc":"yeast.png","imageAlt":"Yeast graphic by Zoe Zorn CC BY 4.0","mod":"SGD","modLink":"https://yeastgenome.org","linkVariable":""},{"value":"saccharomyces paradoxus","label":"Saccharomyces paradoxus ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. uvarum","label":"Saccharomyces uvarum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schistosoma","label":"Schistosoma","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schizosaccharomyces japonicus","label":"Schizosaccharomyces japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. pombe","label":"Schizosaccharomyces pombe","imageSrc":"pombe.png","imageAlt":"Pombe graphic by Zoe Zorn © Caltech","mod":"PomBase","modLink":"https://www.pombase.org/reference/PMID:","linkVariable":"pmId"},{"value":"schmidtea mediterranea","label":"Schmidtea mediterranea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"senecio sp","label":"Senecio sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"simocephalus","label":"Simocephalus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"siraitia grosvenorii","label":"Siraitia grosvenorii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"solanum lycopersicum","label":"Solanum lycopersicum","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/1/view/","linkVariable":""},{"value":"sorghum","label":"Sorghum","imageSrc":"","imageAlt":"","mod":"SorghumBase","modLink":"https://www.sorghumbase.org","linkVariable":""},{"value":"spiroplasma eriocheiris","label":"Spiroplasma eriocheiris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus aureus","label":"Staphylococcus aureus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus epidermidis","label":"Staphylococcus epidermidis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"steinernema carpocapsae","label":"Steinernema carpocapsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"steinernema hermaphroditum","label":"Steinernema hermaphroditum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stenotrophomonas geniculata","label":"Stenotrophomonas geniculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stewartia floidana","label":"Stewartia floridana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus gordonii ","label":"Streptococcus gordonii ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus mutans","label":"Streptococcus mutans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":" streptococcus pneumoniae","label":"Streptococcus pneumoniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. purpuratus","label":"Strongylocentrotus purpuratus","imageSrc":"","imageAlt":"","mod":"Echinobase","modLink":"https://www.echinobase.org","linkVariable":""},{"value":"strongyloides ratti","label":"Strongyloides ratti","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"sulfolobus","label":"Sulfolobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"symphoricarpos albus","label":"Symphoricarpos albus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syncirsodes","label":"Syncirsodes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"synechococcus elongatus","label":"Synechococcus elongatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syrphidae","label":"Syrphidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tarantobelus jeffdanielsi","label":"Tarantobelus jeffdanielsi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"taraxacum officinale","label":"Taraxacum officinale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tatochila theodice","label":"Tatochila theodice","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetrahymena","label":"Tetrahymena","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetramorium immigrans","label":"Tetramorium immigrans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tomato brown rugose fruit virus","label":"ToBRFV","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trachemys scripta","label":"Trachemys scripta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tribolium castaneum","label":"Tribolium castaneum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichoptera","label":"Trichoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichuris muris","label":"Trichuris muris","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"trifolium repens","label":"Trifolium repens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trypoxylus dichotomus","label":"Trypoxylus dichotomus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tsuga canadensis","label":"Tsuga canadensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ulva expansa","label":"Ulva expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"universal","label":"Universal","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"vargula hilgendorfii","label":"Vargula hilgendorfii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"vespula vulgaris","label":"Vespula vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"virus","label":"Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"watasenia scintillans","label":"Watasenia scintillans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"wolbachia pipientis","label":"Wolbachia pipientis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"xenopus","label":"Xenopus","imageSrc":"xenopus.png","imageAlt":"Xenopus graphic by Zoe Zorn CC BY 4.0","mod":"XenBase","modLink":"https://xenbase.org","linkVariable":""},{"value":"xenorhabdus griffiniae","label":"Xenorhabdus griffiniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"yramea cytheris","label":"Yramea cytheris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zaprionus indianus","label":"Zaprionus indianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zea mays","label":"Zea mays","imageSrc":"","imageAlt":"","mod":"MaizeGDB","modLink":"https://www.maizegdb.org","linkVariable":""},{"value":"zebrafish","label":"Zebrafish","imageSrc":"zebrafish.png","imageAlt":"Zebrafish graphic by Zoe Zorn CC BY 4.0","mod":"ZFIN","modLink":"https://zfin.org","linkVariable":""}]}},"pageContext":{"id":"187ac275-ed02-4f49-ba27-3a446caa024d","citedBy":[],"parsedCsv":{"csvHeader":[],"csvData":[]}}}, "staticQueryHashes": ["2114697108"]}