F-BOX STRESS INDUCED (FBS) proteins are substrate adaptors in SCF-type E3 ubiquitin ligases that regulate plant development and stress responses. Arabidopsis thaliana FBS1 interacts with multiple 14-3-3 proteins, but it is unknown whether other AtFBS family members share these interactions. Bimolecular fluorescence complementation (BiFC) assays in Nicotiana benthamiana showed that all four AtFBS proteins interact with multiple 14-3-3 proteins in vivo. However, AtFBS1 interactions were restricted to the nucleus, whereas AtFBS2 – AtFBS4 interactions were detected in both the nucleus and cytosol. These findings indicate conserved 14-3-3 interactions within the AtFBS family, but suggest functional divergence in subcellular interaction profiles.
","acknowledgements":"We thank Michal Morrison-Kerr for storeroom support, David Somers for providing H2B-RFP, and Xing Wang Deng for providing pCL112 and pCL113 vectors, as well as the SPA1 constructs.
","authors":[{"affiliations":["University of Puget Sound, Tacoma, WA"],"departments":[""],"credit":["conceptualization","investigation","formalAnalysis","methodology"],"email":"maelbradley24@gmail.com","firstName":"Mael","lastName":"Bradley","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Cal Berkeley, Berkeley, CA","University of Puget Sound, Tacoma, WA"],"departments":["",""],"credit":["conceptualization","formalAnalysis","investigation","methodology"],"email":"mbacher@berkeley.edu","firstName":"Meghan","lastName":"Bacher","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Washingtone State University, Pullman, WA","University of Puget Sound, Tacoma, WA"],"departments":["",""],"credit":["formalAnalysis","investigation"],"email":"kaitlin.riggan@wsu.edu","firstName":"Kaitlin","lastName":"Riggan","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Puget Sound, Tacoma, WA"],"departments":[""],"credit":["formalAnalysis","investigation"],"email":"nicolo.spalding@gmail.com","firstName":"Nicolo","lastName":"Torresan","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Puget Sound, Tacoma, WA"],"departments":[""],"credit":["formalAnalysis","investigation"],"email":"mtegman@pugetsound.edu","firstName":"Megan","lastName":"Tegman","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Rhode Island, Kingston, RI","University of Puget Sound, Tacoma, WA"],"departments":["",""],"credit":["formalAnalysis","investigation"],"email":"sabine.angier@uri.edu","firstName":"Sabine","lastName":"Angier","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Puget Sound, Tacoma, WA"],"departments":[""],"credit":["investigation","methodology"],"email":"areplogle@pugetsound.edu","firstName":"Amy","lastName":"Replogle","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Puget Sound, Tacoma, WA"],"departments":[""],"credit":["fundingAcquisition","conceptualization","dataCuration","writing_originalDraft","writing_reviewEditing"],"email":"bthines@pugetsound.edu","firstName":"Bryan","lastName":"Thines","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":null}],"awards":[{"awardId":"grant #2035582 ","funderName":"National Science Foundation (United States)","awardRecipient":"Bryan Thines"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"","image":{"url":"https://portal.micropublication.org/uploads/16537350f44192bbf2497a9b4a3e98f7.jpg"},"imageCaption":"(A – D) nYFP-AtFBS1 through nYFP-AtFBS4 were co-expressed with cYFP-14-3-3 ω and H2B-RFP in four-week-old N. benthamiana leaves. Cell walls were stained with 50 mM propidium iodide (PI), and images were taken three days after agroinfiltration. BiFC (green; first column) indicates protein interaction, while H2B-RFP and PI staining (red; second column) show nuclei and cell walls, respectively. Merged images (third column) show co-localization of BiFC signal and nucleus. (E) nYFP-PP2-A12 was co-expressed with cYFP-14-3-3 ω and H2B-RFP as a negative control. (F – J) The same nYFP fusion constructs and H2B-RFP were co-expressed with cYFP-14-3-3 ψ under identical conditions. Scale bar = 100 μm. (K) Average number of nuclei exhibiting BiFC signal per field of view (FOV; 1100μm) for nYFP-AtFBS family members co-expressed with cYFP-14-3-3 ω, and (L) co-expressed with cYFP-14-3-3 ψ. Error bars represent SE (n = 3 independent experimental replicates). Statistical significance was assessed using one-way ANOVA followed by Tukey’s HSD post-hoc tests. Means with different letters are significantly different from each other at P < 0.05.
","imageTitle":"Arabidopsis FBS interactions with 14-3-3 proteins in bimolecular fluorescence complementation (BiFC) assays
","methods":"Plasmid construction
Standard molecular biology cloning protocols were used to generate Gateway compatible constructs (Thermo Fisher Scientific). FBS and 14-3-3 coding sequences were amplified from cDNA by PCR with gene specific primers (see Reagents) using Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific). Amplicons were cloned into the pENTR entry vector with the pENTR/D-TOPO directional cloning kit (Thermo Fisher Scientific). Genes were then transferred into either pCL112 (creates N-terminal fusion to nYFP) or pCL113 (creates N-terminal fusion to cYFP) with LR Clonase II enzyme mix (Thermo Fisher Scientific). Sequences were verified by Sanger sequencing (Eurofins Genomics).
Agroinfiltration of Nicotiana benthamiana leaves
Agrobacterium tumefaciens strain GV3101 pMP90 was transformed by electroporation and selected by appropriate antibiotics. Seed cultures were grown in liquid LB for 2 days with shaking at 28 oC. Full cultures were inoculated with 1:100 volume and grown for 24 hours under the same conditions. Cells were pelleted and resuspended in infiltration medium (10 mM MES, 10 mM MgCl2, 100 mM acetosyringone) and incubated for 5 hours with rocking at room temperature. Cells were pelleted a second time and resuspended in infiltration medium. Appropriate nYFP/cYFP pairs, H2B-RFP, and p19 suppressor strains were mixed at a final OD600 of 1.0 for each strain. The abaxial side of Nicotiana benthamiana leaves from 4-week-old plants grown under greenhouse conditions were infiltrated by syringe with the A. tumefaciens mixes using standard protocols (Leuzinger et al., 2013).
Imaging
Three days after infiltration, N. benthamiana leaves to be imaged were infiltrated with 50 mM propidium iodide in 0.1% Tween-20 and allowed to sit for 10 minutes. Approximately 1 cm2 from infiltrated leaves was then cut and mounted on a glass slide with 0.1% Tween-20. The underside of whole leaf mounts was visualized by laser-scanning confocal microscopy using a Nikon D-Eclipse C1 Confocal laser scanning microscope (Nikon Instruments) with either: 1) excitation at 488 nm with an emission band pass filter of 515/30, or 2) excitation at 561 nm with an emission band pass filter of 650 LP. Images were processed with Fiji software (http://imagej.net/software/fiji/). Representative images from at least three independent experimental replicates are shown.
Data analysis
Nuclei containing a BiFC fluorescence signal were counted under a 20X objective lens in two separate areas of each leaf, which were then averaged, from three independent experimental trials. The field of view (FOV) diameter was 1100 µm. Statistical analyses were performed in RStudio version 4.0.4 using a one-way ANOVA and Tukey’s HSD post-hoc test.
","reagents":"
|
| Primer sequences 5' to 3' | |
Gene | AGI number | Forward | Reverse |
FBS1 | At1g61340 | CACCATGGCATTGGGGAAGAAAAGAATCG | TCAGTGGAATAGAGCCACTGAGAC |
FBS2 | At4g21510 | CACCATGATCCATTATCTCCATTTCA | TCATGTAAACAAAGCCGCAG |
FBS3 | At4g05010 | CACCATGGCGTATTTGAGTGATG | TCATTTAAACAATACCATAGAGATCTTCGACAAATC |
FBS4 | At4g35930 | CACCATGGGGAAGGTATCTCCAAAG | TCAGGTGAGGTTGTTTTGAGC |
AtPP2-A12 | At1g12710 | CACCATGGGTGTGGCTCACTCTGAT | TTAAAACCGCTTCAACTGGTC |
14-3-3 omega | At1g78300 | CACCATGGCGTCTGGGCGTGAAG | TCACTGCTGTTCCTCGGTCG |
14-3-3 psi | At5g38480 | CACCATGTCGACAAGGGAAGAGAATGT | TTACTCGGCACCATCGGG |
14-3-3 phi | At1g35160 | CACCATGGCGGCAC CACCAGCATC ATCC | TTAGATCTCCTTCTGTTCTTCAGCAGGC |
14-3-3 kappa | At5g65430 | CACCATGGCGACGACCTTAAGCAG | TCAATATGCGAGTTTCTGATGATGC |
Numerous cellular pathways in eukaryotes are regulated through selective protein degradation by the ubiquitin 26S proteasome system (UPS). SKP1-CUL1-F-box (SCF) complexes are a prevalent type of E3 ubiquitin ligase in the UPS that use F-box (FBX) proteins as substrate adaptors to specifically recruit ubiquitination targets (Lee et al., 2018; Sheard et al., 2010; Varshney et al., 2026). Four Arabidopsis thaliana F-BOX STRESS INDUCED proteins (AtFBS1 – AtFBS4) compose a subfamily of plant-specific FBX proteins (Maldonado-Calderon et al., 2012). AtFBS1 and AtFBS4 target anaphase-promoting complex/cyclosome (APC/C)-associated regulatory proteins to control cell division events and related processes, including maintenance of the root quiescent center (QC) and cell fate determination during stomatal development (Geem et al., 2022; Li et al., 2022; Zhang et al., 2025). AtFBS proteins also likely target two other nuclear-localized WD40 repeat-like family proteins of unknown function (Sepulveda-Garcia et al., 2021).
In addition to its targeting interactions, AtFBS1 interacts with at least six of thirteen proteins belonging to the Arabidopsis 14-3-3 family in yeast two-hybrid and in vitro pull-down assays (Sepulveda-Garcia & Rocha-Sosa, 2012). 14-3-3 proteins are eukaryotic regulators that specifically interact with their client proteins to alter their activity (Wilson et al., 2016). While some 14-3-3 proteins are SCF targets in plants (Hong et al., 2017), AtFBS1 does not seem to target 14-3-3 proteins for degradation, as increased AtFBS1 abundance does not lead to a decrease in the level of FBS interactor 14-3-3 λ (Sepulveda-Garcia et al., 2021; Sepulveda-Garcia & Rocha-Sosa, 2012). Furthermore, 14-3-3 proteins interact with AtFBS1 via the F-box domain (Sepulveda-Garcia & Rocha-Sosa, 2012), which is required for FBX protein interaction with Skp and the core SCF complex. The regulatory purpose and biological consequence of AtFBS1 interaction with 14-3-3 proteins are currently unknown.
Members of FBX protein subfamilies often have some functional redundancy while still maintaining distinct biological roles (Lee et al., 2018). It is almost certainly the case that AtFBS1 – AtFBS4 each have some distinct biological functions relative to each other based on their expression profiles and mutant phenotypes (Geem et al., 2022; Li et al., 2022; Maldonado-Calderon et al., 2012). However, it is unknown whether AtFBS2 – AtFBS4 also interact with 14-3-3 proteins and whether they might experience similar regulatory mechanisms to AtFBS1. Moreover, while FBS proteins interact with at least some of their targets in the nucleus (Li et al., 2022; Sepulveda-Garcia et al., 2021), the subcellular locations of AtFBS interactions with 14-3-3 proteins are unknown. Having this interaction information could offer clues as to how 14-3-3 proteins work with AtFBS proteins within the regulatory network associated with the APC/C to influence plant growth and development. We therefore tested all four AtFBS proteins for interaction with multiple Arabidopsis 14-3-3 proteins in living plants using bimolecular fluorescence complementation (BiFC) assays.
Between the four members of the AtFBS protein family, there were distinct interaction profiles with 14-3-3 proteins. AtFBS1 interaction with 14-3-3 ω and 14-3-3 ψ was restricted to the nucleus under the conditions tested, as shown by colocalization of the BiFC signal with nuclear localized fusion protein H2B-RFP (Figure 1 A and F). In contrast, AtFBS2 – AtFBS4 had fewer interactions with these 14-3-3 proteins in the nucleus, but they interacted in the cytosol (Figure 1 B – D and G – I). The frequencies of nuclear interactions between AtFBS2 – AtFBS4 and 14-3-3 proteins ω or ψ were less than 25% of those found for AtFBS1 interactions in a field of view (Figure 1 K and L). Similar results were observed for AtFBS interactions with 14-3-3 φ and 14-3-3 κ in identical experimental set-ups. Because the F-box domain is required for AtFBS1 interaction with 14-3-3 proteins (Sepulveda-Garcia & Rocha-Sosa, 2012), we tested the phylogenetically related FBS protein PP2-A12 (At1g12710), one of the two closest non-AtFBS FBX family members based on F-box domain sequence analysis (Gagne et al., 2002). No interactions were observed between PP2-A12 with any 14-3-3 proteins (Figure 1 E and J), suggesting that 14-3-3 interactions are specific to the AtFBS subfamily. Finally, AtFBS proteins did not interact with SPA1, another nuclear localized protein used as a negative control (Zhu et al., 2008). Collectively, these findings indicate that AtFBS interactions with 14-3-3 proteins occur in vivo and have specificity to this FBX subfamily, but the subcellular interaction locations also indicate biological differences among AtFBS family members.
AtFBS proteins have numerous protein interactors, some of which are ubiquitylation targets, while others may regulate FBX protein function and the ubiquitylation process. This work found that all four AtFBS proteins interact with 14-3-3 proteins in living plant cells, consistent with the notion that there is at least some conserved function within the AtFBS family. However, AtFBS1 was the predominant interactor in the nucleus with the 14-3-3 proteins under the conditions tested here, suggesting potential functional divergence or distinct contributions among family members. Although BiFC can stabilize transient protein interactions (Kudla & Bock, 2016), these observations nonetheless provide a framework for future studies examining how 14-3-3 and AtFBS proteins function together in plant cells.
The purpose of AtFBS interaction with 14-3-3 proteins is currently unknown. One possibility is that these interactions regulate AtFBS distribution within the cell, as some 14-3-3 protein interactions control the subcellular localization of client proteins (Gampala et al., 2007; Huang et al., 2018). A more in-depth investigation of AtFBS localization, whether bound to 14-3-3 proteins or not, may clarify whether cellular distribution plays a role in restricting AtFBS activities. The roles of 14-3-3 proteins to AtFBS localization could then be tested through genetic reduction of 14-3-3 activity in Arabidopsis mutants or through chemical inhibition using AICAR (Toroser et al., 1998). Alternatively, interactions between AtFBS and 14-3-3 proteins may have important implications for SCF complex assembly and substrate specificity. SCF complex dimerization can enhance substrate recognition capabilities and/or diversify target range (Tang et al., 2007; Welcker et al., 2013), and facilitating FBX dimerization is a role of some 14-3-3 proteins (Barbash et al., 2011). Considering FBX protein homo- and hetero-dimerization (Kominami et al., 1998), having four AtFBS family members raises the possibility that combinatorial dimerization could expand target range as the number of verified SCFAtFBS targets continues to grow. Future work could therefore assess the effects of 14-3-3 proteins on SCFAtFBS target selection and ubiquitylation activity in both in vitro and in vivo systems.
Determining whether 14-3-3 proteins regulate AtFBS localization or enable SCFFBS substrate recognition may lead to a deeper mechanistic understanding of how plant stress responses are controlled. Several 14-3-3 proteins that interact with AtFBS proteins regulate abiotic stress signaling (Catala et al., 2014; Tan et al., 2016; van Kleeff et al., 2014). Likewise, both AtFBS1 and a rice homolog OsFBX257 are functionally connected to plant abiotic stress responses, either through transcriptional effects or mutant phenotypes (Geem et al., 2022; Gonzalez et al., 2017; Maldonado-Calderon et al., 2012; Sharma et al., 2023). Future work investigating how AtFBS and 14-3-3 proteins function together should therefore include conditions that specifically address environmental stress. Collectively, this work expands understanding of AtFBS/14-3-3 family-wide interactions and suggests future studies examining their mechanistic roles in environmental stress signaling.
","references":[{"reference":"Barbash O, Lee EK, Diehl JA. 2011. Phosphorylation-dependent regulation of SCFFbx4 dimerization and activity involves a novel component, 14-3-3ɛ. Oncogene 30: 1995-2002.
","pubmedId":"","doi":"10.1038/onc.2010.584"},{"reference":"Catalá R, López-Cobollo R, Mar Castellano M, Angosto T, Alonso JM, Ecker JR, Salinas J. 2014. TheArabidopsis14-3-3 Protein RARE COLD INDUCIBLE 1A Links Low-Temperature Response and Ethylene Biosynthesis to Regulate Freezing Tolerance and Cold Acclimation . The Plant Cell 26: 3326-3342.
","pubmedId":"","doi":"doi.org/10.1105/tpc.114.127605"},{"reference":"Gagne JM, Downes BP, Shiu SH, Durski AM, Vierstra RD. 2002. The F-box subunit of the SCF E3 complex is encoded by a diverse superfamily of genes in\n Arabidopsis. Proceedings of the National Academy of Sciences 99: 11519-11524.
","pubmedId":"","doi":"doi.org/10.1073/pnas.162339999"},{"reference":"Gampala SS, Kim TW, He JX, Tang W, Deng Z, Bai MY, et al., Wang. 2007. An Essential Role for 14-3-3 Proteins in Brassinosteroid Signal Transduction in Arabidopsis. Developmental Cell 13: 177-189.
","pubmedId":"","doi":"doi.org/10.1016/j.devcel.2007.06.009"},{"reference":"Geem KR, Kim H, Ryu H. 2022. SCFFBS1 Regulates Root Quiescent Center Cell Division via Protein Degradation of APC/CCCS52A2. Molecules and Cells 45: 695-701.
","pubmedId":"","doi":"doi.org/10.14348/molcells.2022.0074"},{"reference":"Gonzalez LE, Keller K, Chan KX, Gessel MM, Thines BC. 2017. Transcriptome analysis uncovers Arabidopsis F-BOX STRESS INDUCED 1 as a regulator of jasmonic acid and abscisic acid stress gene expression. BMC Genomics 18: 10.1186/s12864-017-3864-6.
","pubmedId":"","doi":"doi.org/10.1186/s12864-017-3864-6"},{"reference":"Hong JP, Adams E, Yanagawa Y, Matsui M, Shin R. 2017. AtSKIP18 and AtSKIP31, F-box subunits of the SCF E3 ubiquitin ligase complex, mediate the degradation of 14-3-3 proteins in Arabidopsis. Biochemical and Biophysical Research Communications 485: 174-180.
","pubmedId":"","doi":"doi.org/10.1016/j.bbrc.2017.02.046"},{"reference":"Huang X, Zhang Q, Jiang Y, Yang C, Wang Q, Li L. 2018. Shade-induced nuclear localization of PIF7 is regulated by phosphorylation and 14-3-3 proteins in Arabidopsis. eLife 7: 10.7554/elife.31636.
","pubmedId":"","doi":"doi.org/10.7554/eLife.31636"},{"reference":"Kominami Ki, Ochotorena I, Toda T. 1998. Two F‐box/WD‐repeat proteins Pop1 and Pop2 form hetero‐ and homo‐complexes together with cullin‐1 in the fission yeast SCF (Skp1‐Cullin‐1‐F‐box) ubiquitin ligase. Genes to Cells 3: 721-735.
","pubmedId":"","doi":"doi.org/10.1046/j.1365-2443.1998.00225.x"},{"reference":"Kudla Jr, Bock R. 2016. Lighting the Way to Protein-Protein Interactions: Recommendations on Best Practices for Bimolecular Fluorescence Complementation Analyses. The Plant Cell 28: 1002-1008.
","pubmedId":"","doi":"doi.org/10.1105/tpc.16.00043"},{"reference":"Lee CM, Feke A, Li MW, Adamchek C, Webb K, Pruneda-Paz J, et al., Gendron. 2018. Decoys Untangle Complicated Redundancy and Reveal Targets of Circadian Clock F-Box Proteins. Plant Physiology 177: 1170-1186.
","pubmedId":"","doi":"doi.org/10.1104/pp.18.00331"},{"reference":"Leuzinger K, Dent M, Hurtado J, Stahnke J, Lai H, Zhou X, Chen Q. 2013. Efficient Agroinfiltration of Plants for High-level Transient Expression of Recombinant Proteins. Journal of Visualized Experiments : 10.3791/50521.
","pubmedId":"","doi":"doi.org/10.3791/50521"},{"reference":"Li Y, Xue S, He Q, Wang J, Zhu L, Zou J, et al., Le. 2022. Arabidopsis F‐BOX STRESS INDUCED 4 is required to repress excessive divisions in stomatal development. Journal of Integrative Plant Biology 64: 56-72.
","pubmedId":"","doi":"doi.org/10.1111/jipb.13193"},{"reference":"Maldonado-Calderón MaT, Sepúlveda-García E, Rocha-Sosa M. 2012. Characterization of novel F-box proteins in plants induced by biotic and abiotic stress. Plant Science 185-186: 208-217.
","pubmedId":"","doi":"doi.org/10.1016/j.plantsci.2011.10.013"},{"reference":"Sepulveda-Garcia E, Fulton EC, Parlan EV, O’Connor LE, Fleming AA, Replogle AJ, et al., Thines. 2021. Unique N-Terminal Interactions Connect F-BOX STRESS INDUCED (FBS) Proteins to a WD40 Repeat-like Protein Pathway in Arabidopsis. Plants 10: 2228.
","pubmedId":"","doi":"doi.org/10.3390/plants10102228"},{"reference":"Sepúlveda-García E, Rocha-Sosa M. 2012. The Arabidopsis F-box protein AtFBS1 interacts with 14-3-3 proteins. Plant Science 195: 36-47.
","pubmedId":"","doi":"doi.org/10.1016/j.plantsci.2012.06.009"},{"reference":"Sharma E, Bhatnagar A, Bhaskar A, Majee SM, Kieffer M, Kepinski S, Khurana P, Khurana JP. 2022. Stress‐induced F‐Box protein‐coding geneOsFBX257modulates drought stress adaptations and ABA responses in rice. Plant, Cell & Environment 46: 1207-1231.
","pubmedId":"","doi":"doi.org/10.1111/pce.14496"},{"reference":"Sheard LB, Tan X, Mao H, Withers J, Ben-Nissan G, Hinds TR, et al., Zheng. 2010. Jasmonate perception by inositol-phosphate-potentiated COI1–JAZ co-receptor. Nature 468: 400-405.
","pubmedId":"","doi":"doi.org/10.1038/nature09430"},{"reference":"Tan T, Cai J, Zhan E, Yang Y, Zhao J, Guo Y, Zhou H. 2016. Stability and localization of 14-3-3 proteins are involved in salt tolerance in Arabidopsis. Plant Molecular Biology 92: 391-400.
","pubmedId":"","doi":"doi.org/10.1007/s11103-016-0520-5"},{"reference":"Tang X, Orlicky S, Lin Z, Willems A, Neculai D, Ceccarelli D, et al., Tyers. 2007. Suprafacial Orientation of the SCFCdc4 Dimer Accommodates Multiple Geometries for Substrate Ubiquitination. Cell 129: 1165-1176.
","pubmedId":"","doi":"doi.org/10.1016/j.cell.2007.04.042"},{"reference":"van Kleeff PJ, Jaspert N, Li KW, Rauch S, Oecking C, de Boer AH. 2014. Higher order Arabidopsis 14-3-3 mutants show 14-3-3 involvement in primary root growth both under control and abiotic stress conditions. J Exp Bot 65(20): 5877-88.
","pubmedId":"25189593","doi":""},{"reference":"Varshney V, Potuschak T, Yan S, Noir S, Genschik P. 2026. Hundreds of plant F-box proteins in search of function. J Exp Bot: pii: erag074. 10.1093/jxb/erag074.
","pubmedId":"41678363","doi":""},{"reference":"Welcker M, Larimore EA, Swanger J, Bengoechea-Alonso MT, Grim JE, Ericsson J, Zheng N, Clurman BE. 2013. Fbw7 dimerization determines the specificity and robustness of substrate degradation. Genes & Development 27: 2531-2536.
","pubmedId":"","doi":"doi.org/10.1101/gad.229195.113"},{"reference":"Wilson RS, Swatek KN, Thelen JJ. 2016. Regulation of the Regulators: Post-Translational Modifications, Subcellular, and Spatiotemporal Distribution of Plant 14-3-3 Proteins. Frontiers in Plant Science 7: 10.3389/fpls.2016.00611.
","pubmedId":"","doi":"doi.org/10.3389/fpls.2016.00611"},{"reference":"Zhang C, Yue J, Li S, Zuo C, Li Y, He Q, Le J. 2025. The Arabidopsis F-box protein FBS associated with the helix-loop-helix transcription factor FAMA involved in stomatal immunity. Plant Molecular Biology 115: 10.1007/s11103-025-01577-7.
","pubmedId":"","doi":"doi.org/10.1007/s11103-025-01577-7"},{"reference":"Zhu D, Maier A, Lee JH, Laubinger S, Saijo Y, Wang H, et al., Deng. 2008. Biochemical Characterization ofArabidopsisComplexes Containing CONSTITUTIVELY PHOTOMORPHOGENIC1 and SUPPRESSOR OF PHYA Proteins in Light Control of Plant Development. The Plant Cell 20: 2307-2323.
","pubmedId":"","doi":"doi.org/10.1105/tpc.107.056580"}],"title":"Arabidopsis F-BOX STRESS INDUCED (FBS) proteins have distinct subcellular interaction patterns with 14-3-3 proteins
","reviews":[],"curatorReviews":[]},{"id":"9fda8d43-f327-4459-b593-06b4dcc4caf7","decision":"revise","abstract":"F-BOX STRESS INDUCED (FBS) proteins are substrate adaptors in SCF-type E3 ubiquitin ligases that regulate plant development and stress responses. Arabidopsis thaliana FBS1 (AT1G61340) interacts with multiple 14-3-3 proteins, but it is unknown whether other FBS family members share these interactions. Bimolecular fluorescence complementation (BiFC) assays in Nicotiana benthamiana showed that all four FBS proteins interact with multiple 14-3-3 proteins in vivo. However, FBS1 interactions were restricted to the nucleus, whereas FBS2 – FBS4 (AT4G21510, AT4G05010, AT4G35930) interactions were detected in both the nucleus and cytosol. These findings indicate conserved 14-3-3 interactions within the FBS family, but suggest functional divergence in subcellular interaction profiles.
","acknowledgements":"We thank Michal Morrison-Kerr for storeroom support, David Somers for providing H2B-RFP, and Xing Wang Deng for providing pCL112 and pCL113 vectors, as well as the SPA1 constructs.
","authors":[{"affiliations":["University of Puget Sound, Tacoma, WA"],"departments":[""],"credit":["conceptualization","investigation","formalAnalysis","methodology"],"email":"maelbradley24@gmail.com","firstName":"Mael","lastName":"Bradley","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Cal Berkeley, Berkeley, CA","University of Puget Sound, Tacoma, WA"],"departments":["",""],"credit":["conceptualization","formalAnalysis","investigation","methodology"],"email":"mbacher@berkeley.edu","firstName":"Meghan","lastName":"Bacher","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Washington State University, Pullman, WA","University of Puget Sound, Tacoma, WA"],"departments":["",""],"credit":["formalAnalysis","investigation"],"email":"kaitlin.riggan@wsu.edu","firstName":"Kaitlin","lastName":"Riggan","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Puget Sound, Tacoma, WA"],"departments":[""],"credit":["formalAnalysis","investigation"],"email":"nicolo.spalding@gmail.com","firstName":"Nicolo","lastName":"Torresan","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Puget Sound, Tacoma, WA"],"departments":[""],"credit":["formalAnalysis","investigation"],"email":"mtegman@pugetsound.edu","firstName":"Megan","lastName":"Tegman","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Rhode Island, Kingston, RI","University of Puget Sound, Tacoma, WA"],"departments":["",""],"credit":["formalAnalysis","investigation"],"email":"sabine.angier@uri.edu","firstName":"Sabine","lastName":"Angier","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Puget Sound, Tacoma, WA"],"departments":[""],"credit":["investigation","methodology"],"email":"areplogle@pugetsound.edu","firstName":"Amy","lastName":"Replogle","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Puget Sound, Tacoma, WA"],"departments":[""],"credit":["fundingAcquisition","conceptualization","dataCuration","writing_originalDraft","writing_reviewEditing"],"email":"bthines@pugetsound.edu","firstName":"Bryan","lastName":"Thines","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":null}],"awards":[{"awardId":"grant #2035582 ","funderName":"National Science Foundation (United States)","awardRecipient":"Bryan Thines"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"","image":{"url":"https://portal.micropublication.org/uploads/41bf303086f12cd0fa46696da380793d.jpg"},"imageCaption":"(A – D) nYFP-FBS1 through nYFP-FBS4 were co-expressed with cYFP-14-3-3 ω and H2B-RFP in four-week-old N. benthamiana leaves. Cell walls were stained with 50 mM propidium iodide (PI), and images were taken three days after agroinfiltration. BiFC (green; first column) indicates protein interaction, while H2B-RFP and PI staining (red; second column) show nuclei and cell walls, respectively. Merged images (third column) show co-localization of BiFC signal and nucleus. (E) nYFP-PP2-A12 was co-expressed with cYFP-14-3-3 ω and H2B-RFP as a negative control. (F – J) The same nYFP fusion constructs and H2B-RFP were co-expressed with cYFP-14-3-3 ψ under identical conditions. Scale bar = 100 μm. (K) Average number of nuclei exhibiting BiFC signal per field of view (FOV; 1100μm) for nYFP-FBS family members co-expressed with cYFP-14-3-3 ω, and (L) co-expressed with cYFP-14-3-3 ψ. Error bars represent SE (n = 3 independent experimental replicates). Statistical significance was assessed using one-way ANOVA followed by Tukey’s HSD post-hoc tests. Means with different letters are significantly different from each other at P < 0.05.
","imageTitle":"Arabidopsis FBS interactions with 14-3-3 proteins in bimolecular fluorescence complementation (BiFC) assays
","methods":"Plasmid construction
Standard molecular biology cloning protocols were used to generate Gateway compatible constructs (Thermo Fisher Scientific). FBS and 14-3-3 coding sequences were amplified from cDNA by PCR with gene specific primers (see Reagents) using Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific). Amplicons were cloned into the pENTR entry vector with the pENTR/D-TOPO directional cloning kit (Thermo Fisher Scientific). Genes were then transferred into either pCL112 (creates N-terminal fusion to nYFP) or pCL113 (creates N-terminal fusion to cYFP) with LR Clonase II enzyme mix (Thermo Fisher Scientific). Sequences were verified by Sanger sequencing (Eurofins Genomics).
Agroinfiltration of Nicotiana benthamiana leaves
Agrobacterium tumefaciens strain GV3101 pMP90 was transformed by electroporation and selected by appropriate antibiotics. Seed cultures were grown in liquid LB for 2 days with shaking at 28 oC. Full cultures were inoculated with 1:100 volume and grown for 24 hours under the same conditions. Cells were pelleted and resuspended in infiltration medium (10 mM MES, 10 mM MgCl2, 100 mM acetosyringone) and incubated for 5 hours with rocking at room temperature. Cells were pelleted a second time and resuspended in infiltration medium. Appropriate nYFP/cYFP pairs, H2B-RFP, and p19 suppressor strains were mixed at a final OD600 of 1.0 for each strain. The abaxial side of Nicotiana benthamiana leaves from 4-week-old plants grown under greenhouse conditions were infiltrated by syringe with the A. tumefaciens mixes using standard protocols (Leuzinger et al., 2013).
Imaging
Three days after infiltration, N. benthamiana leaves to be imaged were infiltrated with 50 mM propidium iodide in 0.1% Tween-20 and allowed to sit for 10 minutes. Approximately 1 cm2 from infiltrated leaves was then cut and mounted on a glass slide with 0.1% Tween-20. The underside of whole leaf mounts was visualized by laser-scanning confocal microscopy using a Nikon D-Eclipse C1 Confocal laser scanning microscope (Nikon Instruments) with either: 1) excitation at 488 nm with an emission band pass filter of 515/30, or 2) excitation at 561 nm with an emission band pass filter of 650 LP. Images were processed with Fiji software (http://imagej.net/software/fiji/). Representative images from at least three independent experimental replicates are shown.
Data analysis
Nuclei containing a BiFC fluorescence signal were counted under a 20X objective lens in two separate areas of each leaf, which were then averaged, from three independent experimental trials. The field of view (FOV) diameter was 1100 µm. Statistical analyses were performed in RStudio version 4.0.4 using a one-way ANOVA and Tukey’s HSD post-hoc test.
","reagents":"
|
| Primer sequences 5' to 3' | |
Gene | AGI number | Forward | Reverse |
FBS1 | At1g61340 | CACCATGGCATTGGGGAAGAAAAGAATCG | TCAGTGGAATAGAGCCACTGAGAC |
FBS2 | At4g21510 | CACCATGATCCATTATCTCCATTTCA | TCATGTAAACAAAGCCGCAG |
FBS3 | At4g05010 | CACCATGGCGTATTTGAGTGATG | TCATTTAAACAATACCATAGAGATCTTCGACAAATC |
FBS4 | At4g35930 | CACCATGGGGAAGGTATCTCCAAAG | TCAGGTGAGGTTGTTTTGAGC |
PP2-A12 | At1g12710 | CACCATGGGTGTGGCTCACTCTGAT | TTAAAACCGCTTCAACTGGTC |
14-3-3 omega | At1g78300 | CACCATGGCGTCTGGGCGTGAAG | TCACTGCTGTTCCTCGGTCG |
14-3-3 psi | At5g38480 | CACCATGTCGACAAGGGAAGAGAATGT | TTACTCGGCACCATCGGG |
14-3-3 phi | At1g35160 | CACCATGGCGGCAC CACCAGCATC ATCC | TTAGATCTCCTTCTGTTCTTCAGCAGGC |
14-3-3 kappa | At5g65430 | CACCATGGCGACGACCTTAAGCAG | TCAATATGCGAGTTTCTGATGATGC |
Numerous cellular pathways in eukaryotes are regulated through selective protein degradation by the ubiquitin 26S proteasome system (UPS). SKP1-CUL1-F-box (SCF) complexes are a prevalent type of E3 ubiquitin ligase in the UPS that use F-box (FBX) proteins as substrate adaptors to specifically recruit ubiquitination targets (Lee et al., 2018; Sheard et al., 2010; Varshney et al., 2026). Four Arabidopsis thaliana F-BOX STRESS INDUCED proteins (FBS1 – FBS4) compose a subfamily of plant-specific FBX proteins (Maldonado-Calderon et al., 2012). FBS1 and FBS4 target anaphase-promoting complex/cyclosome (APC/C)-associated regulatory proteins to control cell division events and related processes, including maintenance of the root quiescent center (QC) and cell fate determination during stomatal development (Geem et al., 2022; Li et al., 2022; Zhang et al., 2025). FBS proteins also likely target two other nuclear-localized WD40 repeat-like family proteins of unknown function (Sepulveda-Garcia et al., 2021).
In addition to its targeting interactions, FBS1 interacts with at least six of thirteen proteins belonging to the Arabidopsis 14-3-3 family in yeast two-hybrid and in vitro pull-down assays (Sepulveda-Garcia & Rocha-Sosa, 2012). 14-3-3 proteins are eukaryotic regulators that specifically interact with their client proteins to alter their activity (Wilson et al., 2016). While some 14-3-3 proteins are SCF targets in plants (Hong et al., 2017), FBS1 does not seem to target 14-3-3 proteins for degradation, as increased FBS1 abundance does not lead to a decrease in the level of FBS interactor 14-3-3 λ (AT5G10450) (Sepulveda-Garcia et al., 2021; Sepulveda-Garcia & Rocha-Sosa, 2012). Furthermore, 14-3-3 proteins interact with FBS1 via the F-box domain (Sepulveda-Garcia & Rocha-Sosa, 2012), which is required for FBX protein interaction with Skp and the core SCF complex. The regulatory purpose and biological consequence of FBS1 interaction with 14-3-3 proteins are currently unknown.
Members of FBX protein subfamilies often have some functional redundancy while still maintaining distinct biological roles (Lee et al., 2018). It is almost certainly the case that FBS1 – FBS4 each have some distinct biological functions relative to each other based on their expression profiles and mutant phenotypes (Geem et al., 2022; Li et al., 2022; Maldonado-Calderon et al., 2012). However, it is unknown whether FBS2 – FBS4 also interact with 14-3-3 proteins and whether they might experience similar regulatory mechanisms to FBS1. Moreover, while FBS proteins interact with at least some of their targets in the nucleus (Li et al., 2022; Sepulveda-Garcia et al., 2021), the subcellular locations of FBS interactions with 14-3-3 proteins are unknown. Having this interaction information could offer clues as to how 14-3-3 proteins work with FBS proteins within the regulatory network associated with the APC/C to influence plant growth and development. We therefore tested all four Arabidopsis FBS proteins for interaction with multiple 14-3-3 proteins in living plants using bimolecular fluorescence complementation (BiFC) assays.
Between the four members of the FBS protein family, there were distinct interaction profiles with 14-3-3 proteins. FBS1 interactions with 14-3-3 ω (AT1G78300) and 14-3-3 ψ (AT5G38480) were restricted to the nucleus under the conditions tested, as shown by colocalization of the BiFC signal with nuclear localized fusion protein H2B-RFP (Figure 1 A and F). In contrast, FBS2 – FBS4 had fewer interactions with these 14-3-3 proteins in the nucleus, but they interacted in the cytosol (Figure 1 B – D and G – I). The frequencies of nuclear interactions between FBS2 – FBS4 and 14-3-3 proteins ω or ψ were less than 25% of those found for FBS1 interactions in a field of view (Figure 1 K and L). Similar results were observed for FBS interactions with 14-3-3 φ (AT1G35160) and 14-3-3 κ (AT5G65430) in identical experimental set-ups. Because the F-box domain is required for FBS1 interaction with 14-3-3 proteins (Sepulveda-Garcia & Rocha-Sosa, 2012), we tested the phylogenetically related FBX protein PP2-A12 (AT1G12710), one of the two closest non-FBS FBX family members based on F-box domain sequence analysis (Gagne et al., 2002). No interactions were observed between PP2-A12 with any 14-3-3 proteins (Figure 1 E and J), suggesting that 14-3-3 interactions are specific to the FBS subfamily. Finally, FBS proteins did not interact with SPA1 (AT2G46340), another nuclear localized protein used as a negative control (Zhu et al., 2008). Collectively, these findings indicate that FBS interactions with 14-3-3 proteins occur in vivo and have specificity to this FBX subfamily, but the subcellular interaction locations also indicate biological differences among FBS family members.
FBS proteins have numerous protein interactors, some of which are ubiquitylation targets, while others may regulate FBX protein function and the ubiquitylation process. This work found that all four FBS proteins interact with 14-3-3 proteins in living plant cells, consistent with the notion that there is at least some conserved function within the FBS family. However, FBS1 was the predominant interactor in the nucleus with the 14-3-3 proteins under the conditions tested here, suggesting potential functional divergence or distinct contributions among family members. Although BiFC can stabilize transient protein interactions (Kudla & Bock, 2016), these observations nonetheless provide a framework for future studies examining how 14-3-3 and FBS proteins function together in plant cells.
The purpose of FBS interaction with 14-3-3 proteins is currently unknown. One possibility is that these interactions regulate FBS distribution within the cell, as some 14-3-3 protein interactions control the subcellular localization of client proteins (Gampala et al., 2007; Huang et al., 2018). A more in-depth investigation of FBS localization, whether bound to 14-3-3 proteins or not, may clarify whether cellular distribution plays a role in restricting FBS activities. The roles of 14-3-3 proteins to FBS localization could then be tested through genetic reduction of 14-3-3 activity in Arabidopsis mutants or through chemical inhibition using AICAR (Toroser et al., 1998). Alternatively, interactions between FBS and 14-3-3 proteins may have important implications for SCF complex assembly and substrate specificity. SCF complex dimerization can enhance substrate recognition capabilities and/or diversify target range (Tang et al., 2007; Welcker et al., 2013), and facilitating FBX dimerization is a role of some 14-3-3 proteins (Barbash et al., 2011). Considering FBX protein homo- and hetero-dimerization (Kominami et al., 1998), having four Arabidopsis FBS family members raises the possibility that combinatorial dimerization could expand target range as the number of verified SCFFBS targets continues to grow. Future work could therefore assess the effects of 14-3-3 proteins on SCFFBS target selection and ubiquitylation activity in both in vitro and in vivo systems.
Determining whether 14-3-3 proteins regulate FBS localization or enable SCFFBS substrate recognition may lead to a deeper mechanistic understanding of how plant stress responses are controlled. Several 14-3-3 proteins that interact with FBS proteins regulate abiotic stress signaling (Catala et al., 2014; Tan et al., 2016; van Kleeff et al., 2014). Likewise, both FBS1 and rice homolog FBX257 are functionally connected to plant abiotic stress responses, either through transcriptional effects or mutant phenotypes (Geem et al., 2022; Gonzalez et al., 2017; Maldonado-Calderon et al., 2012; Sharma et al., 2023). Future work investigating how FBS and 14-3-3 proteins function together should therefore include conditions that specifically address environmental stress. Collectively, this work expands understanding of FBS/14-3-3 family-wide interactions and suggests future studies examining their mechanistic roles in environmental stress signaling.
","references":[{"reference":"Barbash O, Lee EK, Diehl JA. 2011. Phosphorylation-dependent regulation of SCFFbx4 dimerization and activity involves a novel component, 14-3-3ɛ. Oncogene 30: 1995-2002.
","pubmedId":"","doi":"10.1038/onc.2010.584"},{"reference":"Catalá R, López-Cobollo R, Mar Castellano M, Angosto T, Alonso JM, Ecker JR, Salinas J. 2014. TheArabidopsis14-3-3 Protein RARE COLD INDUCIBLE 1A Links Low-Temperature Response and Ethylene Biosynthesis to Regulate Freezing Tolerance and Cold Acclimation . The Plant Cell 26: 3326-3342.
","pubmedId":"","doi":"doi.org/10.1105/tpc.114.127605"},{"reference":"Gagne JM, Downes BP, Shiu SH, Durski AM, Vierstra RD. 2002. The F-box subunit of the SCF E3 complex is encoded by a diverse superfamily of genes in\n Arabidopsis. Proceedings of the National Academy of Sciences 99: 11519-11524.
","pubmedId":"","doi":"doi.org/10.1073/pnas.162339999"},{"reference":"Gampala SS, Kim TW, He JX, Tang W, Deng Z, Bai MY, et al., Wang. 2007. An Essential Role for 14-3-3 Proteins in Brassinosteroid Signal Transduction in Arabidopsis. Developmental Cell 13: 177-189.
","pubmedId":"","doi":"doi.org/10.1016/j.devcel.2007.06.009"},{"reference":"Geem KR, Kim H, Ryu H. 2022. SCFFBS1 Regulates Root Quiescent Center Cell Division via Protein Degradation of APC/CCCS52A2. Molecules and Cells 45: 695-701.
","pubmedId":"","doi":"doi.org/10.14348/molcells.2022.0074"},{"reference":"Gonzalez LE, Keller K, Chan KX, Gessel MM, Thines BC. 2017. Transcriptome analysis uncovers Arabidopsis F-BOX STRESS INDUCED 1 as a regulator of jasmonic acid and abscisic acid stress gene expression. BMC Genomics 18: 10.1186/s12864-017-3864-6.
","pubmedId":"","doi":"doi.org/10.1186/s12864-017-3864-6"},{"reference":"Hong JP, Adams E, Yanagawa Y, Matsui M, Shin R. 2017. AtSKIP18 and AtSKIP31, F-box subunits of the SCF E3 ubiquitin ligase complex, mediate the degradation of 14-3-3 proteins in Arabidopsis. Biochemical and Biophysical Research Communications 485: 174-180.
","pubmedId":"","doi":"doi.org/10.1016/j.bbrc.2017.02.046"},{"reference":"Huang X, Zhang Q, Jiang Y, Yang C, Wang Q, Li L. 2018. Shade-induced nuclear localization of PIF7 is regulated by phosphorylation and 14-3-3 proteins in Arabidopsis. eLife 7: 10.7554/elife.31636.
","pubmedId":"","doi":"doi.org/10.7554/eLife.31636"},{"reference":"Kominami Ki, Ochotorena I, Toda T. 1998. Two F‐box/WD‐repeat proteins Pop1 and Pop2 form hetero‐ and homo‐complexes together with cullin‐1 in the fission yeast SCF (Skp1‐Cullin‐1‐F‐box) ubiquitin ligase. Genes to Cells 3: 721-735.
","pubmedId":"","doi":"doi.org/10.1046/j.1365-2443.1998.00225.x"},{"reference":"Kudla Jr, Bock R. 2016. Lighting the Way to Protein-Protein Interactions: Recommendations on Best Practices for Bimolecular Fluorescence Complementation Analyses. The Plant Cell 28: 1002-1008.
","pubmedId":"","doi":"doi.org/10.1105/tpc.16.00043"},{"reference":"Lee CM, Feke A, Li MW, Adamchek C, Webb K, Pruneda-Paz J, et al., Gendron. 2018. Decoys Untangle Complicated Redundancy and Reveal Targets of Circadian Clock F-Box Proteins. Plant Physiology 177: 1170-1186.
","pubmedId":"","doi":"doi.org/10.1104/pp.18.00331"},{"reference":"Leuzinger K, Dent M, Hurtado J, Stahnke J, Lai H, Zhou X, Chen Q. 2013. Efficient Agroinfiltration of Plants for High-level Transient Expression of Recombinant Proteins. Journal of Visualized Experiments : 10.3791/50521.
","pubmedId":"","doi":"doi.org/10.3791/50521"},{"reference":"Li Y, Xue S, He Q, Wang J, Zhu L, Zou J, et al., Le. 2022. Arabidopsis F‐BOX STRESS INDUCED 4 is required to repress excessive divisions in stomatal development. Journal of Integrative Plant Biology 64: 56-72.
","pubmedId":"","doi":"doi.org/10.1111/jipb.13193"},{"reference":"Maldonado-Calderón MaT, Sepúlveda-García E, Rocha-Sosa M. 2012. Characterization of novel F-box proteins in plants induced by biotic and abiotic stress. Plant Science 185-186: 208-217.
","pubmedId":"","doi":"doi.org/10.1016/j.plantsci.2011.10.013"},{"reference":"Sepulveda-Garcia E, Fulton EC, Parlan EV, O’Connor LE, Fleming AA, Replogle AJ, et al., Thines. 2021. Unique N-Terminal Interactions Connect F-BOX STRESS INDUCED (FBS) Proteins to a WD40 Repeat-like Protein Pathway in Arabidopsis. Plants 10: 2228.
","pubmedId":"","doi":"doi.org/10.3390/plants10102228"},{"reference":"Sepúlveda-García E, Rocha-Sosa M. 2012. The Arabidopsis F-box protein AtFBS1 interacts with 14-3-3 proteins. Plant Science 195: 36-47.
","pubmedId":"","doi":"doi.org/10.1016/j.plantsci.2012.06.009"},{"reference":"Sharma E, Bhatnagar A, Bhaskar A, Majee SM, Kieffer M, Kepinski S, Khurana P, Khurana JP. 2022. Stress‐induced F‐Box protein‐coding geneOsFBX257modulates drought stress adaptations and ABA responses in rice. Plant, Cell & Environment 46: 1207-1231.
","pubmedId":"","doi":"doi.org/10.1111/pce.14496"},{"reference":"Sheard LB, Tan X, Mao H, Withers J, Ben-Nissan G, Hinds TR, et al., Zheng. 2010. Jasmonate perception by inositol-phosphate-potentiated COI1–JAZ co-receptor. Nature 468: 400-405.
","pubmedId":"","doi":"doi.org/10.1038/nature09430"},{"reference":"Tan T, Cai J, Zhan E, Yang Y, Zhao J, Guo Y, Zhou H. 2016. Stability and localization of 14-3-3 proteins are involved in salt tolerance in Arabidopsis. Plant Molecular Biology 92: 391-400.
","pubmedId":"","doi":"doi.org/10.1007/s11103-016-0520-5"},{"reference":"Tang X, Orlicky S, Lin Z, Willems A, Neculai D, Ceccarelli D, et al., Tyers. 2007. Suprafacial Orientation of the SCFCdc4 Dimer Accommodates Multiple Geometries for Substrate Ubiquitination. Cell 129: 1165-1176.
","pubmedId":"","doi":"doi.org/10.1016/j.cell.2007.04.042"},{"reference":"van Kleeff PJ, Jaspert N, Li KW, Rauch S, Oecking C, de Boer AH. 2014. Higher order Arabidopsis 14-3-3 mutants show 14-3-3 involvement in primary root growth both under control and abiotic stress conditions. J Exp Bot 65(20): 5877-88.
","pubmedId":"25189593","doi":""},{"reference":"Varshney V, Potuschak T, Yan S, Noir S, Genschik P. 2026. Hundreds of plant F-box proteins in search of function. J Exp Bot: pii: erag074. 10.1093/jxb/erag074.
","pubmedId":"41678363","doi":""},{"reference":"Welcker M, Larimore EA, Swanger J, Bengoechea-Alonso MT, Grim JE, Ericsson J, Zheng N, Clurman BE. 2013. Fbw7 dimerization determines the specificity and robustness of substrate degradation. Genes & Development 27: 2531-2536.
","pubmedId":"","doi":"doi.org/10.1101/gad.229195.113"},{"reference":"Wilson RS, Swatek KN, Thelen JJ. 2016. Regulation of the Regulators: Post-Translational Modifications, Subcellular, and Spatiotemporal Distribution of Plant 14-3-3 Proteins. Frontiers in Plant Science 7: 10.3389/fpls.2016.00611.
","pubmedId":"","doi":"doi.org/10.3389/fpls.2016.00611"},{"reference":"Zhang C, Yue J, Li S, Zuo C, Li Y, He Q, Le J. 2025. The Arabidopsis F-box protein FBS associated with the helix-loop-helix transcription factor FAMA involved in stomatal immunity. Plant Molecular Biology 115: 10.1007/s11103-025-01577-7.
","pubmedId":"","doi":"doi.org/10.1007/s11103-025-01577-7"},{"reference":"Zhu D, Maier A, Lee JH, Laubinger S, Saijo Y, Wang H, et al., Deng. 2008. Biochemical Characterization ofArabidopsisComplexes Containing CONSTITUTIVELY PHOTOMORPHOGENIC1 and SUPPRESSOR OF PHYA Proteins in Light Control of Plant Development. The Plant Cell 20: 2307-2323.
","pubmedId":"","doi":"doi.org/10.1105/tpc.107.056580"}],"title":"Arabidopsis F-BOX STRESS INDUCED (FBS) proteins have distinct subcellular interaction patterns with 14-3-3 proteins
","reviews":[{"reviewer":{"displayName":"Joshua Gendron"},"openAcknowledgement":false,"status":{"submitted":true}}],"curatorReviews":[]},{"id":"834f0880-6dc2-403d-ad83-d11abf72d114","decision":"revise","abstract":"F-BOX STRESS INDUCED (FBS) proteins are substrate adaptors in SCF-type E3 ubiquitin ligases that regulate plant development and stress responses. Arabidopsis thaliana FBS1 (AT1G61340) interacts with multiple 14-3-3 proteins, but it is unknown whether other FBS family members share these interactions. Bimolecular fluorescence complementation (BiFC) assays in Nicotiana benthamiana showed that all four FBS proteins interact with multiple 14-3-3 proteins in vivo. However, FBS1 interactions were restricted to the nucleus, whereas FBS2 – FBS4 (AT4G21510, AT4G05010, AT4G35930) interactions were detected in both the nucleus and cytosol. These findings indicate conserved 14-3-3 interactions within the FBS family, but suggest functional divergence in subcellular interaction profiles.
","acknowledgements":"We thank Michal Morrison-Kerr for storeroom support, David Somers for providing H2B-RFP, and Xing Wang Deng for providing pCL112 and pCL113 vectors, as well as the SPA1 constructs.
","authors":[{"affiliations":["University of Puget Sound, Tacoma, WA"],"departments":[""],"credit":["conceptualization","investigation","formalAnalysis","methodology"],"email":"maelbradley24@gmail.com","firstName":"Mael","lastName":"Bradley","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Cal Berkeley, Berkeley, CA","University of Puget Sound, Tacoma, WA"],"departments":["",""],"credit":["conceptualization","formalAnalysis","investigation","methodology"],"email":"mbacher@berkeley.edu","firstName":"Meghan","lastName":"Bacher","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Washington State University, Pullman, WA","University of Puget Sound, Tacoma, WA"],"departments":["",""],"credit":["formalAnalysis","investigation"],"email":"kaitlin.riggan@wsu.edu","firstName":"Kaitlin","lastName":"Riggan","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Puget Sound, Tacoma, WA"],"departments":[""],"credit":["formalAnalysis","investigation"],"email":"nicolo.spalding@gmail.com","firstName":"Nicolo","lastName":"Torresan","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Puget Sound, Tacoma, WA"],"departments":[""],"credit":["formalAnalysis","investigation"],"email":"mtegman@pugetsound.edu","firstName":"Megan","lastName":"Tegman","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Rhode Island, Kingston, RI","University of Puget Sound, Tacoma, WA"],"departments":["",""],"credit":["formalAnalysis","investigation"],"email":"sabine.angier@uri.edu","firstName":"Sabine","lastName":"Angier","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Puget Sound, Tacoma, WA"],"departments":[""],"credit":["investigation","methodology"],"email":"areplogle@pugetsound.edu","firstName":"Amy","lastName":"Replogle","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Puget Sound, Tacoma, WA"],"departments":[""],"credit":["fundingAcquisition","conceptualization","dataCuration","writing_originalDraft","writing_reviewEditing"],"email":"bthines@pugetsound.edu","firstName":"Bryan","lastName":"Thines","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":null}],"awards":[{"awardId":"grant #2035582 ","funderName":"National Science Foundation (United States)","awardRecipient":"Bryan Thines"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"","image":{"url":"https://portal.micropublication.org/uploads/1136da3a0aef82bc1de4b22588df1fbd.jpg"},"imageCaption":"(A – D) nYFP-FBS1 through nYFP-FBS4 were co-expressed with cYFP-14-3-3 ω and H2B-RFP in four-week-old N. benthamiana leaves. Cell walls were stained with 50 mM propidium iodide (PI), and images were taken three days after agroinfiltration. BiFC (green; first column) indicates protein interaction, while H2B-RFP and PI staining (red; second column) show nuclei and cell walls, respectively. Merged images (third column) show co-localization of BiFC signal with nuclei. (E) nYFP-PP2-A12 was co-expressed with cYFP-14-3-3 ω and H2B-RFP as a negative control. (F – J) The same nYFP fusion constructs and H2B-RFP were co-expressed with cYFP-14-3-3 ψ under identical conditions. (K – N) nYFP-FBS constructs were co-expressed with cYFP-SPA1, the BiFC channel is shown. Scale bar = 100 mm. (O) Average number of nuclei exhibiting BiFC signal per field of view (FOV) for nYFP-FBS family members co-expressed with cYFP-14-3-3 ω, and (P) co-expressed with cYFP-14-3-3 ψ. Error bars represent SE (n = 3 independent experimental replicates). Statistical significance was assessed using one-way ANOVA followed by Tukey’s HSD post-hoc tests. Means with different letters are significantly different from each other at P < 0.05.
","imageTitle":"Arabidopsis FBS interactions with 14-3-3 proteins in bimolecular fluorescence complementation (BiFC) assays
","methods":"Plasmid construction
Standard molecular biology cloning protocols were used to generate Gateway compatible constructs (Thermo Fisher Scientific). FBS and 14-3-3 coding sequences were amplified from cDNA by PCR with gene specific primers (Table 1) using Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific). Amplicons were cloned into the pENTR entry vector with the pENTR/D-TOPO directional cloning kit (Thermo Fisher Scientific). Genes were then transferred into either pCL112 (creates N-terminal fusion to nYFP) or pCL113 (creates N-terminal fusion to cYFP) with LR Clonase II enzyme mix (Thermo Fisher Scientific). Sequences were verified by Sanger sequencing (Eurofins Genomics).
Agroinfiltration of Nicotiana benthamiana leaves
Agrobacterium tumefaciens strain GV3101 pMP90 was transformed by electroporation and selected by appropriate antibiotics. Seed cultures were grown in liquid LB for 2 days with shaking at 28 oC. Full cultures were inoculated with 1:100 volume and grown for 24 hours under the same conditions. Cells were pelleted and resuspended in infiltration medium (10 mM MES, 10 mM MgCl2, 100 mM acetosyringone) and incubated for 5 hours with rocking at room temperature. Cells were pelleted a second time and resuspended in infiltration medium. Appropriate nYFP/cYFP pairs, H2B-RFP, and p19 suppressor strains were mixed at a final OD600 of 1.0 for each strain. The abaxial side of Nicotiana benthamiana leaves from 4-week-old plants grown under greenhouse conditions was infiltrated by syringe with the A. tumefaciens mixes using standard protocols (Leuzinger et al., 2013).
Imaging
Three days after infiltration, N. benthamiana leaves to be imaged were infiltrated with 50 mM propidium iodide in 0.1% Tween-20 and allowed to sit for 10 minutes. Approximately 1 cm2 from infiltrated leaves was then cut and mounted on a glass slide with 0.1% Tween-20. The underside of whole leaf mounts was visualized by laser-scanning confocal microscopy using a Nikon D-Eclipse C1 Confocal laser scanning microscope (Nikon Instruments) with either: 1) excitation at 488 nm with an emission band pass filter of 515/30, or 2) excitation at 561 nm with an emission band pass filter of 650 LP. Images were processed with Fiji software (http://imagej.net/software/fiji/). Representative images from at least three independent experimental replicates are shown.
Data analysis
Nuclei containing a BiFC fluorescence signal were counted under a 20X objective lens in two separate areas of each leaf, which were then averaged, from three independent experimental trials. The field of view (FOV) diameter was 1100 µm. Statistical analyses were performed in RStudio version 4.0.4 using a one-way ANOVA and Tukey’s HSD post-hoc test.
","reagents":"
|
| Primer sequences 5' to 3' | |
Gene | AGI number | Forward | Reverse |
FBS1 | At1g61340 | CACCATGGCATTGGGGAAGAAAAGAATCG | TCAGTGGAATAGAGCCACTGAGAC |
FBS2 | At4g21510 | CACCATGATCCATTATCTCCATTTCA | TCATGTAAACAAAGCCGCAG |
FBS3 | At4g05010 | CACCATGGCGTATTTGAGTGATG | TCATTTAAACAATACCATAGAGATCTTCGACAAATC |
FBS4 | At4g35930 | CACCATGGGGAAGGTATCTCCAAAG | TCAGGTGAGGTTGTTTTGAGC |
PP2-A12 | At1g12710 | CACCATGGGTGTGGCTCACTCTGAT | TTAAAACCGCTTCAACTGGTC |
14-3-3 omega | At1g78300 | CACCATGGCGTCTGGGCGTGAAG | TCACTGCTGTTCCTCGGTCG |
14-3-3 psi | At5g38480 | CACCATGTCGACAAGGGAAGAGAATGT | TTACTCGGCACCATCGGG |
Numerous cellular pathways in eukaryotes are regulated through selective protein degradation by the ubiquitin 26S proteasome system (UPS). SKP1-CUL1-F-box (SCF) complexes are a prevalent type of E3 ubiquitin ligase in the UPS that use F-box (FBX) proteins as substrate adaptors to specifically recruit ubiquitination targets (Lee et al., 2018; Sheard et al., 2010; Varshney et al., 2026). Four Arabidopsis thaliana F-BOX STRESS INDUCED proteins (FBS1 – FBS4) compose a subfamily of plant-specific FBX proteins (Maldonado-Calderon et al., 2012). FBS1 and FBS4 target anaphase-promoting complex/cyclosome (APC/C)-associated regulatory proteins to control cell division events and related processes, including maintenance of the root quiescent center (QC) and cell fate determination during stomatal development (Geem et al., 2022; Li et al., 2022; Zhang et al., 2025). FBS proteins also likely target two other nuclear-localized WD40 repeat-like family proteins of unknown function (Sepulveda-Garcia et al., 2021).
In addition to its targeting interactions, FBS1 interacts with at least six of thirteen proteins belonging to the Arabidopsis 14-3-3 family in yeast two-hybrid and in vitro pull-down assays (Sepulveda-Garcia & Rocha-Sosa, 2012). 14-3-3 proteins are eukaryotic regulators that specifically interact with their client proteins to alter their activity (Wilson et al., 2016). While some 14-3-3 proteins are SCF targets in plants (Hong et al., 2017), FBS1 does not seem to target 14-3-3 proteins for degradation, as increased FBS1 abundance does not lead to a decrease in the level of FBS interactor 14-3-3 λ (AT5G10450) (Sepulveda-Garcia et al., 2021; Sepulveda-Garcia & Rocha-Sosa, 2012). Furthermore, 14-3-3 proteins interact with FBS1 via the F-box domain (Sepulveda-Garcia & Rocha-Sosa, 2012), which is required for FBX protein interaction with Skp and the core SCF complex. The regulatory purpose and biological consequence of FBS1 interaction with 14-3-3 proteins are currently unknown.
Members of FBX protein subfamilies often have some functional redundancy while still maintaining distinct biological roles (Lee et al., 2018). FBS1 – FBS4 likely have distinct biological functions relative to each other based on their expression profiles and mutant phenotypes (Geem et al., 2022; Li et al., 2022; Maldonado-Calderon et al., 2012). However, it is unknown whether FBS2 – FBS4 also interact with 14-3-3 proteins and whether they might experience similar regulatory mechanisms to FBS1. Moreover, while FBS proteins interact with at least some of their targets in the nucleus (Li et al., 2022; Sepulveda-Garcia et al., 2021), the subcellular locations of FBS interactions with 14-3-3 proteins are unknown. Having this interaction information could offer clues as to how 14-3-3 proteins work with FBS proteins within the regulatory network associated with the APC/C to influence plant growth and development. We therefore tested all four Arabidopsis FBS proteins for interaction with multiple Arabidopsis 14-3-3 proteins in living plants using bimolecular fluorescence complementation (BiFC) assays.
Among the four members of the FBS protein family, distinct interaction profiles with 14-3-3 proteins were observed. FBS1 interactions with 14-3-3 ω (AT1G78300) and 14-3-3 ψ (AT5G38480) were restricted to the nucleus under the conditions tested, as shown by colocalization of the BiFC signal with nuclear localized fusion protein H2B-RFP (Figure 1 A and F). In contrast, FBS2 – FBS4 had fewer interactions with these 14-3-3 proteins in the nucleus, but they interacted in the cytosol (Figure 1 B – D and G – I). The frequencies of nuclear interactions between FBS2 – FBS4 and 14-3-3 proteins ω or ψ were less than 25% of those found for FBS1 interactions in a field of view (Figure 1 O and P). Because the F-box domain is required for FBS1 interaction with 14-3-3 proteins (Sepulveda-Garcia & Rocha-Sosa, 2012), we tested the phylogenetically related FBX protein PP2-A12 (AT1G12710), one of the two closest non-FBS FBX family members based on F-box domain sequence analysis (Gagne et al., 2002). In contrast to the FBS proteins, no BiFC signal was detected when PP2-A12 was co-expressed with either of the 14-3-3 proteins under the conditions tested (Figure 1 E and J). As an additional negative control for nonspecific interactions, FBS proteins were tested with the unrelated nuclear-localized protein SPA1 (AT2G46340) (Zhu et al., 2008), and no detectable BiFC signal was observed for any of the four FBS proteins (Figure 1 K – N). Collectively, these findings show distinct subcellular patterns of FBS/14-3-3 interactions in vivo, while the negative control results are consistent with specificity of the observed BiFC interactions.
FBS proteins have numerous protein interactors, some of which are ubiquitylation targets, while others may regulate FBX protein function and the ubiquitylation process. This work found that all four FBS proteins interacted with 14-3-3 proteins in living plant cells, indicating that 14-3-3 interaction is conserved within the FBS family. However, FBS1 showed the highest frequency of nuclear interactions with the 14-3-3 proteins under the conditions tested here, suggesting potential functional divergence or distinct contributions among family members. Although the negative controls are consistent with specificity of the observed FBS/14-3-3 interactions, PP2-A12 and SPA1 protein accumulation was not independently verified and alternative orientations of the YFP fragments were not tested. Thus, differences in protein abundance or steric constraints could contribute to the absence of BiFC signal with PP2-A12 or SPA1, and these results should not be interpreted as definitive evidence for lack of interaction. Moreover, BiFC can stabilize transient protein interactions (Kudla & Bock, 2016), and therefore these findings may not fully reflect endogenous interaction dynamics. Nevertheless, the absence of detectable BiFC signal between FBS proteins and SPA1 or between 14-3-3 proteins and PP2-A12, together with the distinct subcellular interaction patterns observed among FBS family members and previous yeast two-hybrid and in vitro pull-down evidence for FBS1/14-3-3 interactions (Sepúlveda-García & Rocha-Sosa, 2012), provides support for the specificity of the observed FBS/14-3-3 interactions.
The N-terminal region and F-box domain of FBS1 have previously been implicated in 14-3-3 binding (Sepulveda-Garcia & Rocha-Sosa, 2012), but whether these regions similarly mediate 14-3-3 interactions with FBS2 – FBS4 remains unknown. Canonical Mode I or Mode II 14-3-3 recognition motifs often mediate 14-3-3 protein interaction with the client protein (Camoni et al., 2018). None of the four FBS proteins contains either of these motifs. The absence of canonical recognition motifs suggests that FBS interactions with 14-3-3 proteins may involve noncanonical phosphorylation-dependent binding sites or an alternative mode of interaction. Sequence analysis using 14-3-3-Pred, software that predicts 14-3-3-binding phosphopeptides (Madeira et al., 2015), identified several Ser/Thr residues in FBS1, FBS2, and FBS4 with scores above the consensus prediction threshold, despite their occurrence outside canonical recognition motifs. These residues therefore represent candidate phosphorylation sites for future studies testing the effects of amino acid substitutions on 14-3-3 binding.
The purpose of FBS interaction with 14-3-3 proteins is currently unknown. One possibility is that these interactions regulate FBS distribution within the cell, as some 14-3-3 protein interactions control the subcellular localization of client proteins. A more in-depth investigation of FBS localization, whether bound to 14-3-3 proteins or not, may clarify whether cellular distribution plays a role in restricting FBS activities. The roles of 14-3-3 proteins in regulating FBS localization could then be tested through genetic reduction of 14-3-3 activity in Arabidopsis mutants or through chemical inhibition using AICAR (Toroser et al., 1998). Alternatively, interactions between FBS and 14-3-3 proteins may have important implications for SCF complex assembly and substrate specificity. SCF complex dimerization can enhance substrate recognition capabilities and/or diversify target range (Tang et al., 2007; Welcker et al., 2013), and facilitating FBX dimerization is a role of some 14-3-3 proteins (Barbash et al., 2011). Considering FBX protein homo- and hetero-dimerization (Kominami et al., 1998), having four Arabidopsis FBS family members raises the possibility that combinatorial dimerization could expand target range as the number of verified SCFFBS targets continues to grow. The differential localization observed here raises the possibility that 14-3-3-mediated, compartment-specific FBS dimerization could contribute to distinct functions among FBS family members. Future work could therefore assess the effects of 14-3-3 proteins on SCFFBS target selection and ubiquitylation activity in both in vitro and in vivo systems.
Determining whether 14-3-3 proteins regulate FBS localization or enable SCFFBS substrate recognition may lead to a deeper mechanistic understanding of how plant stress responses are controlled. Several 14-3-3 proteins that interact with FBS proteins regulate abiotic stress signaling (Catala et al., 2014; Tan et al., 2016; van Kleeff et al., 2014). Likewise, both FBS1 and the rice homolog FBX257 are functionally connected to plant abiotic stress responses, either through transcriptional effects or mutant phenotypes (Geem et al., 2022; Gonzalez et al., 2017; Maldonado-Calderon et al., 2012; Sharma et al., 2023). Future work investigating how FBS and 14-3-3 proteins function together should therefore include conditions that specifically address environmental stress. Collectively, this work expands understanding of FBS/14-3-3 family-wide interactions and suggests future studies examining their mechanistic roles in environmental stress signaling.
","references":[{"reference":"Barbash O, Lee EK, Diehl JA. 2011. Phosphorylation-dependent regulation of SCFFbx4 dimerization and activity involves a novel component, 14-3-3ɛ. Oncogene 30: 1995-2002.
","pubmedId":"","doi":"10.1038/onc.2010.584"},{"reference":"Camoni L, Visconti S, Aducci P, Marra M. 2018. 14-3-3 Proteins in Plant Hormone Signaling: Doing Several Things at Once. Frontiers in Plant Science 9: 10.3389/fpls.2018.00297.
","pubmedId":"","doi":"10.3389/fpls.2018.00297"},{"reference":"Catalá R, López-Cobollo R, Mar Castellano M, Angosto T, Alonso JM, Ecker JR, Salinas J. 2014. TheArabidopsis14-3-3 Protein RARE COLD INDUCIBLE 1A Links Low-Temperature Response and Ethylene Biosynthesis to Regulate Freezing Tolerance and Cold Acclimation . The Plant Cell 26: 3326-3342.
","pubmedId":"","doi":"doi.org/10.1105/tpc.114.127605"},{"reference":"Gagne JM, Downes BP, Shiu SH, Durski AM, Vierstra RD. 2002. The F-box subunit of the SCF E3 complex is encoded by a diverse superfamily of genes in\n Arabidopsis. Proceedings of the National Academy of Sciences 99: 11519-11524.
","pubmedId":"","doi":"doi.org/10.1073/pnas.162339999"},{"reference":"Gampala SS, Kim TW, He JX, Tang W, Deng Z, Bai MY, et al., Wang. 2007. An Essential Role for 14-3-3 Proteins in Brassinosteroid Signal Transduction in Arabidopsis. Developmental Cell 13: 177-189.
","pubmedId":"","doi":"doi.org/10.1016/j.devcel.2007.06.009"},{"reference":"Geem KR, Kim H, Ryu H. 2022. SCFFBS1 Regulates Root Quiescent Center Cell Division via Protein Degradation of APC/CCCS52A2. Molecules and Cells 45: 695-701.
","pubmedId":"","doi":"doi.org/10.14348/molcells.2022.0074"},{"reference":"Gonzalez LE, Keller K, Chan KX, Gessel MM, Thines BC. 2017. Transcriptome analysis uncovers Arabidopsis F-BOX STRESS INDUCED 1 as a regulator of jasmonic acid and abscisic acid stress gene expression. BMC Genomics 18: 10.1186/s12864-017-3864-6.
","pubmedId":"","doi":"doi.org/10.1186/s12864-017-3864-6"},{"reference":"Hong JP, Adams E, Yanagawa Y, Matsui M, Shin R. 2017. AtSKIP18 and AtSKIP31, F-box subunits of the SCF E3 ubiquitin ligase complex, mediate the degradation of 14-3-3 proteins in Arabidopsis. Biochemical and Biophysical Research Communications 485: 174-180.
","pubmedId":"","doi":"doi.org/10.1016/j.bbrc.2017.02.046"},{"reference":"Huang X, Zhang Q, Jiang Y, Yang C, Wang Q, Li L. 2018. Shade-induced nuclear localization of PIF7 is regulated by phosphorylation and 14-3-3 proteins in Arabidopsis. eLife 7: 10.7554/elife.31636.
","pubmedId":"","doi":"doi.org/10.7554/eLife.31636"},{"reference":"Kominami Ki, Ochotorena I, Toda T. 1998. Two F‐box/WD‐repeat proteins Pop1 and Pop2 form hetero‐ and homo‐complexes together with cullin‐1 in the fission yeast SCF (Skp1‐Cullin‐1‐F‐box) ubiquitin ligase. Genes to Cells 3: 721-735.
","pubmedId":"","doi":"doi.org/10.1046/j.1365-2443.1998.00225.x"},{"reference":"Kudla Jr, Bock R. 2016. Lighting the Way to Protein-Protein Interactions: Recommendations on Best Practices for Bimolecular Fluorescence Complementation Analyses. The Plant Cell 28: 1002-1008.
","pubmedId":"","doi":"doi.org/10.1105/tpc.16.00043"},{"reference":"Lee CM, Feke A, Li MW, Adamchek C, Webb K, Pruneda-Paz J, et al., Gendron. 2018. Decoys Untangle Complicated Redundancy and Reveal Targets of Circadian Clock F-Box Proteins. Plant Physiology 177: 1170-1186.
","pubmedId":"","doi":"doi.org/10.1104/pp.18.00331"},{"reference":"Leuzinger K, Dent M, Hurtado J, Stahnke J, Lai H, Zhou X, Chen Q. 2013. Efficient Agroinfiltration of Plants for High-level Transient Expression of Recombinant Proteins. Journal of Visualized Experiments : 10.3791/50521.
","pubmedId":"","doi":"doi.org/10.3791/50521"},{"reference":"Li Y, Xue S, He Q, Wang J, Zhu L, Zou J, et al., Le. 2022. Arabidopsis F‐BOX STRESS INDUCED 4 is required to repress excessive divisions in stomatal development. Journal of Integrative Plant Biology 64: 56-72.
","pubmedId":"","doi":"doi.org/10.1111/jipb.13193"},{"reference":"Madeira Fb, Tinti M, Murugesan G, Berrett E, Stafford M, Toth R, et al., Barton. 2015. 14-3-3-Pred: improved methods to predict 14-3-3-binding phosphopeptides. Bioinformatics 31: 2276-2283.
","pubmedId":"","doi":"10.1093/bioinformatics/btv133"},{"reference":"Maldonado-Calderón MaT, Sepúlveda-García E, Rocha-Sosa M. 2012. Characterization of novel F-box proteins in plants induced by biotic and abiotic stress. Plant Science 185-186: 208-217.
","pubmedId":"","doi":"doi.org/10.1016/j.plantsci.2011.10.013"},{"reference":"Sepulveda-Garcia E, Fulton EC, Parlan EV, O’Connor LE, Fleming AA, Replogle AJ, et al., Thines. 2021. Unique N-Terminal Interactions Connect F-BOX STRESS INDUCED (FBS) Proteins to a WD40 Repeat-like Protein Pathway in Arabidopsis. Plants 10: 2228.
","pubmedId":"","doi":"doi.org/10.3390/plants10102228"},{"reference":"Sepúlveda-García E, Rocha-Sosa M. 2012. The Arabidopsis F-box protein AtFBS1 interacts with 14-3-3 proteins. Plant Science 195: 36-47.
","pubmedId":"","doi":"doi.org/10.1016/j.plantsci.2012.06.009"},{"reference":"Sharma E, Bhatnagar A, Bhaskar A, Majee SM, Kieffer M, Kepinski S, Khurana P, Khurana JP. 2022. Stress‐induced F‐Box protein‐coding geneOsFBX257modulates drought stress adaptations and ABA responses in rice. Plant, Cell & Environment 46: 1207-1231.
","pubmedId":"","doi":"doi.org/10.1111/pce.14496"},{"reference":"Sheard LB, Tan X, Mao H, Withers J, Ben-Nissan G, Hinds TR, et al., Zheng. 2010. Jasmonate perception by inositol-phosphate-potentiated COI1–JAZ co-receptor. Nature 468: 400-405.
","pubmedId":"","doi":"doi.org/10.1038/nature09430"},{"reference":"Tan T, Cai J, Zhan E, Yang Y, Zhao J, Guo Y, Zhou H. 2016. Stability and localization of 14-3-3 proteins are involved in salt tolerance in Arabidopsis. Plant Molecular Biology 92: 391-400.
","pubmedId":"","doi":"doi.org/10.1007/s11103-016-0520-5"},{"reference":"Tang X, Orlicky S, Lin Z, Willems A, Neculai D, Ceccarelli D, et al., Tyers. 2007. Suprafacial Orientation of the SCFCdc4 Dimer Accommodates Multiple Geometries for Substrate Ubiquitination. Cell 129: 1165-1176.
","pubmedId":"","doi":"doi.org/10.1016/j.cell.2007.04.042"},{"reference":"van Kleeff PJ, Jaspert N, Li KW, Rauch S, Oecking C, de Boer AH. 2014. Higher order Arabidopsis 14-3-3 mutants show 14-3-3 involvement in primary root growth both under control and abiotic stress conditions. J Exp Bot 65(20): 5877-88.
","pubmedId":"25189593","doi":""},{"reference":"Varshney V, Potuschak T, Yan S, Noir S, Genschik P. 2026. Hundreds of plant F-box proteins in search of function. J Exp Bot: pii: erag074. 10.1093/jxb/erag074.
","pubmedId":"41678363","doi":""},{"reference":"Welcker M, Larimore EA, Swanger J, Bengoechea-Alonso MT, Grim JE, Ericsson J, Zheng N, Clurman BE. 2013. Fbw7 dimerization determines the specificity and robustness of substrate degradation. Genes & Development 27: 2531-2536.
","pubmedId":"","doi":"doi.org/10.1101/gad.229195.113"},{"reference":"Wilson RS, Swatek KN, Thelen JJ. 2016. Regulation of the Regulators: Post-Translational Modifications, Subcellular, and Spatiotemporal Distribution of Plant 14-3-3 Proteins. Frontiers in Plant Science 7: 10.3389/fpls.2016.00611.
","pubmedId":"","doi":"doi.org/10.3389/fpls.2016.00611"},{"reference":"Zhang C, Yue J, Li S, Zuo C, Li Y, He Q, Le J. 2025. The Arabidopsis F-box protein FBS associated with the helix-loop-helix transcription factor FAMA involved in stomatal immunity. Plant Molecular Biology 115: 10.1007/s11103-025-01577-7.
","pubmedId":"","doi":"doi.org/10.1007/s11103-025-01577-7"},{"reference":"Zhu D, Maier A, Lee JH, Laubinger S, Saijo Y, Wang H, et al., Deng. 2008. Biochemical Characterization ofArabidopsisComplexes Containing CONSTITUTIVELY PHOTOMORPHOGENIC1 and SUPPRESSOR OF PHYA Proteins in Light Control of Plant Development. The Plant Cell 20: 2307-2323.
","pubmedId":"","doi":"doi.org/10.1105/tpc.107.056580"}],"title":"Arabidopsis F-BOX STRESS INDUCED (FBS) proteins have distinct subcellular interaction patterns with 14-3-3 proteins
","reviews":[],"curatorReviews":[]},{"id":"a18f58bf-43d7-4769-b5ee-1319caf3565e","decision":"revise","abstract":"F-BOX STRESS INDUCED (FBS) proteins are substrate adaptors in SCF-type E3 ubiquitin ligases that regulate plant development and stress responses. Arabidopsis thaliana FBS1 (AT1G61340) interacts with multiple 14-3-3 proteins, but it is unknown whether other FBS family members share these interactions. Bimolecular fluorescence complementation (BiFC) assays in Nicotiana benthamiana showed that all four FBS proteins interact with multiple 14-3-3 proteins in vivo. However, FBS1 interactions were restricted to the nucleus, whereas FBS2 – FBS4 (AT4G21510, AT4G05010, AT4G35930) interactions were detected in both the nucleus and cytosol. These findings indicate conserved 14-3-3 interactions within the FBS family, but suggest functional divergence in subcellular interaction profiles.
","acknowledgements":"We thank Michal Morrison-Kerr for storeroom support, David Somers for providing H2B-RFP, and Xing Wang Deng for providing pCL112 and pCL113 vectors, as well as the SPA1 constructs.
","authors":[{"affiliations":["University of Puget Sound, Tacoma, WA"],"departments":[""],"credit":["conceptualization","investigation","formalAnalysis","methodology"],"email":"maelbradley24@gmail.com","firstName":"Mael","lastName":"Bradley","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of California, Berkeley, CA","University of Puget Sound, Tacoma, WA"],"departments":["",""],"credit":["conceptualization","formalAnalysis","investigation","methodology"],"email":"mbacher@berkeley.edu","firstName":"Meghan","lastName":"Bacher","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Washington State University, Pullman, WA","University of Puget Sound, Tacoma, WA"],"departments":["",""],"credit":["formalAnalysis","investigation"],"email":"kaitlin.riggan@wsu.edu","firstName":"Kaitlin","lastName":"Riggan","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Puget Sound, Tacoma, WA"],"departments":[""],"credit":["formalAnalysis","investigation"],"email":"nicolo.spalding@gmail.com","firstName":"Nicolo","lastName":"Torresan","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Puget Sound, Tacoma, WA"],"departments":[""],"credit":["formalAnalysis","investigation"],"email":"mtegman@pugetsound.edu","firstName":"Megan","lastName":"Tegman","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Rhode Island, Kingston, RI","University of Puget Sound, Tacoma, WA"],"departments":["",""],"credit":["formalAnalysis","investigation"],"email":"sabine.angier@uri.edu","firstName":"Sabine","lastName":"Angier","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Puget Sound, Tacoma, WA"],"departments":[""],"credit":["investigation","methodology"],"email":"areplogle@pugetsound.edu","firstName":"Amy","lastName":"Replogle","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Puget Sound, Tacoma, WA"],"departments":[""],"credit":["fundingAcquisition","conceptualization","dataCuration","writing_originalDraft","writing_reviewEditing"],"email":"bthines@pugetsound.edu","firstName":"Bryan","lastName":"Thines","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":null}],"awards":[{"awardId":"grant #2035582 ","funderName":"National Science Foundation (United States)","awardRecipient":"Bryan Thines"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"","image":{"url":"https://portal.micropublication.org/uploads/1136da3a0aef82bc1de4b22588df1fbd.jpg"},"imageCaption":"(A – D) nYFP-FBS1 through nYFP-FBS4 were co-expressed with cYFP-14-3-3 ω and H2B-RFP in four-week-old N. benthamiana leaves. Cell walls were stained with 50 mM propidium iodide (PI), and images were taken three days after agroinfiltration. BiFC (green; first column) indicates protein interaction, while H2B-RFP and PI staining (red; second column) show nuclei and cell walls, respectively. Merged images (third column) show co-localization of BiFC signal with nuclei. (E) nYFP-PP2-A12 was co-expressed with cYFP-14-3-3 ω and H2B-RFP as a negative control. (F – J) The same nYFP fusion constructs and H2B-RFP were co-expressed with cYFP-14-3-3 ψ under identical conditions. (K – N) nYFP-FBS constructs were co-expressed with cYFP-SPA1, the BiFC channel is shown. Scale bar = 100 mm. (O) Average number of nuclei exhibiting BiFC signal per field of view (FOV) for nYFP-FBS family members co-expressed with cYFP-14-3-3 ω, and (P) co-expressed with cYFP-14-3-3 ψ. Error bars represent SE (n = 3 independent experimental replicates). Statistical significance was assessed using one-way ANOVA followed by Tukey’s HSD post-hoc tests. Means with different letters are significantly different from each other at P < 0.05.
","imageTitle":"Arabidopsis FBS interactions with 14-3-3 proteins in bimolecular fluorescence complementation (BiFC) assays
","methods":"Plasmid construction
Standard molecular biology cloning protocols were used to generate Gateway compatible constructs (Thermo Fisher Scientific). FBS and 14-3-3 coding sequences were amplified from cDNA by PCR with gene specific primers (Table 1) using Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific). Amplicons were cloned into the pENTR entry vector with the pENTR/D-TOPO directional cloning kit (Thermo Fisher Scientific). Genes were then transferred into either pCL112 (creates N-terminal fusion to nYFP) or pCL113 (creates N-terminal fusion to cYFP) with LR Clonase II enzyme mix (Thermo Fisher Scientific). Sequences were verified by Sanger sequencing (Eurofins Genomics).
Agroinfiltration of Nicotiana benthamiana leaves
Agrobacterium tumefaciens strain GV3101 pMP90 was transformed by electroporation and selected by appropriate antibiotics. Seed cultures were grown in liquid LB for 2 days with shaking at 28 oC. Full cultures were inoculated with 1:100 volume and grown for 24 hours under the same conditions. Cells were pelleted and resuspended in infiltration medium (10 mM MES, 10 mM MgCl2, 100 mM acetosyringone) and incubated for 5 hours with rocking at room temperature. Cells were pelleted a second time and resuspended in infiltration medium. Appropriate nYFP/cYFP pairs, H2B-RFP, and p19 suppressor strains were mixed at a final OD600 of 1.0 for each strain. The abaxial side of Nicotiana benthamiana leaves from 4-week-old plants grown under greenhouse conditions was infiltrated by syringe with the A. tumefaciens mixes using standard protocols (Leuzinger et al., 2013).
Imaging
Three days after infiltration, N. benthamiana leaves to be imaged were infiltrated with 50 mM propidium iodide in 0.1% Tween-20 and allowed to sit for 10 minutes. Approximately 1 cm2 from infiltrated leaves was then cut and mounted on a glass slide with 0.1% Tween-20. The underside of whole leaf mounts was visualized by laser-scanning confocal microscopy using a Nikon D-Eclipse C1 Confocal laser scanning microscope (Nikon Instruments) with either: 1) excitation at 488 nm with an emission band pass filter of 515/30, or 2) excitation at 561 nm with an emission band pass filter of 650 LP. Images were processed with Fiji software (http://imagej.net/software/fiji/). Representative images from at least three independent experimental replicates are shown.
Data analysis
Nuclei containing a BiFC fluorescence signal were counted under a 20X objective lens in two separate areas of each leaf, which were then averaged, from three independent experimental trials. The field of view (FOV) diameter was 1100 µm. Statistical analyses were performed in RStudio version 4.0.4 using a one-way ANOVA and Tukey’s HSD post-hoc test.
","reagents":"
|
| Primer sequences 5' to 3' | |
Gene | AGI number | Forward | Reverse |
FBS1 | At1g61340 | CACCATGGCATTGGGGAAGAAAAGAATCG | TCAGTGGAATAGAGCCACTGAGAC |
FBS2 | At4g21510 | CACCATGATCCATTATCTCCATTTCA | TCATGTAAACAAAGCCGCAG |
FBS3 | At4g05010 | CACCATGGCGTATTTGAGTGATG | TCATTTAAACAATACCATAGAGATCTTCGACAAATC |
FBS4 | At4g35930 | CACCATGGGGAAGGTATCTCCAAAG | TCAGGTGAGGTTGTTTTGAGC |
PP2-A12 | At1g12710 | CACCATGGGTGTGGCTCACTCTGAT | TTAAAACCGCTTCAACTGGTC |
14-3-3 omega | At1g78300 | CACCATGGCGTCTGGGCGTGAAG | TCACTGCTGTTCCTCGGTCG |
14-3-3 psi | At5g38480 | CACCATGTCGACAAGGGAAGAGAATGT | TTACTCGGCACCATCGGG |
Numerous cellular pathways in eukaryotes are regulated through selective protein degradation by the ubiquitin 26S proteasome system (UPS). SKP1-CUL1-F-box (SCF) complexes are a prevalent type of E3 ubiquitin ligase in the UPS that use F-box (FBX) proteins as substrate adaptors to specifically recruit ubiquitination targets (Lee et al., 2018; Sheard et al., 2010; Varshney et al., 2026). Four Arabidopsis thaliana F-BOX STRESS INDUCED proteins (FBS1 – FBS4) compose a subfamily of plant-specific FBX proteins (Maldonado-Calderon et al., 2012). FBS1 and FBS4 target anaphase-promoting complex/cyclosome (APC/C)-associated regulatory proteins to control cell division events and related processes, including maintenance of the root quiescent center (QC) and cell fate determination during stomatal development (Geem et al., 2022; Li et al., 2022; Zhang et al., 2025). FBS proteins also likely target two other nuclear-localized WD40 repeat-like family proteins of unknown function (Sepulveda-Garcia et al., 2021).
In addition to its targeting interactions, FBS1 interacts with at least six of thirteen proteins belonging to the Arabidopsis 14-3-3 family in yeast two-hybrid and in vitro pull-down assays (Sepulveda-Garcia & Rocha-Sosa, 2012). 14-3-3 proteins are eukaryotic regulators that specifically interact with their client proteins to alter their activity (Wilson et al., 2016). While some 14-3-3 proteins are SCF targets in plants (Hong et al., 2017), FBS1 does not seem to target 14-3-3 proteins for degradation, as increased FBS1 abundance does not lead to a decrease in the level of FBS interactor 14-3-3 λ (AT5G10450) (Sepulveda-Garcia et al., 2021; Sepulveda-Garcia & Rocha-Sosa, 2012). Furthermore, 14-3-3 proteins interact with FBS1 via the F-box domain (Sepulveda-Garcia & Rocha-Sosa, 2012), which is required for FBX protein interaction with Skp and the core SCF complex. The regulatory purpose and biological consequence of FBS1 interaction with 14-3-3 proteins are currently unknown.
Members of FBX protein subfamilies often have some functional redundancy while still maintaining distinct biological roles (Lee et al., 2018). FBS1 – FBS4 likely have distinct biological functions relative to each other based on their expression profiles and mutant phenotypes (Geem et al., 2022; Li et al., 2022; Maldonado-Calderon et al., 2012). However, it is unknown whether FBS2 – FBS4 also interact with 14-3-3 proteins and whether they might experience similar regulatory mechanisms to FBS1. Moreover, while FBS proteins interact with at least some of their targets in the nucleus (Li et al., 2022; Sepulveda-Garcia et al., 2021), the subcellular locations of FBS interactions with 14-3-3 proteins are unknown. Having this interaction information could offer clues as to how 14-3-3 proteins work with FBS proteins within the regulatory network associated with the APC/C to influence plant growth and development. We therefore tested all four Arabidopsis FBS proteins for interaction with multiple Arabidopsis 14-3-3 proteins in living plants using bimolecular fluorescence complementation (BiFC) assays.
Among the four members of the FBS protein family, distinct interaction profiles with 14-3-3 proteins were observed. FBS1 interactions with 14-3-3 ω (AT1G78300) and 14-3-3 ψ (AT5G38480) were restricted to the nucleus under the conditions tested, as shown by colocalization of the BiFC signal with nuclear localized fusion protein H2B-RFP (Figure 1 A and F). In contrast, FBS2 – FBS4 had fewer interactions with these 14-3-3 proteins in the nucleus, but they interacted in the cytosol (Figure 1 B – D and G – I). The frequencies of nuclear interactions between FBS2 – FBS4 and 14-3-3 proteins ω or ψ were less than 25% of those found for FBS1 interactions in a field of view (Figure 1 O and P). Because the F-box domain is required for FBS1 interaction with 14-3-3 proteins (Sepulveda-Garcia & Rocha-Sosa, 2012), we tested the phylogenetically related FBX protein PP2-A12 (AT1G12710), one of the two closest non-FBS FBX family members based on F-box domain sequence analysis (Gagne et al., 2002). In contrast to the FBS proteins, no BiFC signal was detected when PP2-A12 was co-expressed with either of the 14-3-3 proteins under the conditions tested (Figure 1 E and J). As an additional negative control for nonspecific interactions, FBS proteins were tested with the unrelated nuclear-localized protein SPA1 (AT2G46340) (Zhu et al., 2008), and no detectable BiFC signal was observed for any of the four FBS proteins (Figure 1 K – N). Collectively, these findings show distinct subcellular patterns of FBS/14-3-3 interactions in vivo, while the negative control results are consistent with specificity of the observed BiFC interactions.
FBS proteins have numerous protein interactors, some of which are ubiquitylation targets, while others may regulate FBX protein function and the ubiquitylation process. This work found that all four FBS proteins interacted with 14-3-3 proteins in living plant cells, indicating that 14-3-3 interaction is conserved within the FBS family. However, FBS1 showed the highest frequency of nuclear interactions with the 14-3-3 proteins under the conditions tested here, suggesting potential functional divergence or distinct contributions among family members. Although the negative controls are consistent with specificity of the observed FBS/14-3-3 interactions, PP2-A12 and SPA1 protein accumulation was not independently verified and alternative orientations of the YFP fragments were not tested. Thus, differences in protein abundance or steric constraints could contribute to the absence of BiFC signal with PP2-A12 or SPA1, and these results should not be interpreted as definitive evidence for lack of interaction. Moreover, BiFC can stabilize transient protein interactions (Kudla & Bock, 2016), and therefore these findings may not fully reflect endogenous interaction dynamics. Nevertheless, the absence of detectable BiFC signal between FBS proteins and SPA1 or between 14-3-3 proteins and PP2-A12, together with the distinct subcellular interaction patterns observed among FBS family members and previous yeast two-hybrid and in vitro pull-down evidence for FBS1/14-3-3 interactions (Sepúlveda-García & Rocha-Sosa, 2012), provides support for the specificity of the observed FBS/14-3-3 interactions.
The N-terminal region and F-box domain of FBS1 have previously been implicated in 14-3-3 binding (Sepulveda-Garcia & Rocha-Sosa, 2012), but whether these regions similarly mediate 14-3-3 interactions with FBS2 – FBS4 remains unknown. Canonical Mode I or Mode II 14-3-3 recognition motifs often mediate 14-3-3 protein interaction with the client protein (Camoni et al., 2018). None of the four FBS proteins contains either of these motifs. The absence of canonical recognition motifs suggests that FBS interactions with 14-3-3 proteins may involve noncanonical phosphorylation-dependent binding sites or an alternative mode of interaction. Sequence analysis using 14-3-3-Pred, software that predicts 14-3-3-binding phosphopeptides (Madeira et al., 2015), identified several Ser/Thr residues in FBS1, FBS2, and FBS4 with scores above the consensus prediction threshold, despite their occurrence outside canonical recognition motifs. These residues therefore represent candidate phosphorylation sites for future studies testing the effects of amino acid substitutions on 14-3-3 binding.
The purpose of FBS interaction with 14-3-3 proteins is currently unknown. One possibility is that these interactions regulate FBS distribution within the cell, as some 14-3-3 protein interactions control the subcellular localization of client proteins. A more in-depth investigation of FBS localization, whether bound to 14-3-3 proteins or not, may clarify whether cellular distribution plays a role in restricting FBS activities. The roles of 14-3-3 proteins in regulating FBS localization could then be tested through genetic reduction of 14-3-3 activity in Arabidopsis mutants or through chemical inhibition using AICAR (Toroser et al., 1998). Alternatively, interactions between FBS and 14-3-3 proteins may have important implications for SCF complex assembly and substrate specificity. SCF complex dimerization can enhance substrate recognition capabilities and/or diversify target range (Tang et al., 2007; Welcker et al., 2013), and facilitating FBX dimerization is a role of some 14-3-3 proteins (Barbash et al., 2011). Considering FBX protein homo- and hetero-dimerization (Kominami et al., 1998), having four Arabidopsis FBS family members raises the possibility that combinatorial dimerization could expand target range as the number of verified SCFFBS targets continues to grow. The differential localization observed here raises the possibility that 14-3-3-mediated, compartment-specific FBS dimerization could contribute to distinct functions among FBS family members. Future work could therefore assess the effects of 14-3-3 proteins on SCFFBS target selection and ubiquitylation activity in both in vitro and in vivo systems.
Determining whether 14-3-3 proteins regulate FBS localization or enable SCFFBS substrate recognition may lead to a deeper mechanistic understanding of how plant stress responses are controlled. Several 14-3-3 proteins that interact with FBS proteins regulate abiotic stress signaling (Catala et al., 2014; Tan et al., 2016; van Kleeff et al., 2014). Likewise, both FBS1 and the rice homolog FBX257 are functionally connected to plant abiotic stress responses, either through transcriptional effects or mutant phenotypes (Geem et al., 2022; Gonzalez et al., 2017; Maldonado-Calderon et al., 2012; Sharma et al., 2023). Future work investigating how FBS and 14-3-3 proteins function together should therefore include conditions that specifically address environmental stress. Collectively, this work expands understanding of FBS/14-3-3 family-wide interactions and suggests future studies examining their mechanistic roles in environmental stress signaling.
","references":[{"reference":"Barbash O, Lee EK, Diehl JA. 2011. Phosphorylation-dependent regulation of SCFFbx4 dimerization and activity involves a novel component, 14-3-3ɛ. Oncogene 30: 1995-2002.
","pubmedId":"","doi":"10.1038/onc.2010.584"},{"reference":"Camoni L, Visconti S, Aducci P, Marra M. 2018. 14-3-3 Proteins in Plant Hormone Signaling: Doing Several Things at Once. Frontiers in Plant Science 9: 10.3389/fpls.2018.00297.
","pubmedId":"","doi":"10.3389/fpls.2018.00297"},{"reference":"Catalá R, López-Cobollo R, Mar Castellano M, Angosto T, Alonso JM, Ecker JR, Salinas J. 2014. TheArabidopsis14-3-3 Protein RARE COLD INDUCIBLE 1A Links Low-Temperature Response and Ethylene Biosynthesis to Regulate Freezing Tolerance and Cold Acclimation . The Plant Cell 26: 3326-3342.
","pubmedId":"","doi":"doi.org/10.1105/tpc.114.127605"},{"reference":"Gagne JM, Downes BP, Shiu SH, Durski AM, Vierstra RD. 2002. The F-box subunit of the SCF E3 complex is encoded by a diverse superfamily of genes in\n Arabidopsis. Proceedings of the National Academy of Sciences 99: 11519-11524.
","pubmedId":"","doi":"doi.org/10.1073/pnas.162339999"},{"reference":"Gampala SS, Kim TW, He JX, Tang W, Deng Z, Bai MY, et al., Wang. 2007. An Essential Role for 14-3-3 Proteins in Brassinosteroid Signal Transduction in Arabidopsis. Developmental Cell 13: 177-189.
","pubmedId":"","doi":"doi.org/10.1016/j.devcel.2007.06.009"},{"reference":"Geem KR, Kim H, Ryu H. 2022. SCFFBS1 Regulates Root Quiescent Center Cell Division via Protein Degradation of APC/CCCS52A2. Molecules and Cells 45: 695-701.
","pubmedId":"","doi":"doi.org/10.14348/molcells.2022.0074"},{"reference":"Gonzalez LE, Keller K, Chan KX, Gessel MM, Thines BC. 2017. Transcriptome analysis uncovers Arabidopsis F-BOX STRESS INDUCED 1 as a regulator of jasmonic acid and abscisic acid stress gene expression. BMC Genomics 18: 10.1186/s12864-017-3864-6.
","pubmedId":"","doi":"doi.org/10.1186/s12864-017-3864-6"},{"reference":"Hong JP, Adams E, Yanagawa Y, Matsui M, Shin R. 2017. AtSKIP18 and AtSKIP31, F-box subunits of the SCF E3 ubiquitin ligase complex, mediate the degradation of 14-3-3 proteins in Arabidopsis. Biochemical and Biophysical Research Communications 485: 174-180.
","pubmedId":"","doi":"doi.org/10.1016/j.bbrc.2017.02.046"},{"reference":"Huang X, Zhang Q, Jiang Y, Yang C, Wang Q, Li L. 2018. Shade-induced nuclear localization of PIF7 is regulated by phosphorylation and 14-3-3 proteins in Arabidopsis. eLife 7: 10.7554/elife.31636.
","pubmedId":"","doi":"doi.org/10.7554/eLife.31636"},{"reference":"Kominami Ki, Ochotorena I, Toda T. 1998. Two F‐box/WD‐repeat proteins Pop1 and Pop2 form hetero‐ and homo‐complexes together with cullin‐1 in the fission yeast SCF (Skp1‐Cullin‐1‐F‐box) ubiquitin ligase. Genes to Cells 3: 721-735.
","pubmedId":"","doi":"doi.org/10.1046/j.1365-2443.1998.00225.x"},{"reference":"Kudla Jr, Bock R. 2016. Lighting the Way to Protein-Protein Interactions: Recommendations on Best Practices for Bimolecular Fluorescence Complementation Analyses. The Plant Cell 28: 1002-1008.
","pubmedId":"","doi":"doi.org/10.1105/tpc.16.00043"},{"reference":"Lee CM, Feke A, Li MW, Adamchek C, Webb K, Pruneda-Paz J, et al., Gendron. 2018. Decoys Untangle Complicated Redundancy and Reveal Targets of Circadian Clock F-Box Proteins. Plant Physiology 177: 1170-1186.
","pubmedId":"","doi":"doi.org/10.1104/pp.18.00331"},{"reference":"Leuzinger K, Dent M, Hurtado J, Stahnke J, Lai H, Zhou X, Chen Q. 2013. Efficient Agroinfiltration of Plants for High-level Transient Expression of Recombinant Proteins. Journal of Visualized Experiments : 10.3791/50521.
","pubmedId":"","doi":"doi.org/10.3791/50521"},{"reference":"Li Y, Xue S, He Q, Wang J, Zhu L, Zou J, et al., Le. 2022. Arabidopsis F‐BOX STRESS INDUCED 4 is required to repress excessive divisions in stomatal development. Journal of Integrative Plant Biology 64: 56-72.
","pubmedId":"","doi":"doi.org/10.1111/jipb.13193"},{"reference":"Madeira Fb, Tinti M, Murugesan G, Berrett E, Stafford M, Toth R, et al., Barton. 2015. 14-3-3-Pred: improved methods to predict 14-3-3-binding phosphopeptides. Bioinformatics 31: 2276-2283.
","pubmedId":"","doi":"10.1093/bioinformatics/btv133"},{"reference":"Maldonado-Calderón MaT, Sepúlveda-García E, Rocha-Sosa M. 2012. Characterization of novel F-box proteins in plants induced by biotic and abiotic stress. Plant Science 185-186: 208-217.
","pubmedId":"","doi":"doi.org/10.1016/j.plantsci.2011.10.013"},{"reference":"Sepulveda-Garcia E, Fulton EC, Parlan EV, O’Connor LE, Fleming AA, Replogle AJ, et al., Thines. 2021. Unique N-Terminal Interactions Connect F-BOX STRESS INDUCED (FBS) Proteins to a WD40 Repeat-like Protein Pathway in Arabidopsis. Plants 10: 2228.
","pubmedId":"","doi":"doi.org/10.3390/plants10102228"},{"reference":"Sepúlveda-García E, Rocha-Sosa M. 2012. The Arabidopsis F-box protein AtFBS1 interacts with 14-3-3 proteins. Plant Science 195: 36-47.
","pubmedId":"","doi":"doi.org/10.1016/j.plantsci.2012.06.009"},{"reference":"Sharma E, Bhatnagar A, Bhaskar A, Majee SM, Kieffer M, Kepinski S, Khurana P, Khurana JP. 2022. Stress‐induced F‐Box protein‐coding geneOsFBX257modulates drought stress adaptations and ABA responses in rice. Plant, Cell & Environment 46: 1207-1231.
","pubmedId":"","doi":"doi.org/10.1111/pce.14496"},{"reference":"Sheard LB, Tan X, Mao H, Withers J, Ben-Nissan G, Hinds TR, et al., Zheng. 2010. Jasmonate perception by inositol-phosphate-potentiated COI1–JAZ co-receptor. Nature 468: 400-405.
","pubmedId":"","doi":"doi.org/10.1038/nature09430"},{"reference":"Tan T, Cai J, Zhan E, Yang Y, Zhao J, Guo Y, Zhou H. 2016. Stability and localization of 14-3-3 proteins are involved in salt tolerance in Arabidopsis. Plant Molecular Biology 92: 391-400.
","pubmedId":"","doi":"doi.org/10.1007/s11103-016-0520-5"},{"reference":"Tang X, Orlicky S, Lin Z, Willems A, Neculai D, Ceccarelli D, et al., Tyers. 2007. Suprafacial Orientation of the SCFCdc4 Dimer Accommodates Multiple Geometries for Substrate Ubiquitination. Cell 129: 1165-1176.
","pubmedId":"","doi":"doi.org/10.1016/j.cell.2007.04.042"},{"reference":"van Kleeff PJ, Jaspert N, Li KW, Rauch S, Oecking C, de Boer AH. 2014. Higher order Arabidopsis 14-3-3 mutants show 14-3-3 involvement in primary root growth both under control and abiotic stress conditions. J Exp Bot 65(20): 5877-88.
","pubmedId":"25189593","doi":""},{"reference":"Varshney V, Potuschak T, Yan S, Noir S, Genschik P. 2026. Hundreds of plant F-box proteins in search of function. J Exp Bot: pii: erag074. 10.1093/jxb/erag074.
","pubmedId":"41678363","doi":""},{"reference":"Welcker M, Larimore EA, Swanger J, Bengoechea-Alonso MT, Grim JE, Ericsson J, Zheng N, Clurman BE. 2013. Fbw7 dimerization determines the specificity and robustness of substrate degradation. Genes & Development 27: 2531-2536.
","pubmedId":"","doi":"doi.org/10.1101/gad.229195.113"},{"reference":"Wilson RS, Swatek KN, Thelen JJ. 2016. Regulation of the Regulators: Post-Translational Modifications, Subcellular, and Spatiotemporal Distribution of Plant 14-3-3 Proteins. Frontiers in Plant Science 7: 10.3389/fpls.2016.00611.
","pubmedId":"","doi":"doi.org/10.3389/fpls.2016.00611"},{"reference":"Zhang C, Yue J, Li S, Zuo C, Li Y, He Q, Le J. 2025. The Arabidopsis F-box protein FBS associated with the helix-loop-helix transcription factor FAMA involved in stomatal immunity. Plant Molecular Biology 115: 10.1007/s11103-025-01577-7.
","pubmedId":"","doi":"doi.org/10.1007/s11103-025-01577-7"},{"reference":"Zhu D, Maier A, Lee JH, Laubinger S, Saijo Y, Wang H, et al., Deng. 2008. Biochemical Characterization ofArabidopsisComplexes Containing CONSTITUTIVELY PHOTOMORPHOGENIC1 and SUPPRESSOR OF PHYA Proteins in Light Control of Plant Development. The Plant Cell 20: 2307-2323.
","pubmedId":"","doi":"doi.org/10.1105/tpc.107.056580"}],"title":"Arabidopsis F-BOX STRESS INDUCED (FBS) proteins have distinct subcellular interaction patterns with 14-3-3 proteins
","reviews":[],"curatorReviews":[]},{"id":"4b0993c1-de5e-43d9-bba7-0f537209c4a8","decision":"accept","abstract":"F-BOX STRESS INDUCED (FBS) proteins are substrate adaptors in SCF-type E3 ubiquitin ligases that regulate plant development and stress responses. Arabidopsis thaliana FBS1 (AT1G61340) interacts with multiple 14-3-3 proteins, but it is unknown whether other FBS family members share these interactions. Bimolecular fluorescence complementation (BiFC) assays in Nicotiana benthamiana showed that all four FBS proteins interact with multiple 14-3-3 proteins in vivo. However, FBS1 interactions were restricted to the nucleus, whereas FBS2 – FBS4 (AT4G21510, AT4G05010, AT4G35930) interactions were detected in both the nucleus and cytosol. These findings indicate conserved 14-3-3 interactions within the FBS family, but suggest functional divergence in subcellular interaction profiles.
","acknowledgements":"We thank Michal Morrison-Kerr for storeroom support, David Somers for providing H2B-RFP, and Xing Wang Deng for providing pCL112 and pCL113 vectors, as well as the SPA1 constructs.
","authors":[{"affiliations":["University of Puget Sound, Tacoma, WA"],"departments":[""],"credit":["conceptualization","investigation","formalAnalysis","methodology"],"email":"maelbradley24@gmail.com","firstName":"Mael","lastName":"Bradley","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of California, Berkeley, CA","University of Puget Sound, Tacoma, WA"],"departments":["",""],"credit":["conceptualization","formalAnalysis","investigation","methodology"],"email":"mbacher@berkeley.edu","firstName":"Meghan","lastName":"Bacher","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Washington State University, Pullman, WA","University of Puget Sound, Tacoma, WA"],"departments":["",""],"credit":["formalAnalysis","investigation"],"email":"kaitlin.riggan@wsu.edu","firstName":"Kaitlin","lastName":"Riggan","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Puget Sound, Tacoma, WA"],"departments":[""],"credit":["formalAnalysis","investigation"],"email":"nicolo.spalding@gmail.com","firstName":"Nicolo","lastName":"Torresan","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Puget Sound, Tacoma, WA"],"departments":[""],"credit":["formalAnalysis","investigation"],"email":"mtegman@pugetsound.edu","firstName":"Megan","lastName":"Tegman","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Rhode Island, Kingston, RI","University of Puget Sound, Tacoma, WA"],"departments":["",""],"credit":["formalAnalysis","investigation"],"email":"sabine.angier@uri.edu","firstName":"Sabine","lastName":"Angier","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Puget Sound, Tacoma, WA"],"departments":[""],"credit":["investigation","methodology"],"email":"areplogle@pugetsound.edu","firstName":"Amy","lastName":"Replogle","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Puget Sound, Tacoma, WA"],"departments":[""],"credit":["fundingAcquisition","conceptualization","dataCuration","writing_originalDraft","writing_reviewEditing"],"email":"bthines@pugetsound.edu","firstName":"Bryan","lastName":"Thines","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":null}],"awards":[{"awardId":"grant #2035582 ","funderName":"National Science Foundation (United States)","awardRecipient":"Bryan Thines"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"Arabidopsis FBS proteins co-expressed with SPA1 in bimolecular fluorescence complementation (BiFC) assays.
","doi":"10.22002/mpexm-85m05","resourceType":"Image","name":"14-3-3 SPA1.jpg","url":"https://portal.micropublication.org/uploads/f03335643586839492e3cafcb273b949.jpg"}],"funding":"","image":{"url":"https://portal.micropublication.org/uploads/c613a85570a319a1c98e932c8ffad4a7.jpg"},"imageCaption":"(A – D) nYFP-FBS1 through nYFP-FBS4 were co-expressed with cYFP-14-3-3 ω and H2B-RFP in four-week-old N. benthamiana leaves. Cell walls were stained with 50 μM propidium iodide (PI), and images were taken three days after agroinfiltration. BiFC (green; first column) indicates protein interaction, while H2B-RFP and PI staining (red; second column) show nuclei and cell walls, respectively. Merged images (third column) show co-localization of BiFC signal with nuclei. (E) nYFP-PP2-A12 was co-expressed with cYFP-14-3-3 ω and H2B-RFP as a negative control. (F – J) The same nYFP fusion constructs and H2B-RFP were co-expressed with cYFP-14-3-3 ψ under identical conditions. (K – N) nYFP-FBS constructs were co-expressed with cYFP-SPA1, the BiFC channel is shown (all channels are shown in Extended Data). Scale bar = 100 μm. (O) Average number of nuclei exhibiting BiFC signal per field of view (FOV) for nYFP-FBS family members co-expressed with cYFP-14-3-3 ω, and (P) co-expressed with cYFP-14-3-3 ψ. Error bars represent SE (n = 3 independent experimental replicates). Statistical significance was assessed using one-way ANOVA followed by Tukey’s HSD post-hoc tests. Means with different letters are significantly different from each other at P < 0.05.
","imageTitle":"Arabidopsis FBS interactions with 14-3-3 proteins in bimolecular fluorescence complementation (BiFC) assays
","methods":"Plasmid construction
Standard molecular biology cloning protocols were used to generate Gateway compatible constructs (Thermo Fisher Scientific). FBS and 14-3-3 coding sequences were amplified from cDNA by PCR with gene specific primers (Table 1) using Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific). Amplicons were cloned into the pENTR entry vector with the pENTR/D-TOPO directional cloning kit (Thermo Fisher Scientific). Genes were then transferred into either pCL112 (creates N-terminal fusion to nYFP) or pCL113 (creates N-terminal fusion to cYFP) with LR Clonase II enzyme mix (Thermo Fisher Scientific). Sequences were verified by Sanger sequencing (Eurofins Genomics).
Agroinfiltration of Nicotiana benthamiana leaves
Agrobacterium tumefaciens strain GV3101 pMP90 was transformed by electroporation and selected by appropriate antibiotics. Seed cultures were grown in liquid LB for 2 days with shaking at 28 oC. Full cultures were inoculated with 1:100 volume and grown for 24 hours under the same conditions. Cells were pelleted and resuspended in infiltration medium (10 mM MES, 10 mM MgCl2, 100 mM acetosyringone) and incubated for 5 hours with rocking at room temperature. Cells were pelleted a second time and resuspended in infiltration medium. Appropriate nYFP/cYFP pairs, H2B-RFP, and p19 suppressor strains were mixed at a final OD600 of 1.0 for each strain. The abaxial side of Nicotiana benthamiana leaves from 4-week-old plants grown under greenhouse conditions was infiltrated by syringe with the A. tumefaciens mixes using standard protocols (Leuzinger et al., 2013).
Imaging
Three days after infiltration, N. benthamiana leaves to be imaged were infiltrated with 50 mM propidium iodide in 0.1% Tween-20 and allowed to sit for 10 minutes. Approximately 1 cm2 from infiltrated leaves was then cut and mounted on a glass slide with 0.1% Tween-20. The underside of whole leaf mounts was visualized by laser-scanning confocal microscopy using a Nikon D-Eclipse C1 Confocal laser scanning microscope (Nikon Instruments) with either: 1) excitation at 488 nm with an emission band pass filter of 515/30, or 2) excitation at 561 nm with an emission band pass filter of 650 LP. Images were processed with Fiji software (http://imagej.net/software/fiji/). Representative images from at least three independent experimental replicates are shown.
Data analysis
Nuclei containing a BiFC fluorescence signal were counted under a 20X objective lens in two separate areas of each leaf, which were then averaged, from three independent experimental trials. The field of view (FOV) diameter was 1100 µm. Statistical analyses were performed in RStudio version 4.0.4 using a one-way ANOVA and Tukey’s HSD post-hoc test.
","reagents":"
|
| Primer sequences 5' to 3' | |
Gene | AGI number | Forward | Reverse |
FBS1 | At1g61340 | CACCATGGCATTGGGGAAGAAAAGAATCG | TCAGTGGAATAGAGCCACTGAGAC |
FBS2 | At4g21510 | CACCATGATCCATTATCTCCATTTCA | TCATGTAAACAAAGCCGCAG |
FBS3 | At4g05010 | CACCATGGCGTATTTGAGTGATG | TCATTTAAACAATACCATAGAGATCTTCGACAAATC |
FBS4 | At4g35930 | CACCATGGGGAAGGTATCTCCAAAG | TCAGGTGAGGTTGTTTTGAGC |
PP2-A12 | At1g12710 | CACCATGGGTGTGGCTCACTCTGAT | TTAAAACCGCTTCAACTGGTC |
14-3-3 omega | At1g78300 | CACCATGGCGTCTGGGCGTGAAG | TCACTGCTGTTCCTCGGTCG |
14-3-3 psi | At5g38480 | CACCATGTCGACAAGGGAAGAGAATGT | TTACTCGGCACCATCGGG |
Numerous cellular pathways in eukaryotes are regulated through selective protein degradation by the ubiquitin 26S proteasome system (UPS). SKP1-CUL1-F-box (SCF) complexes are a prevalent type of E3 ubiquitin ligase in the UPS that use F-box (FBX) proteins as substrate adaptors to specifically recruit ubiquitination targets (Lee et al., 2018; Sheard et al., 2010; Varshney et al., 2026). Four Arabidopsis thaliana F-BOX STRESS INDUCED proteins (FBS1 – FBS4) compose a subfamily of plant-specific FBX proteins (Maldonado-Calderon et al., 2012). FBS1 and FBS4 target anaphase-promoting complex/cyclosome (APC/C)-associated regulatory proteins to control cell division events and related processes, including maintenance of the root quiescent center (QC) and cell fate determination during stomatal development (Geem et al., 2022; Li et al., 2022; Zhang et al., 2025). FBS proteins also likely target two other nuclear-localized WD40 repeat-like family proteins of unknown function (Sepulveda-Garcia et al., 2021).
In addition to its targeting interactions, FBS1 interacts with at least six of thirteen proteins belonging to the Arabidopsis 14-3-3 family in yeast two-hybrid and in vitro pull-down assays (Sepulveda-Garcia & Rocha-Sosa, 2012). 14-3-3 proteins are eukaryotic regulators that specifically interact with their client proteins to alter their activity (Wilson et al., 2016). While some 14-3-3 proteins are SCF targets in plants (Hong et al., 2017), FBS1 does not seem to target 14-3-3 proteins for degradation, as increased FBS1 abundance does not lead to a decrease in the level of FBS interactor 14-3-3 λ (AT5G10450) (Sepulveda-Garcia et al., 2021; Sepulveda-Garcia & Rocha-Sosa, 2012). Furthermore, 14-3-3 proteins interact with FBS1 via the F-box domain (Sepulveda-Garcia & Rocha-Sosa, 2012), which is required for FBX protein interaction with Skp and the core SCF complex. The regulatory purpose and biological consequence of FBS1 interaction with 14-3-3 proteins are currently unknown.
Members of FBX protein subfamilies often have some functional redundancy while still maintaining distinct biological roles (Lee et al., 2018). FBS1 – FBS4 likely have distinct biological functions relative to each other based on their expression profiles and mutant phenotypes (Geem et al., 2022; Li et al., 2022; Maldonado-Calderon et al., 2012). However, it is unknown whether FBS2 – FBS4 also interact with 14-3-3 proteins and whether they might experience similar regulatory mechanisms to FBS1. Moreover, while FBS proteins interact with at least some of their targets in the nucleus (Li et al., 2022; Sepulveda-Garcia et al., 2021), the subcellular locations of FBS interactions with 14-3-3 proteins are unknown. Having this interaction information could offer clues as to how 14-3-3 proteins work with FBS proteins within the regulatory network associated with the APC/C to influence plant growth and development. We therefore tested all four Arabidopsis FBS proteins for interaction with multiple Arabidopsis 14-3-3 proteins in living plants using bimolecular fluorescence complementation (BiFC) assays.
Among the four members of the FBS protein family, distinct interaction profiles with 14-3-3 proteins were observed. FBS1 interactions with 14-3-3 ω (AT1G78300) and 14-3-3 ψ (AT5G38480) were restricted to the nucleus under the conditions tested, as shown by colocalization of the BiFC signal with nuclear localized fusion protein H2B-RFP (Figure 1 A and F). In contrast, FBS2 – FBS4 had fewer interactions with these 14-3-3 proteins in the nucleus, but they interacted in the cytosol (Figure 1 B – D and G – I). The frequencies of nuclear interactions between FBS2 – FBS4 and 14-3-3 proteins ω or ψ were less than 25% of those found for FBS1 interactions in a field of view (Figure 1 O and P). Because the F-box domain is required for FBS1 interaction with 14-3-3 proteins (Sepulveda-Garcia & Rocha-Sosa, 2012), we tested the phylogenetically related FBX protein PP2-A12 (AT1G12710), one of the two closest non-FBS FBX family members based on F-box domain sequence analysis (Gagne et al., 2002). In contrast to the FBS proteins, no BiFC signal was detected when PP2-A12 was co-expressed with either of the 14-3-3 proteins under the conditions tested (Figure 1 E and J). As an additional negative control for nonspecific interactions, FBS proteins were tested with the unrelated nuclear-localized protein SPA1 (AT2G46340) (Zhu et al., 2008), and no detectable BiFC signal was observed for any of the four FBS proteins (Figure 1 K – N, see also Extended Data). Collectively, these findings show distinct subcellular patterns of FBS/14-3-3 interactions in vivo, while the negative control results are consistent with specificity of the observed BiFC interactions.
FBS proteins have numerous protein interactors, some of which are ubiquitylation targets, while others may regulate FBX protein function and the ubiquitylation process. This work found that all four FBS proteins interacted with 14-3-3 proteins in living plant cells, indicating that 14-3-3 interaction is conserved within the FBS family. However, FBS1 showed the highest frequency of nuclear interactions with the 14-3-3 proteins under the conditions tested here, suggesting potential functional divergence or distinct contributions among family members. Although the negative controls are consistent with specificity of the observed FBS/14-3-3 interactions, PP2-A12 and SPA1 protein accumulation was not independently verified and alternative orientations of the YFP fragments were not tested. Thus, differences in protein abundance or steric constraints could contribute to the absence of BiFC signal with PP2-A12 or SPA1, and these results should not be interpreted as definitive evidence for lack of interaction. Moreover, BiFC can stabilize transient protein interactions (Kudla & Bock, 2016), and therefore these findings may not fully reflect endogenous interaction dynamics. Nevertheless, the absence of detectable BiFC signal between FBS proteins and SPA1 or between 14-3-3 proteins and PP2-A12, together with the distinct subcellular interaction patterns observed among FBS family members and previous yeast two-hybrid and in vitro pull-down evidence for FBS1/14-3-3 interactions (Sepúlveda-García & Rocha-Sosa, 2012), provides support for the specificity of the observed FBS/14-3-3 interactions.
The N-terminal region and F-box domain of FBS1 have previously been implicated in 14-3-3 binding (Sepulveda-Garcia & Rocha-Sosa, 2012), but whether these regions similarly mediate 14-3-3 interactions with FBS2 – FBS4 remains unknown. Canonical Mode I or Mode II 14-3-3 recognition motifs often mediate 14-3-3 protein interaction with the client protein (Camoni et al., 2018). None of the four FBS proteins contains either of these motifs. The absence of canonical recognition motifs suggests that FBS interactions with 14-3-3 proteins may involve noncanonical phosphorylation-dependent binding sites or an alternative mode of interaction. Sequence analysis using 14-3-3-Pred, software that predicts 14-3-3-binding phosphopeptides (Madeira et al., 2015), identified several Ser/Thr residues in FBS1, FBS2, and FBS4 with scores above the consensus prediction threshold, despite their occurrence outside canonical recognition motifs. These residues therefore represent candidate phosphorylation sites for future studies testing the effects of amino acid substitutions on 14-3-3 binding.
The purpose of FBS interaction with 14-3-3 proteins is currently unknown. One possibility is that these interactions regulate FBS distribution within the cell, as some 14-3-3 protein interactions control the subcellular localization of client proteins. A more in-depth investigation of FBS localization, whether bound to 14-3-3 proteins or not, may clarify whether cellular distribution plays a role in restricting FBS activities. The roles of 14-3-3 proteins in regulating FBS localization could then be tested through genetic reduction of 14-3-3 activity in Arabidopsis mutants or through chemical inhibition using AICAR (Toroser et al., 1998). Alternatively, interactions between FBS and 14-3-3 proteins may have important implications for SCF complex assembly and substrate specificity. SCF complex dimerization can enhance substrate recognition capabilities and/or diversify target range (Tang et al., 2007; Welcker et al., 2013), and facilitating FBX dimerization is a role of some 14-3-3 proteins (Barbash et al., 2011). Considering FBX protein homo- and hetero-dimerization (Kominami et al., 1998), having four Arabidopsis FBS family members raises the possibility that combinatorial dimerization could expand target range as the number of verified SCFFBS targets continues to grow. The differential localization observed here raises the possibility that 14-3-3-mediated, compartment-specific FBS dimerization could contribute to distinct functions among FBS family members. Future work could therefore assess the effects of 14-3-3 proteins on SCFFBS target selection and ubiquitylation activity in both in vitro and in vivo systems.
Determining whether 14-3-3 proteins regulate FBS localization or enable SCFFBS substrate recognition may lead to a deeper mechanistic understanding of how plant stress responses are controlled. Several 14-3-3 proteins that interact with FBS proteins regulate abiotic stress signaling (Catala et al., 2014; Tan et al., 2016; van Kleeff et al., 2014). Likewise, both FBS1 and the rice homolog FBX257 are functionally connected to plant abiotic stress responses, either through transcriptional effects or mutant phenotypes (Geem et al., 2022; Gonzalez et al., 2017; Maldonado-Calderon et al., 2012; Sharma et al., 2023). Future work investigating how FBS and 14-3-3 proteins function together should therefore include conditions that specifically address environmental stress. Collectively, this work expands understanding of FBS/14-3-3 family-wide interactions and suggests future studies examining their mechanistic roles in environmental stress signaling.
","references":[{"reference":"Barbash O, Lee EK, Diehl JA. 2011. Phosphorylation-dependent regulation of SCFFbx4 dimerization and activity involves a novel component, 14-3-3ɛ. Oncogene 30: 1995-2002.
","pubmedId":"","doi":"10.1038/onc.2010.584"},{"reference":"Camoni L, Visconti S, Aducci P, Marra M. 2018. 14-3-3 Proteins in Plant Hormone Signaling: Doing Several Things at Once. Frontiers in Plant Science 9: 10.3389/fpls.2018.00297.
","pubmedId":"","doi":"10.3389/fpls.2018.00297"},{"reference":"Catalá R, López-Cobollo R, Mar Castellano M, Angosto T, Alonso JM, Ecker JR, Salinas J. 2014. TheArabidopsis14-3-3 Protein RARE COLD INDUCIBLE 1A Links Low-Temperature Response and Ethylene Biosynthesis to Regulate Freezing Tolerance and Cold Acclimation . The Plant Cell 26: 3326-3342.
","pubmedId":"","doi":"doi.org/10.1105/tpc.114.127605"},{"reference":"Gagne JM, Downes BP, Shiu SH, Durski AM, Vierstra RD. 2002. The F-box subunit of the SCF E3 complex is encoded by a diverse superfamily of genes in\n Arabidopsis. Proceedings of the National Academy of Sciences 99: 11519-11524.
","pubmedId":"","doi":"doi.org/10.1073/pnas.162339999"},{"reference":"Gampala SS, Kim TW, He JX, Tang W, Deng Z, Bai MY, et al., Wang. 2007. An Essential Role for 14-3-3 Proteins in Brassinosteroid Signal Transduction in Arabidopsis. Developmental Cell 13: 177-189.
","pubmedId":"","doi":"doi.org/10.1016/j.devcel.2007.06.009"},{"reference":"Geem KR, Kim H, Ryu H. 2022. SCFFBS1 Regulates Root Quiescent Center Cell Division via Protein Degradation of APC/CCCS52A2. Molecules and Cells 45: 695-701.
","pubmedId":"","doi":"doi.org/10.14348/molcells.2022.0074"},{"reference":"Gonzalez LE, Keller K, Chan KX, Gessel MM, Thines BC. 2017. Transcriptome analysis uncovers Arabidopsis F-BOX STRESS INDUCED 1 as a regulator of jasmonic acid and abscisic acid stress gene expression. BMC Genomics 18: 10.1186/s12864-017-3864-6.
","pubmedId":"","doi":"doi.org/10.1186/s12864-017-3864-6"},{"reference":"Hong JP, Adams E, Yanagawa Y, Matsui M, Shin R. 2017. AtSKIP18 and AtSKIP31, F-box subunits of the SCF E3 ubiquitin ligase complex, mediate the degradation of 14-3-3 proteins in Arabidopsis. Biochemical and Biophysical Research Communications 485: 174-180.
","pubmedId":"","doi":"doi.org/10.1016/j.bbrc.2017.02.046"},{"reference":"Huang X, Zhang Q, Jiang Y, Yang C, Wang Q, Li L. 2018. Shade-induced nuclear localization of PIF7 is regulated by phosphorylation and 14-3-3 proteins in Arabidopsis. eLife 7: 10.7554/elife.31636.
","pubmedId":"","doi":"doi.org/10.7554/eLife.31636"},{"reference":"Kominami Ki, Ochotorena I, Toda T. 1998. Two F‐box/WD‐repeat proteins Pop1 and Pop2 form hetero‐ and homo‐complexes together with cullin‐1 in the fission yeast SCF (Skp1‐Cullin‐1‐F‐box) ubiquitin ligase. Genes to Cells 3: 721-735.
","pubmedId":"","doi":"doi.org/10.1046/j.1365-2443.1998.00225.x"},{"reference":"Kudla Jr, Bock R. 2016. Lighting the Way to Protein-Protein Interactions: Recommendations on Best Practices for Bimolecular Fluorescence Complementation Analyses. The Plant Cell 28: 1002-1008.
","pubmedId":"","doi":"doi.org/10.1105/tpc.16.00043"},{"reference":"Lee CM, Feke A, Li MW, Adamchek C, Webb K, Pruneda-Paz J, et al., Gendron. 2018. Decoys Untangle Complicated Redundancy and Reveal Targets of Circadian Clock F-Box Proteins. Plant Physiology 177: 1170-1186.
","pubmedId":"","doi":"doi.org/10.1104/pp.18.00331"},{"reference":"Leuzinger K, Dent M, Hurtado J, Stahnke J, Lai H, Zhou X, Chen Q. 2013. Efficient Agroinfiltration of Plants for High-level Transient Expression of Recombinant Proteins. Journal of Visualized Experiments : 10.3791/50521.
","pubmedId":"","doi":"doi.org/10.3791/50521"},{"reference":"Li Y, Xue S, He Q, Wang J, Zhu L, Zou J, et al., Le. 2022. Arabidopsis F‐BOX STRESS INDUCED 4 is required to repress excessive divisions in stomatal development. Journal of Integrative Plant Biology 64: 56-72.
","pubmedId":"","doi":"doi.org/10.1111/jipb.13193"},{"reference":"Madeira Fb, Tinti M, Murugesan G, Berrett E, Stafford M, Toth R, et al., Barton. 2015. 14-3-3-Pred: improved methods to predict 14-3-3-binding phosphopeptides. Bioinformatics 31: 2276-2283.
","pubmedId":"","doi":"10.1093/bioinformatics/btv133"},{"reference":"Maldonado-Calderón MaT, Sepúlveda-García E, Rocha-Sosa M. 2012. Characterization of novel F-box proteins in plants induced by biotic and abiotic stress. Plant Science 185-186: 208-217.
","pubmedId":"","doi":"doi.org/10.1016/j.plantsci.2011.10.013"},{"reference":"Sepulveda-Garcia E, Fulton EC, Parlan EV, O’Connor LE, Fleming AA, Replogle AJ, et al., Thines. 2021. Unique N-Terminal Interactions Connect F-BOX STRESS INDUCED (FBS) Proteins to a WD40 Repeat-like Protein Pathway in Arabidopsis. Plants 10: 2228.
","pubmedId":"","doi":"doi.org/10.3390/plants10102228"},{"reference":"Sepúlveda-García E, Rocha-Sosa M. 2012. The Arabidopsis F-box protein AtFBS1 interacts with 14-3-3 proteins. Plant Science 195: 36-47.
","pubmedId":"","doi":"doi.org/10.1016/j.plantsci.2012.06.009"},{"reference":"Sharma E, Bhatnagar A, Bhaskar A, Majee SM, Kieffer M, Kepinski S, Khurana P, Khurana JP. 2022. Stress‐induced F‐Box protein‐coding geneOsFBX257modulates drought stress adaptations and ABA responses in rice. Plant, Cell & Environment 46: 1207-1231.
","pubmedId":"","doi":"doi.org/10.1111/pce.14496"},{"reference":"Sheard LB, Tan X, Mao H, Withers J, Ben-Nissan G, Hinds TR, et al., Zheng. 2010. Jasmonate perception by inositol-phosphate-potentiated COI1–JAZ co-receptor. Nature 468: 400-405.
","pubmedId":"","doi":"doi.org/10.1038/nature09430"},{"reference":"Tan T, Cai J, Zhan E, Yang Y, Zhao J, Guo Y, Zhou H. 2016. Stability and localization of 14-3-3 proteins are involved in salt tolerance in Arabidopsis. Plant Molecular Biology 92: 391-400.
","pubmedId":"","doi":"doi.org/10.1007/s11103-016-0520-5"},{"reference":"Tang X, Orlicky S, Lin Z, Willems A, Neculai D, Ceccarelli D, et al., Tyers. 2007. Suprafacial Orientation of the SCFCdc4 Dimer Accommodates Multiple Geometries for Substrate Ubiquitination. Cell 129: 1165-1176.
","pubmedId":"","doi":"doi.org/10.1016/j.cell.2007.04.042"},{"reference":"van Kleeff PJ, Jaspert N, Li KW, Rauch S, Oecking C, de Boer AH. 2014. Higher order Arabidopsis 14-3-3 mutants show 14-3-3 involvement in primary root growth both under control and abiotic stress conditions. J Exp Bot 65(20): 5877-88.
","pubmedId":"25189593","doi":""},{"reference":"Varshney V, Potuschak T, Yan S, Noir S, Genschik P. 2026. Hundreds of plant F-box proteins in search of function. J Exp Bot: pii: erag074. 10.1093/jxb/erag074.
","pubmedId":"41678363","doi":""},{"reference":"Welcker M, Larimore EA, Swanger J, Bengoechea-Alonso MT, Grim JE, Ericsson J, Zheng N, Clurman BE. 2013. Fbw7 dimerization determines the specificity and robustness of substrate degradation. Genes & Development 27: 2531-2536.
","pubmedId":"","doi":"doi.org/10.1101/gad.229195.113"},{"reference":"Wilson RS, Swatek KN, Thelen JJ. 2016. Regulation of the Regulators: Post-Translational Modifications, Subcellular, and Spatiotemporal Distribution of Plant 14-3-3 Proteins. Frontiers in Plant Science 7: 10.3389/fpls.2016.00611.
","pubmedId":"","doi":"doi.org/10.3389/fpls.2016.00611"},{"reference":"Zhang C, Yue J, Li S, Zuo C, Li Y, He Q, Le J. 2025. The Arabidopsis F-box protein FBS associated with the helix-loop-helix transcription factor FAMA involved in stomatal immunity. Plant Molecular Biology 115: 10.1007/s11103-025-01577-7.
","pubmedId":"","doi":"doi.org/10.1007/s11103-025-01577-7"},{"reference":"Zhu D, Maier A, Lee JH, Laubinger S, Saijo Y, Wang H, et al., Deng. 2008. Biochemical Characterization ofArabidopsisComplexes Containing CONSTITUTIVELY PHOTOMORPHOGENIC1 and SUPPRESSOR OF PHYA Proteins in Light Control of Plant Development. The Plant Cell 20: 2307-2323.
","pubmedId":"","doi":"doi.org/10.1105/tpc.107.056580"}],"title":"Arabidopsis F-BOX STRESS INDUCED (FBS) proteins have distinct subcellular interaction patterns with 14-3-3 proteins
","reviews":[],"curatorReviews":[]},{"id":"aa406d67-4281-40d7-8b78-3cd1a8671ccf","decision":"publish","abstract":"F-BOX STRESS INDUCED (FBS) proteins are substrate adaptors in SCF-type E3 ubiquitin ligases that regulate plant development and stress responses. Arabidopsis thaliana FBS1 (AT1G61340) interacts with multiple 14-3-3 proteins, but it is unknown whether other FBS family members share these interactions. Bimolecular fluorescence complementation (BiFC) assays in Nicotiana benthamiana showed that all four FBS proteins interact with multiple 14-3-3 proteins in vivo. However, FBS1 interactions were restricted to the nucleus, whereas FBS2 – FBS4 (AT4G21510, AT4G05010, AT4G35930) interactions were detected in both the nucleus and cytosol. These findings indicate conserved 14-3-3 interactions within the FBS family, but suggest functional divergence in subcellular interaction profiles.
","acknowledgements":"We thank Michal Morrison-Kerr for storeroom support, David Somers for providing H2B-RFP, and Xing Wang Deng for providing pCL112 and pCL113 vectors, as well as the SPA1 constructs.
","authors":[{"affiliations":["University of Puget Sound, Tacoma, WA"],"departments":[""],"credit":["conceptualization","investigation","formalAnalysis","methodology"],"email":"maelbradley24@gmail.com","firstName":"Mael","lastName":"Bradley","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of California, Berkeley, CA","University of Puget Sound, Tacoma, WA"],"departments":["",""],"credit":["conceptualization","formalAnalysis","investigation","methodology"],"email":"mbacher@berkeley.edu","firstName":"Meghan","lastName":"Bacher","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Washington State University, Pullman, WA","University of Puget Sound, Tacoma, WA"],"departments":["",""],"credit":["formalAnalysis","investigation"],"email":"kaitlin.riggan@wsu.edu","firstName":"Kaitlin","lastName":"Riggan","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Puget Sound, Tacoma, WA"],"departments":[""],"credit":["formalAnalysis","investigation"],"email":"nicolo.spalding@gmail.com","firstName":"Nicolo","lastName":"Torresan","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Puget Sound, Tacoma, WA"],"departments":[""],"credit":["formalAnalysis","investigation"],"email":"mtegman@pugetsound.edu","firstName":"Megan","lastName":"Tegman","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Rhode Island, Kingston, RI","University of Puget Sound, Tacoma, WA"],"departments":["",""],"credit":["formalAnalysis","investigation"],"email":"sabine.angier@uri.edu","firstName":"Sabine","lastName":"Angier","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Puget Sound, Tacoma, WA"],"departments":[""],"credit":["investigation","methodology"],"email":"areplogle@pugetsound.edu","firstName":"Amy","lastName":"Replogle","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["University of Puget Sound, Tacoma, WA"],"departments":[""],"credit":["fundingAcquisition","conceptualization","dataCuration","writing_originalDraft","writing_reviewEditing"],"email":"bthines@pugetsound.edu","firstName":"Bryan","lastName":"Thines","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":null}],"awards":[{"awardId":"grant #2035582 ","funderName":"National Science Foundation (United States)","awardRecipient":"Bryan Thines"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"Arabidopsis FBS proteins co-expressed with SPA1 in bimolecular fluorescence complementation (BiFC) assays
","doi":"10.22002/mpexm-85m05","resourceType":"Image","name":"14-3-3 SPA1.jpg","url":"https://portal.micropublication.org/uploads/f03335643586839492e3cafcb273b949.jpg"}],"funding":"","image":{"url":"https://portal.micropublication.org/uploads/c613a85570a319a1c98e932c8ffad4a7.jpg"},"imageCaption":"(A – D) nYFP-FBS1 through nYFP-FBS4 were co-expressed with cYFP-14-3-3 ω and H2B-RFP in four-week-old N. benthamiana leaves. Cell walls were stained with 50 μM propidium iodide (PI), and images were taken three days after agroinfiltration. BiFC (green; first column) indicates protein interaction, while H2B-RFP and PI staining (red; second column) show nuclei and cell walls, respectively. Merged images (third column) show co-localization of BiFC signal with nuclei. (E) nYFP-PP2-A12 was co-expressed with cYFP-14-3-3 ω and H2B-RFP as a negative control. (F – J) The same nYFP fusion constructs and H2B-RFP were co-expressed with cYFP-14-3-3 ψ under identical conditions. (K – N) nYFP-FBS constructs were co-expressed with cYFP-SPA1; the BiFC channel is shown (all channels are shown in Extended Data). Scale bar = 100 μm. (O) Average number of nuclei exhibiting BiFC signal per field of view (FOV) for nYFP-FBS family members co-expressed with cYFP-14-3-3 ω, and (P) co-expressed with cYFP-14-3-3 ψ. Error bars represent SE (n = 3 independent experimental replicates). Statistical significance was assessed using one-way ANOVA followed by Tukey’s HSD post-hoc tests. Means with different letters are significantly different from each other at P < 0.05.
","imageTitle":"Arabidopsis FBS interactions with 14-3-3 proteins in bimolecular fluorescence complementation (BiFC) assays
","methods":"Plasmid construction
Standard molecular biology cloning protocols were used to generate Gateway-compatible constructs (Thermo Fisher Scientific). FBS and 14-3-3 coding sequences were amplified from cDNA by PCR with gene-specific primers (Table 1) using Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific). Amplicons were cloned into the pENTR entry vector with the pENTR/D-TOPO directional cloning kit (Thermo Fisher Scientific). Genes were then transferred into either pCL112 (creates N-terminal fusion to nYFP) or pCL113 (creates N-terminal fusion to cYFP) with LR Clonase II enzyme mix (Thermo Fisher Scientific). Sequences were verified by Sanger sequencing (Eurofins Genomics).
Agroinfiltration of Nicotiana benthamiana leaves
Agrobacterium tumefaciens strain GV3101 pMP90 was transformed by electroporation and selected by appropriate antibiotics. Seed cultures were grown in liquid LB for 2 days with shaking at 28 oC. Full cultures were inoculated with seed culture at a 1:100 dilution and grown for 24 hours under the same conditions. Cells were pelleted and resuspended in infiltration medium (10 mM MES, 10 mM MgCl2, 100 μM acetosyringone) and incubated for 5 hours with rocking at room temperature. Cells were pelleted a second time and resuspended in infiltration medium. Appropriate nYFP/cYFP pairs, H2B-RFP, and p19 suppressor strains were mixed at a final OD600 of 1.0 for each strain. The abaxial side of Nicotiana benthamiana leaves from 4-week-old plants grown under greenhouse conditions was infiltrated by syringe with the A. tumefaciens mixes using standard protocols (Leuzinger et al., 2013).
Imaging
Three days after infiltration, N. benthamiana leaves to be imaged were infiltrated with 50 μM propidium iodide in 0.1% Tween-20 and allowed to sit for 10 minutes. Approximately 1 cm2 from infiltrated leaves was then cut and mounted on a glass slide with 0.1% Tween-20. The underside of whole leaf mounts was visualized by laser-scanning confocal microscopy using a Nikon D-Eclipse C1 Confocal laser scanning microscope (Nikon Instruments) with either: 1) excitation at 488 nm with an emission band-pass filter of 515/30, or 2) excitation at 561 nm with an emission band pass filter of 650 LP. Images were processed with Fiji software (http://imagej.net/software/fiji/). Representative images from at least three independent experimental replicates are shown.
Data analysis
Nuclei containing a BiFC fluorescence signal were counted under a 20x objective lens in two separate areas of each leaf, which were then averaged, from three independent experimental trials. The field of view (FOV) diameter was 1100 µm. Statistical analyses were performed in RStudio version 4.0.4 using a one-way ANOVA and Tukey’s HSD post-hoc test.
","reagents":"
|
| Primer sequences 5' to 3' | |
Gene | AGI number | Forward | Reverse |
FBS1 | At1g61340 | CACCATGGCATTGGGGAAGAAAAGAATCG | TCAGTGGAATAGAGCCACTGAGAC |
FBS2 | At4g21510 | CACCATGATCCATTATCTCCATTTCA | TCATGTAAACAAAGCCGCAG |
FBS3 | At4g05010 | CACCATGGCGTATTTGAGTGATG | TCATTTAAACAATACCATAGAGATCTTCGACAAATC |
FBS4 | At4g35930 | CACCATGGGGAAGGTATCTCCAAAG | TCAGGTGAGGTTGTTTTGAGC |
PP2-A12 | At1g12710 | CACCATGGGTGTGGCTCACTCTGAT | TTAAAACCGCTTCAACTGGTC |
14-3-3 omega | At1g78300 | CACCATGGCGTCTGGGCGTGAAG | TCACTGCTGTTCCTCGGTCG |
14-3-3 psi | At5g38480 | CACCATGTCGACAAGGGAAGAGAATGT | TTACTCGGCACCATCGGG |
Numerous cellular pathways in eukaryotes are regulated through selective protein degradation by the ubiquitin 26S proteasome system (UPS). SKP1-CUL1-F-box (SCF) complexes are a prevalent type of E3 ubiquitin ligase in the UPS that use F-box (FBX) proteins as substrate adaptors to specifically recruit ubiquitination targets (Lee et al., 2018; Sheard et al., 2010; Varshney et al., 2026). Four Arabidopsis thaliana F-BOX STRESS INDUCED proteins (FBS1 – FBS4) compose a subfamily of plant-specific FBX proteins (Maldonado-Calderon et al., 2012). FBS1 and FBS4 target anaphase-promoting complex/cyclosome (APC/C)-associated regulatory proteins to control cell division events and related processes, including maintenance of the root quiescent center (QC) and cell fate determination during stomatal development (Geem et al., 2022; Li et al., 2022; Zhang et al., 2025). FBS proteins also likely target two other nuclear-localized WD40 repeat-like family proteins of unknown function (Sepulveda-Garcia et al., 2021).
In addition to its targeting interactions, FBS1 interacts with at least six of thirteen proteins belonging to the Arabidopsis 14-3-3 family in yeast two-hybrid and in vitro pull-down assays (Sepulveda-Garcia & Rocha-Sosa, 2012). 14-3-3 proteins are eukaryotic regulators that specifically interact with their client proteins to alter their activity (Wilson et al., 2016). While some 14-3-3 proteins are SCF targets in plants (Hong et al., 2017), FBS1 does not seem to target 14-3-3 proteins for degradation, as increased FBS1 abundance does not lead to a decrease in the level of FBS interactor 14-3-3 λ (AT5G10450) (Sepulveda-Garcia et al., 2021; Sepulveda-Garcia & Rocha-Sosa, 2012). Furthermore, 14-3-3 proteins interact with FBS1 via the F-box domain (Sepulveda-Garcia & Rocha-Sosa, 2012), which is required for FBX protein interaction with Skp and the core SCF complex. The regulatory purpose and biological consequence of FBS1 interaction with 14-3-3 proteins are currently unknown.
Members of FBX protein subfamilies often have some functional redundancy while still maintaining distinct biological roles (Lee et al., 2018). FBS1 – FBS4 likely have distinct biological functions relative to each other based on their expression profiles and mutant phenotypes (Geem et al., 2022; Li et al., 2022; Maldonado-Calderon et al., 2012). However, it is unknown whether FBS2 – FBS4 also interact with 14-3-3 proteins and whether they might experience similar regulatory mechanisms to FBS1. Moreover, while FBS proteins interact with at least some of their targets in the nucleus (Li et al., 2022; Sepulveda-Garcia et al., 2021), the subcellular locations of FBS interactions with 14-3-3 proteins are unknown. Having this interaction information could offer clues as to how 14-3-3 proteins work with FBS proteins within the regulatory network associated with the APC/C to influence plant growth and development. We therefore tested all four Arabidopsis FBS proteins for interaction with multiple Arabidopsis 14-3-3 proteins in living plants using bimolecular fluorescence complementation (BiFC) assays.
Among the four members of the FBS protein family, distinct interaction profiles with 14-3-3 proteins were observed. FBS1 interactions with 14-3-3 ω (AT1G78300) and 14-3-3 ψ (AT5G38480) were restricted to the nucleus under the conditions tested, as shown by colocalization of the BiFC signal with nuclear-localized fusion protein H2B-RFP (Figure 1 A and F). In contrast, FBS2 – FBS4 had fewer interactions with these 14-3-3 proteins in the nucleus, but they interacted in the cytosol (Figure 1 B – D and G – I). The frequencies of nuclear interactions between FBS2 – FBS4 and 14-3-3 proteins ω or ψ were less than 25% of those found for FBS1 interactions in a field of view (Figure 1 O and P). Because the F-box domain is required for FBS1 interaction with 14-3-3 proteins (Sepulveda-Garcia & Rocha-Sosa, 2012), we tested the phylogenetically related FBX protein PP2-A12 (AT1G12710), one of the two closest non-FBS FBX family members based on F-box domain sequence analysis (Gagne et al., 2002). In contrast to the FBS proteins, no BiFC signal was detected when PP2-A12 was co-expressed with either of the 14-3-3 proteins under the conditions tested (Figure 1 E and J). As an additional negative control for nonspecific interactions, FBS proteins were tested with the unrelated nuclear-localized protein SPA1 (AT2G46340) (Zhu et al., 2008), and no detectable BiFC signal was observed for any of the four FBS proteins (Figure 1 K – N, see also Extended Data). Collectively, these findings show distinct subcellular patterns of FBS/14-3-3 interactions in vivo, while the negative control results are consistent with specificity of the observed BiFC interactions.
FBS proteins have numerous protein interactors, some of which are ubiquitylation targets, while others may regulate FBX protein function and the ubiquitylation process. This work found that all four FBS proteins interacted with 14-3-3 proteins in living plant cells, indicating that 14-3-3 interaction is conserved within the FBS family. However, FBS1 showed the highest frequency of nuclear interactions with the 14-3-3 proteins under the conditions tested here, suggesting potential functional divergence or distinct contributions among family members. Although the negative controls are consistent with specificity of the observed FBS/14-3-3 interactions, PP2-A12 and SPA1 protein accumulation was not independently verified and alternative orientations of the YFP fragments were not tested. Thus, differences in protein abundance or steric constraints could contribute to the absence of BiFC signal with PP2-A12 or SPA1, and these results should not be interpreted as definitive evidence for lack of interaction. Moreover, BiFC can stabilize transient protein interactions (Kudla & Bock, 2016), and therefore these findings may not fully reflect endogenous interaction dynamics. Nevertheless, the absence of detectable BiFC signal between FBS proteins and SPA1 or between 14-3-3 proteins and PP2-A12, together with the distinct subcellular interaction patterns observed among FBS family members and previous yeast two-hybrid and in vitro pull-down evidence for FBS1/14-3-3 interactions (Sepúlveda-García & Rocha-Sosa, 2012), provides support for the specificity of the observed FBS/14-3-3 interactions.
The N-terminal region and F-box domain of FBS1 have previously been implicated in 14-3-3 binding (Sepulveda-Garcia & Rocha-Sosa, 2012), but whether these regions similarly mediate 14-3-3 interactions with FBS2 – FBS4 remains unknown. Canonical Mode I or Mode II 14-3-3 recognition motifs often mediate 14-3-3 protein interaction with the client protein (Camoni et al., 2018). None of the four FBS proteins contains either of these motifs. The absence of canonical recognition motifs suggests that FBS interactions with 14-3-3 proteins may involve noncanonical phosphorylation-dependent binding sites or an alternative mode of interaction. Sequence analysis using 14-3-3-Pred, software that predicts 14-3-3-binding phosphopeptides (Madeira et al., 2015), identified several Ser/Thr residues in FBS1, FBS2, and FBS4 with scores above the consensus prediction threshold, despite their occurrence outside canonical recognition motifs. These residues therefore represent candidate phosphorylation sites for future studies testing the effects of amino acid substitutions on 14-3-3 binding.
The purpose of FBS interaction with 14-3-3 proteins is currently unknown. One possibility is that these interactions regulate FBS distribution within the cell, as some 14-3-3 protein interactions control the subcellular localization of client proteins (Gampala et al., 2007; Huang et al., 2018). A more in-depth investigation of FBS localization, whether bound to 14-3-3 proteins or not, may clarify whether cellular distribution plays a role in restricting FBS activities. The roles of 14-3-3 proteins in regulating FBS localization could then be tested through genetic reduction of 14-3-3 activity in Arabidopsis mutants or through chemical inhibition using AICAR (Toroser et al., 1998). Alternatively, interactions between FBS and 14-3-3 proteins may have important implications for SCF complex assembly and substrate specificity. SCF complex dimerization can enhance substrate recognition capabilities and/or diversify target range (Tang et al., 2007; Welcker et al., 2013), and facilitating FBX dimerization is a role of some 14-3-3 proteins (Barbash et al., 2011). Considering FBX protein homo- and hetero-dimerization (Kominami et al., 1998), having four Arabidopsis FBS family members raises the possibility that combinatorial dimerization could expand target range as the number of verified SCFFBS targets continues to grow. The differential localization observed here raises the possibility that 14-3-3-mediated, compartment-specific FBS dimerization could contribute to distinct functions among FBS family members. Future work could therefore assess the effects of 14-3-3 proteins on SCFFBS target selection and ubiquitylation activity in both in vitro and in vivo systems.
Determining whether 14-3-3 proteins regulate FBS localization or enable SCFFBS substrate recognition may lead to a deeper mechanistic understanding of how plant stress responses are controlled. Several 14-3-3 proteins that interact with FBS proteins regulate abiotic stress signaling (Catala et al., 2014; Tan et al., 2016; van Kleeff et al., 2014). Likewise, both FBS1 and the rice homolog FBX257 are functionally connected to plant abiotic stress responses, either through transcriptional effects or mutant phenotypes (Geem et al., 2022; Gonzalez et al., 2017; Maldonado-Calderon et al., 2012; Sharma et al., 2023). Future work investigating how FBS and 14-3-3 proteins function together should therefore include conditions that specifically address environmental stress. Collectively, this work expands understanding of FBS/14-3-3 family-wide interactions and suggests future studies examining their mechanistic roles in environmental stress signaling.
","references":[{"reference":"Barbash O, Lee EK, Diehl JA. 2011. Phosphorylation-dependent regulation of SCFFbx4 dimerization and activity involves a novel component, 14-3-3ɛ. Oncogene 30: 1995-2002.
","pubmedId":"","doi":"10.1038/onc.2010.584"},{"reference":"Camoni L, Visconti S, Aducci P, Marra M. 2018. 14-3-3 Proteins in Plant Hormone Signaling: Doing Several Things at Once. Frontiers in Plant Science 9: 10.3389/fpls.2018.00297.
","pubmedId":"","doi":"10.3389/fpls.2018.00297"},{"reference":"Catalá R, López-Cobollo R, Mar Castellano M, Angosto T, Alonso JM, Ecker JR, Salinas J. 2014. The Arabidopsis 14-3-3 Protein RARE COLD INDUCIBLE 1A Links Low-Temperature Response and Ethylene Biosynthesis to Regulate Freezing Tolerance and Cold Acclimation. The Plant Cell 26: 3326-3342.
","pubmedId":"","doi":"doi.org/10.1105/tpc.114.127605"},{"reference":"Gagne JM, Downes BP, Shiu SH, Durski AM, Vierstra RD. 2002. The F-box subunit of the SCF E3 complex is encoded by a diverse superfamily of genes in\n Arabidopsis. Proceedings of the National Academy of Sciences 99: 11519-11524.
","pubmedId":"","doi":"doi.org/10.1073/pnas.162339999"},{"reference":"Gampala SS, Kim TW, He JX, Tang W, Deng Z, Bai MY, et al., Wang. 2007. An Essential Role for 14-3-3 Proteins in Brassinosteroid Signal Transduction in Arabidopsis. Developmental Cell 13: 177-189.
","pubmedId":"","doi":"doi.org/10.1016/j.devcel.2007.06.009"},{"reference":"Geem KR, Kim H, Ryu H. 2022. SCFFBS1 Regulates Root Quiescent Center Cell Division via Protein Degradation of APC/CCCS52A2. Molecules and Cells 45: 695-701.
","pubmedId":"","doi":"doi.org/10.14348/molcells.2022.0074"},{"reference":"Gonzalez LE, Keller K, Chan KX, Gessel MM, Thines BC. 2017. Transcriptome analysis uncovers Arabidopsis F-BOX STRESS INDUCED 1 as a regulator of jasmonic acid and abscisic acid stress gene expression. BMC Genomics 18: 10.1186/s12864-017-3864-6.
","pubmedId":"","doi":"doi.org/10.1186/s12864-017-3864-6"},{"reference":"Hong JP, Adams E, Yanagawa Y, Matsui M, Shin R. 2017. AtSKIP18 and AtSKIP31, F-box subunits of the SCF E3 ubiquitin ligase complex, mediate the degradation of 14-3-3 proteins in Arabidopsis. Biochemical and Biophysical Research Communications 485: 174-180.
","pubmedId":"","doi":"doi.org/10.1016/j.bbrc.2017.02.046"},{"reference":"Huang X, Zhang Q, Jiang Y, Yang C, Wang Q, Li L. 2018. Shade-induced nuclear localization of PIF7 is regulated by phosphorylation and 14-3-3 proteins in Arabidopsis. eLife 7: 10.7554/elife.31636.
","pubmedId":"","doi":"doi.org/10.7554/eLife.31636"},{"reference":"Kominami Ki, Ochotorena I, Toda T. 1998. Two F‐box/WD‐repeat proteins Pop1 and Pop2 form hetero‐ and homo‐complexes together with cullin‐1 in the fission yeast SCF (Skp1‐Cullin‐1‐F‐box) ubiquitin ligase. Genes to Cells 3: 721-735.
","pubmedId":"","doi":"doi.org/10.1046/j.1365-2443.1998.00225.x"},{"reference":"Kudla Jr, Bock R. 2016. Lighting the Way to Protein-Protein Interactions: Recommendations on Best Practices for Bimolecular Fluorescence Complementation Analyses. The Plant Cell 28: 1002-1008.
","pubmedId":"","doi":"doi.org/10.1105/tpc.16.00043"},{"reference":"Lee CM, Feke A, Li MW, Adamchek C, Webb K, Pruneda-Paz J, et al., Gendron. 2018. Decoys Untangle Complicated Redundancy and Reveal Targets of Circadian Clock F-Box Proteins. Plant Physiology 177: 1170-1186.
","pubmedId":"","doi":"doi.org/10.1104/pp.18.00331"},{"reference":"Leuzinger K, Dent M, Hurtado J, Stahnke J, Lai H, Zhou X, Chen Q. 2013. Efficient Agroinfiltration of Plants for High-level Transient Expression of Recombinant Proteins. Journal of Visualized Experiments : 10.3791/50521.
","pubmedId":"","doi":"doi.org/10.3791/50521"},{"reference":"Li Y, Xue S, He Q, Wang J, Zhu L, Zou J, et al., Le. 2022. Arabidopsis F‐BOX STRESS INDUCED 4 is required to repress excessive divisions in stomatal development. Journal of Integrative Plant Biology 64: 56-72.
","pubmedId":"","doi":"doi.org/10.1111/jipb.13193"},{"reference":"Madeira Fb, Tinti M, Murugesan G, Berrett E, Stafford M, Toth R, et al., Barton. 2015. 14-3-3-Pred: improved methods to predict 14-3-3-binding phosphopeptides. Bioinformatics 31: 2276-2283.
","pubmedId":"","doi":"10.1093/bioinformatics/btv133"},{"reference":"Maldonado-Calderón MaT, Sepúlveda-García E, Rocha-Sosa M. 2012. Characterization of novel F-box proteins in plants induced by biotic and abiotic stress. Plant Science 185-186: 208-217.
","pubmedId":"","doi":"doi.org/10.1016/j.plantsci.2011.10.013"},{"reference":"Sepulveda-Garcia E, Fulton EC, Parlan EV, O’Connor LE, Fleming AA, Replogle AJ, et al., Thines. 2021. Unique N-Terminal Interactions Connect F-BOX STRESS INDUCED (FBS) Proteins to a WD40 Repeat-like Protein Pathway in Arabidopsis. Plants 10: 2228.
","pubmedId":"","doi":"doi.org/10.3390/plants10102228"},{"reference":"Sepúlveda-García E, Rocha-Sosa M. 2012. The Arabidopsis F-box protein AtFBS1 interacts with 14-3-3 proteins. Plant Science 195: 36-47.
","pubmedId":"","doi":"doi.org/10.1016/j.plantsci.2012.06.009"},{"reference":"Sharma E, Bhatnagar A, Bhaskar A, Majee SM, Kieffer M, Kepinski S, Khurana P, Khurana JP. 2023. Stress‐induced F‐Box protein‐coding gene OsFBX257 modulates drought stress adaptations and ABA responses in rice. Plant, Cell & Environment 46: 1207-1231.
","pubmedId":"","doi":"doi.org/10.1111/pce.14496"},{"reference":"Sheard LB, Tan X, Mao H, Withers J, Ben-Nissan G, Hinds TR, et al., Zheng. 2010. Jasmonate perception by inositol-phosphate-potentiated COI1–JAZ co-receptor. Nature 468: 400-405.
","pubmedId":"","doi":"doi.org/10.1038/nature09430"},{"reference":"Tan T, Cai J, Zhan E, Yang Y, Zhao J, Guo Y, Zhou H. 2016. Stability and localization of 14-3-3 proteins are involved in salt tolerance in Arabidopsis. Plant Molecular Biology 92: 391-400.
","pubmedId":"","doi":"doi.org/10.1007/s11103-016-0520-5"},{"reference":"Tang X, Orlicky S, Lin Z, Willems A, Neculai D, Ceccarelli D, et al., Tyers. 2007. Suprafacial Orientation of the SCFCdc4 Dimer Accommodates Multiple Geometries for Substrate Ubiquitination. Cell 129: 1165-1176.
","pubmedId":"","doi":"doi.org/10.1016/j.cell.2007.04.042"},{"reference":"Toroser D, Athwal GS, Huber SC. 1998. Site-specific regulatory interaction between spinach leaf sucrose-phosphate synthase and 14-3-3 proteins. FEBS Lett 435(1): 110-4.
","pubmedId":"9755869","doi":""},{"reference":"van Kleeff PJ, Jaspert N, Li KW, Rauch S, Oecking C, de Boer AH. 2014. Higher order Arabidopsis 14-3-3 mutants show 14-3-3 involvement in primary root growth both under control and abiotic stress conditions. J Exp Bot 65(20): 5877-88.
","pubmedId":"25189593","doi":""},{"reference":"Varshney V, Potuschak T, Yan S, Noir S, Genschik P. 2026. Hundreds of plant F-box proteins in search of function. J Exp Bot: pii: erag074. 10.1093/jxb/erag074.
","pubmedId":"41678363","doi":""},{"reference":"Welcker M, Larimore EA, Swanger J, Bengoechea-Alonso MT, Grim JE, Ericsson J, Zheng N, Clurman BE. 2013. Fbw7 dimerization determines the specificity and robustness of substrate degradation. Genes & Development 27: 2531-2536.
","pubmedId":"","doi":"doi.org/10.1101/gad.229195.113"},{"reference":"Wilson RS, Swatek KN, Thelen JJ. 2016. Regulation of the Regulators: Post-Translational Modifications, Subcellular, and Spatiotemporal Distribution of Plant 14-3-3 Proteins. Frontiers in Plant Science 7: 10.3389/fpls.2016.00611.
","pubmedId":"","doi":"doi.org/10.3389/fpls.2016.00611"},{"reference":"Zhang C, Yue J, Li S, Zuo C, Li Y, He Q, Le J. 2025. The Arabidopsis F-box protein FBS associated with the helix-loop-helix transcription factor FAMA involved in stomatal immunity. Plant Molecular Biology 115: 10.1007/s11103-025-01577-7.
","pubmedId":"","doi":"doi.org/10.1007/s11103-025-01577-7"},{"reference":"Zhu D, Maier A, Lee JH, Laubinger S, Saijo Y, Wang H, et al., Deng. 2008. Biochemical Characterization of Arabidopsis Complexes Containing CONSTITUTIVELY PHOTOMORPHOGENIC1 and SUPPRESSOR OF PHYA Proteins in Light Control of Plant Development. The Plant Cell 20: 2307-2323.
","pubmedId":"","doi":"doi.org/10.1105/tpc.107.056580"}],"title":"Arabidopsis F-BOX STRESS INDUCED (FBS) proteins have distinct subcellular interaction patterns with 14-3-3 proteins
","reviews":[],"curatorReviews":[]}]}},"species":{"species":[{"value":"acer saccharum","label":"Acer saccharum","imageSrc":"","imageAlt":"","mod":"TreeGenes","modLink":"https://treegenesdb.org","linkVariable":""},{"value":"achillea millefolium","label":"Achillea millefolium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"acinetobacter baylyi","label":"Acinetobacter baylyi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"actinobacteria bacterium","label":"Actinobacteria bacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adelges tsugae","label":"Adelges tsugae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adenocaulon chilense","label":"Adenocaulon chilense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aedes japonicus","label":"Aedes japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aegorhinus vitulus","label":"Aegorhinus vitulus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alaimidae","label":"Alaimidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"allobates femoralis","label":"Allobates femoralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alnus glutinosa","label":"Alnus glutinosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa aestivalis","label":"Alosa aestivalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa pseudoharengus","label":"Alosa pseudoharengus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alternaria alternata","label":"Alternaria alternata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"amynthas agrestis","label":"Amynthas Agrestis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma caninum","label":"Ancylostoma caninum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma ceylanicum","label":"Ancylostoma ceylanicum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anemone multifida","label":"Anemone multifida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anguilla rostrata","label":"Anguilla rostrata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anisakis simplex","label":"Anisakis simplex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anomala albopilosa","label":"Anomala albopilosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arabidopsis","label":"Arabidopsis","imageSrc":"arabidopsis.png","imageAlt":"Arabidopsis graphic by Zoe Zorn CC BY 4.0","mod":"TAIR","modLink":"https://arabidopsis.org","linkVariable":""},{"value":"architeuthis dux","label":"Architeuthis dux","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arion vulgaris","label":"Arion vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"armeria","label":"Armeria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"artemia","label":"Artemia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arthrobacter sp.","label":"Arthrobacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia","label":"Ascaridia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia galli","label":"Ascaridia galli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"asparagopsis taxiformis","label":"Asparagopsis taxiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"astatotilapia burtoni","label":"Astatotilapia burtoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"avena sativa","label":"Avena sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aves","label":"Aves","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus","label":"Bacillus (firmicutes)","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus cereus","label":"Bacillus cereus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus mycoides","label":"Bacillus mycoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus subtilis","label":"Bacillus subtilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus thuringiensis","label":"Bacillus thuringiensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus toyonensis","label":"Bacillus toyonensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus wiedmannii","label":"Bacillus wiedmannii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteria","label":"Bacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteriophage","label":"Bacteriophage","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bactrocera","label":"Bactrocera sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"batrachospermum gelatinosum","label":"Batrachospermum gelatinosum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula lenta","label":"Betula lenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula nigra","label":"Betula nigra","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus dahlbohmii","label":"Bombus dahlbohmii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus terrestris","label":"Bombus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombyx mori","label":"Bombyx mori","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bos taurus","label":"Bos Taurus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brachygobius doriae","label":"Brachygobius doriae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica oleracea","label":"Brassica oleracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica rapa","label":"Brassica rapa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brugia malayi","label":"Brugia malayi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"burkholderia thailandensis","label":"Burkholderia thailandensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"buttiauxella","label":"Buttiauxella","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis brenneri","label":"Caenorhabditis brenneri","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis briggsae","label":"Caenorhabditis briggsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"c. elegans","label":"Caenorhabditis elegans","imageSrc":"c-elegans.jpg","imageAlt":"C. elegans graphic by Zoe Zorn CC BY 4.0","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"caenorhabditis inopinata","label":"Caenorhabditis inopinata","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis japonica","label":"Caenorhabditis japonica","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis nigoni","label":"Caenorhabditis nigoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis remanei","label":"Caenorhabditis remanei","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis tropicalis","label":"Caenorhabditis tropicalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus","label":"Calidifontibacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus erzuremensis","label":"Calidifontibacillus erzuremensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calliphora sp","label":"Calliphora sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caltha sagittata","label":"Caltha sagittata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cambarus latimanus","label":"Cambarus latimanus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"candida albicans","label":"Candida albicans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"canis familiaris","label":"Canis familiaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cannabis sativa","label":"Cannabis sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caretta caretta","label":"Caretta caretta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cassiopea xamachana","label":"Cassiopea xamachana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caulobacter vibrioides","label":"Caulobacter vibrioides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cephalopods","label":"Cephalopoda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cerastium arvense","label":"Cerastium arvense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceriodaphnia","label":"Ceriodaphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceroglossus suturalis","label":"Ceroglossus suturalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chaetoceros","label":"Chaetoceros","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chamaecrista fasciculata","label":"Chamaecrista fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chilicola chalcidiformis","label":"Chilicola chalcidiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chitinimonas","label":"Chitinimonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chlamydomonas reinhardtii","label":"Chlamydomonas reinhardtii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chromobacterium","label":"Chromobacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysemys picta","label":"Chrysemys picta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysoperla rufilabris","label":"Chrysoperla rufilabris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"citrus","label":"Citrus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"clavibacter sp.","label":"Clavibacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"colinus virginianus","label":"Colinus virginianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crassostrea virginica","label":"Crassostrea virginica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crithidia fasciculata","label":"Crithidia fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cutibacterium acnes","label":"Cutibacterium acnes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cyanobacteria","label":"Cyanobacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia","label":"Daphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia pulex","label":"Daphnia pulex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dermacoccus nishinomiyaensis","label":"Dermacoccus nishinomiyaensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera","label":"Diabrotica virgifera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera virgifera virus 1","label":"Diabrotica virgifera virgifera virus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"d. discoideum","label":"Dictyostelium discoideum","imageSrc":"dicty.png","imageAlt":"D. discoideum","mod":"dictyBase","modLink":"http://dictybase.org","linkVariable":""},{"value":"diptera","label":"Diptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dotocryptus bellicosus","label":"Dotocryptus bellicosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drechmeria coniospora","label":"Drechmeria coniospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drosophila","label":"Drosophila","imageSrc":"drosophila.png","imageAlt":"Drosophila graphic by Zoe Zorn CC BY 4.0","mod":"FlyBase","modLink":"https://flybase.org/doi/","linkVariable":"doi"},{"value":"dryopteris campyloptera","label":"Dryopteris campyloptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris expansa","label":"Dryopteris expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris intermedia","label":"Dryopteris intermedia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dugesia dorotocephala","label":"Dugesia dorotocephala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"elasmobranchii","label":"Elasmobranchii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"embryophyta","label":"Embryophyta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enoploteuthis chunii","label":"Enoploteuthis chunii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterobacter aerogenes","label":"Enterobacter aerogenes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterococcus raffinosus","label":"Enterococcus raffinosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"epichloë coenophiala","label":"Epichloë coenophiala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"equus caballus","label":"Equus caballus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erigeron sp","label":"Erigeron sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eristalis","label":"Eristalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eruca vesicaria","label":"Eruca vesicaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erwinia carotovora","label":"Erwinia carotovora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erythronium americanum","label":"Erythronium americanum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"escherichia coli","label":"Escherichia coli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eukaryota","label":"Eukaryotes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"felis catus","label":"Felis catus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella novicida","label":"Francisella novicida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella tularensis","label":"Francisella tularensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fraxinus americana","label":"Fraxinus americana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fucus distichus","label":"Fucus distichus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fungi","label":"Fungi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gasteropelecus sp.","label":"Gasteropelecus sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"geranium sp","label":"Geranium sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"girardia","label":"Girardia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glaucomys volans","label":"Glaucomys volans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glycine max","label":"Glycine max","imageSrc":"","imageAlt":"","mod":"Soybase","modLink":"https://soybase.org","linkVariable":""},{"value":"glyptemys insculpta","label":"Glyptemys insculpta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gossypium hirsutum","label":"Gossypium hirsutum","imageSrc":"","imageAlt":"","mod":"CottonGen","modLink":"https://www.cottongen.org/","linkVariable":""},{"value":"gromphadorhina portentosa","label":"Gromphadorhina portentosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gryllodes sigillatus","label":"Gryllodes sigillatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"haliotis rufescens","label":"Haliotis rufescens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hepacivirus hominis","label":"Hepatitis C Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"herpes simplex virus type 1","label":"Herpes simplex virus type 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human","label":"Human","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human coronavirus oc43","label":"Human coronavirus OC43","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydra vulgaris","label":"Hydra vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydropsyche sp","label":"Hydropsyche sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hymenoptera","label":"Hymenoptera","imageSrc":"","imageAlt":"","mod":"Hymenoptera Genome Database","modLink":"https://hymenoptera.elsiklab.missouri.edu/","linkVariable":""},{"value":"hypochaeris radicata","label":"Hypochaeris radicata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hypodynerus vespiformis","label":"Hypodynerus vespiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflaviridae","label":"Iflaviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflavuris","label":"Iflavirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ipomoea hederacea","label":"Ipomoea hederacea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera","label":"Ischnomera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera ruficollis","label":"Ischnomera ruficollis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"julidochromis marlieri","label":"Julidochromis marlieri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"juniperus virginiana","label":"Juniperus virginiana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"kluyveromyces marxianus","label":"Kluyveromyces marxianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"l. casei","label":"L. casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lacticaseibacillus casei","label":"Lacticaseibacillus casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"larentiinae sp","label":"Larentiinae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"laurus nobilis","label":"Laurus nobilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lepidoptera","label":"Lepidoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"leucanthemum vulgare","label":"Leucanthemum vulgare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"linepithema humile","label":"Linepithema humile","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"liometopum occidentale","label":"Liometopum occidentale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lolium arundinaceum","label":"Lolium arundinaceum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lontra longicaudis","label":"Lontra longicaudis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbriculus variegatus","label":"Lumbriculus variegatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbricus terrestris","label":"Lumbricus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lupinus polyphyllus","label":"Lupinus polyphyllus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lycorma delicatula","label":"Lycorma delicatula","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lynx rufus","label":"Lynx rufus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"magnaporthe oryzae","label":"Magnaporthe oryzae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mammalia","label":"Mammalia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"manihot esculenta","label":"Manihot esculenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"medicago lupulina","label":"Medicago lupulina","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"meloidogyne","label":"Meloidogyne","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mimus polyglottos","label":"Mimus polyglottos","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bryophyta","label":"Mosses","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mouse","label":"Mouse","imageSrc":"","imageAlt":"","mod":"MGI","modLink":"https://informatics.jax.org","linkVariable":""},{"value":"m. minutoides","label":"Mus minutoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mycobacterium smegmatis","label":"Mycobacterium smegmatis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nakaseomyces glabratus","label":"Nakaseomyces glabratus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nauphoeta cinerea","label":"Nauphoeta cinerea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"neurospora","label":"Neurospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"n. benthamiana","label":"Nicotiana benthamiana","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/Nicotiana_benthamiana/genome","linkVariable":""},{"value":"nicotiana tabacum","label":"Nicotiana tabacum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae","label":"Noctuidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae sp","label":"Noctuidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nothobranchius furzeri","label":"Nothobranchius furzeri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"onchocerca volvulus","label":"Onchocerca volvulus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"orconectes virilis","label":"Orconectes virilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ormia ochracea","label":"Ormia ochracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"o. sativa","label":"Oryza sativa","imageSrc":"","imageAlt":"","mod":"Gramene","modLink":"https://www.gramene.org/","linkVariable":""},{"value":"other","label":"Other","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"oxalis enneaphylla","label":"Oxalis enneaphylla","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea","label":"Pantoea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea agglomerans","label":"Pantoea agglomerans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"papaver sp","label":"Papaver sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paramecium bursaria","label":"Paramecium bursaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"partitiviridae","label":"Partitiviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pelodiscus sinensis","label":"Pelodiscus sinensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"perezia recurvata","label":"Perezia recurvata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"petromyzon marinus","label":"Petromyzon marinus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis","label":"Photinus pyralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis associated partiti-like virus","label":"Photinus pyralis associated partiti-like virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis iflavirus 1","label":"Photinus pyralis iflavirus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"physcomitrium patens","label":"Physcomitrium patens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus strobus","label":"Pinus strobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus taeda","label":"Pinus taeda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"platycheirus","label":"Platycheirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"plectus sambesii","label":"Plectus sambesii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pogonomyrmex occidentalis","label":"Pogonomyrmex occidentalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"poncirus trifoliata","label":"Poncirus trifoliata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"populus deltoides","label":"Populus deltoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"potato virus y","label":"Potato virus Y","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"primula magellanica","label":"Primula magellanica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pristionchus pacificus","label":"Pristionchus pacificus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"prunus persica","label":"Prunus persica","imageSrc":"","imageAlt":"","mod":"Genome Database for Rosaceae","modLink":"https://www.rosaceae.org/","linkVariable":""},{"value":"psalmopoeus iriminia","label":"Psalmopoeus iriminia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudanabaena sp.","label":"Pseudanabaena sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas","label":"Pseudomonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas aeruginosa","label":"Pseudomonas aeruginosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas glycinae","label":"Pseudomonas glycinae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas putida","label":"Pseudomonas putida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas syringae","label":"Pseudomonas syringae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pterophyllum scalare","label":"Pterophyllum scalare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"python regius","label":"Python regius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"quercus macrocarpa","label":"Quercus macrocarpa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ralstonia solanacearum","label":"Ralstonia solanacearum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranitomeya imitator","label":"Ranitomeya imitator","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranunculus peduncularis","label":"Ranunculus peduncularis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"rat","label":"Rat","imageSrc":"","imageAlt":"","mod":"RGD","modLink":"https://rgd.mcw.edu","linkVariable":""},{"value":"rheinheimera","label":"Rheinheimera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ribes rubrum","label":"Ribes rubrum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"sars-cov-2","label":"SARS-CoV-2","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. cerevisiae","label":"Saccharomyces cerevisiae","imageSrc":"yeast.png","imageAlt":"Yeast graphic by Zoe Zorn CC BY 4.0","mod":"SGD","modLink":"https://yeastgenome.org","linkVariable":""},{"value":"saccharomyces paradoxus","label":"Saccharomyces paradoxus ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. uvarum","label":"Saccharomyces uvarum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schistosoma","label":"Schistosoma","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schizosaccharomyces japonicus","label":"Schizosaccharomyces japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. pombe","label":"Schizosaccharomyces pombe","imageSrc":"pombe.png","imageAlt":"Pombe graphic by Zoe Zorn © Caltech","mod":"PomBase","modLink":"https://www.pombase.org/reference/PMID:","linkVariable":"pmId"},{"value":"schmidtea mediterranea","label":"Schmidtea mediterranea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"senecio sp","label":"Senecio sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"simocephalus","label":"Simocephalus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"siraitia grosvenorii","label":"Siraitia grosvenorii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"solanum lycopersicum","label":"Solanum lycopersicum","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/1/view/","linkVariable":""},{"value":"sorghum","label":"Sorghum","imageSrc":"","imageAlt":"","mod":"SorghumBase","modLink":"https://www.sorghumbase.org","linkVariable":""},{"value":"spiroplasma eriocheiris","label":"Spiroplasma eriocheiris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus aureus","label":"Staphylococcus aureus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus epidermidis","label":"Staphylococcus epidermidis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"steinernema carpocapsae","label":"Steinernema carpocapsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"steinernema hermaphroditum","label":"Steinernema hermaphroditum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stenotrophomonas geniculata","label":"Stenotrophomonas geniculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stewartia floidana","label":"Stewartia floridana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus gordonii ","label":"Streptococcus gordonii ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus mutans","label":"Streptococcus mutans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":" streptococcus pneumoniae","label":"Streptococcus pneumoniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. purpuratus","label":"Strongylocentrotus purpuratus","imageSrc":"","imageAlt":"","mod":"Echinobase","modLink":"https://www.echinobase.org","linkVariable":""},{"value":"strongyloides ratti","label":"Strongyloides ratti","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"sulfolobus","label":"Sulfolobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"symphoricarpos albus","label":"Symphoricarpos albus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syncirsodes","label":"Syncirsodes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"synechococcus elongatus","label":"Synechococcus elongatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syrphidae","label":"Syrphidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tarantobelus jeffdanielsi","label":"Tarantobelus jeffdanielsi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"taraxacum officinale","label":"Taraxacum officinale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tatochila theodice","label":"Tatochila theodice","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetrahymena","label":"Tetrahymena","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetramorium immigrans","label":"Tetramorium immigrans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tomato brown rugose fruit virus","label":"ToBRFV","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trachemys scripta","label":"Trachemys scripta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tribolium castaneum","label":"Tribolium castaneum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichoptera","label":"Trichoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichuris muris","label":"Trichuris muris","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"trifolium repens","label":"Trifolium repens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trypoxylus dichotomus","label":"Trypoxylus dichotomus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tsuga canadensis","label":"Tsuga canadensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ulva expansa","label":"Ulva expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"universal","label":"Universal","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"vargula hilgendorfii","label":"Vargula hilgendorfii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"vespula vulgaris","label":"Vespula vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"virus","label":"Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"watasenia scintillans","label":"Watasenia scintillans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"wolbachia pipientis","label":"Wolbachia pipientis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"xenopus","label":"Xenopus","imageSrc":"xenopus.png","imageAlt":"Xenopus graphic by Zoe Zorn CC BY 4.0","mod":"XenBase","modLink":"https://xenbase.org","linkVariable":""},{"value":"xenorhabdus griffiniae","label":"Xenorhabdus griffiniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"yramea cytheris","label":"Yramea cytheris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zaprionus indianus","label":"Zaprionus indianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zea mays","label":"Zea mays","imageSrc":"","imageAlt":"","mod":"MaizeGDB","modLink":"https://www.maizegdb.org","linkVariable":""},{"value":"zebrafish","label":"Zebrafish","imageSrc":"zebrafish.png","imageAlt":"Zebrafish graphic by Zoe Zorn CC BY 4.0","mod":"ZFIN","modLink":"https://zfin.org","linkVariable":""}]}},"pageContext":{"id":"d79920b0-68d6-4894-9b71-1c3ed90f8577","citedBy":[],"parsedCsv":{"csvHeader":[],"csvData":[]}}}, "staticQueryHashes": ["2114697108"]}