In the nematode Caenorhabditis elegans, infection with intracellular intestinal pathogens, including microsporidia and the Orsay virus, activates a transcriptional immune response called the intracellular pathogen response (IPR). Upregulation of about 1/3 of IPR genes requires a bZIP transcription factor ZIP-1. Previous work has demonstrated ZIP-1 promotes anti-viral immunity, but how ZIP-1 protein is regulated and where it controls immune defense remains unclear. Here we show that intestinal-specific rescue of ZIP-1 drives IPR gene expression and promotes resistance to viral infection. We also show that ZIP-1::GFP protein is likely degraded by the proteasome under baseline conditions.
","acknowledgements":"We thank Lakshmi Batachari, Max Strul, and Jessica Raygoza for helpful comments on the manuscript, and Mario Bardan Sarmiento and Lakshmi Batachari for generating Orsay virus preps.
","authors":[{"affiliations":["UC San Diego, San Diego, CA, US"],"departments":["Department of Cell and Developmental Biology"],"credit":["conceptualization","investigation","writing_originalDraft","writing_reviewEditing"],"email":"jtirtorahardjo@UCSD.EDU","firstName":"James A.","lastName":"Tirtorahardjo","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["UC San Diego, San Diego, CA, US","The George Washington University, Washington, DC, US"],"departments":["Department of Cell and Developmental Biology","Department of Biological Sciences"],"credit":["conceptualization","fundingAcquisition","investigation","writing_reviewEditing"],"email":"vladimir.lazetic@email.gwu.edu","firstName":"Vladimir","lastName":"Lažetić","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":" https://orcid.org/0000-0001-5825-6584 "},{"affiliations":["UC San Diego, San Diego, CA, US"],"departments":["Department of Cell and Developmental Biology"],"credit":["conceptualization","fundingAcquisition","supervision","writing_originalDraft","writing_reviewEditing"],"email":"etroemel@ucsd.edu","firstName":"Emily R.","lastName":"Troemel","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0003-2422-0473"}],"awards":[{"awardId":"2301657","funderName":"National Science Foundation (United States)","awardRecipient":"Emily R. Troemel"},{"awardId":"AI176639","funderName":"National Institute of Allergy and Infectious Diseases (United States)","awardRecipient":"Emily R. Troemel"},{"awardId":"GM114139","funderName":"National Institute of General Medical Sciences (United States)","awardRecipient":"Emily R. Troemel"},{"awardId":"AG052622","funderName":"National Institute of Aging","awardRecipient":"Emily R. Troemel"},{"awardId":"19POST34460023","funderName":"American Heart Association (United States)","awardRecipient":"Vladimir Lazetic"},{"awardId":"P40 OD010440","funderName":"NIH Office of Research Infrastructure Programs","awardRecipient":"Caenorhabditis Genetics Center (CGC)"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":null,"extendedData":[{"description":"Tables 1, 2, 3","doi":null,"resourceType":"Dataset","name":"2026_03_20 zip-1 Micropublication Tables.xlsx","url":"https://portal.micropublication.org/uploads/4abd1b558b6c38147faddae355459acd.xlsx"}],"funding":"Some strains used in this study were provided by the Caenorhabditis Genetics Center (CGC), which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). This work was supported by NIH under R01 AG052622, GM114139, AI176639 and by NSF 2301657 to E.R.T and the American Heart Association postdoctoral award 19POST34460023 to V.L.
","image":{"url":"https://portal.micropublication.org/uploads/fad517711afe3b2d296adc362d023671.png"},"imageCaption":"A) Diagram of zip-1::gfp constructs. Top: vha-6p drives intestinal expression, Middle: dpy-7p drives epidermal expression, Bottom: endogenous tag. 100 bp scale bars.
B) Fluorescent micrographs of ZIP-1::GFP expression in a wild-type background after 4 hours of bortezomib treatment. Merge of GFP in green, and autofluorescence in blue.
C) Fluorescent micrographs of ZIP-1::GFP expression in a zip-1(jy13) background after 4 hours of bortezomib treatment. Merge of GFP in green, autofluorescence in blue, and bright-field Nomarski.
D) Time course of ZIP-1::GFP nuclear expression during bortezomib treatment. Average of 3 independent experiments shown, with 20 worms per experiment. Error bars are standard deviation (SD).
E) IPR gene activation as quantified by qRT-PCR. Animals treated at the L4 stage with bortezomib for 30 minutes, normalized against a DMSO-treated wild-type control. Average of 3 to 6 independent experiments shown, with each experiment including 10,000 animals per replicate. Welch’s T-test, unpaired, one-tailed * p<0.05. Error bars are standard error of the mean (SEM).
F) Orsay viral load as quantified by qRT-PCR of Orsay RNA1. Animals infected at the L4 stage (see Methods), quantified at 24 hpi. Average of 8 independent experiment, with each experiment including 2000 infected animals per sample. Welch’s T-test, unpaired, one-tailed * p<0.05, ****p<0.0001. Error bars are SD.
B-E) All bortezomib treatments were at final concentration of 20 µM bortezomib compared to DMSO vehicle control.
B, C) Arrows indicate intestinal nuclei, arrowheads indicate epidermal nuclei. 25 µm scale bars.
","imageTitle":"Analysis of tissue-specific ZIP-1::GFP expression and function
","methods":"C. elegans maintenance
C. elegans were maintained at 20°C on Escherichia coli OP50-1 plated onto Nematode Growth Media (NGM) agar plates. Table 1 describes the strains used in this work.
C. elegans strain generation
Plasmids containing a tissue-specific promoter driving the expression of optimized zip-1a with syntrons (Table 2) were used to carry out Mos1-mediated single copy insertion by InVivo Biosystems. Strains were backcrossed to N2 wild-type worms in the Troemel lab three times before use.
Bortezomib treatment
Bortezomib (Selleck Chemicals), catalog number S1013 was dissolved in DMSO to generate a 10 mM stock solution, which was diluted in M9 buffer, and added to NGM plates to achieve a final concentration of 20 μM on the plates. Synchronized L1s were grown on OP50-1 until L4, then treated with bortezomib or DMSO control. Plates were dried for 20 minutes, then incubated at 20°C for 30 minutes to 6 hours. Animals were either imaged immediately, or washed off plates with M9, then stored in Tri-reagent for RNA extraction and qRT-PCR.
RNA extraction and qRT-PCR
Total RNA was isolated as previously described (Lazetic et al., 2022), then used for cDNA synthesis via the iScript cDNA kit (Bio-Rad). At least 3 independent biological replicates per group were performed in each qRT-PCR analysis. Sequences for qRT-PCR primers are provided in Table 3. All qRT-PCR data was normalized against housekeeping gene snb-1, using the Pfaffl method. For IPR activation assays, groups were normalized against a DMSO treated, N2 wild-type control. For Orsay virus infection, groups were normalized against an infected, zip-1p::zip-1::gfp control.
Orsay virus infection
Gravid adults were bleached to obtain synchronized L1 animals, which were grown on OP50-1 until L4 and then infected with a mixture of Orsay Virus, M9 buffer, and OP50-1 culture. After 24hrs at 20°C, animals were washed off plates, and RNA was extracted for cDNA synthesis and qRT-PCR.
Imaging
Imaging in Figure 1B was performed on a Zeiss AxioImager M1 compound microscope. Imaging in Figure 1C was performed on a Zeiss LSM700 confocal microscope. Images were processed with ZEN2010 software.
","reagents":"","patternDescription":"Transcriptional induction of immune genes needs to be carefully controlled to promote defense against pathogen infection, without causing collateral damage to the host. In the nematode C. elegans, infection with natural pathogens of the intestine, including species of microsporidia (intracellular fungi) and a single-stranded RNA virus known as the Orsay virus, activates a transcriptional innate immune program called the intracellular pathogen response (IPR) (Bakowski et al., 2014; Castiglioni et al., 2024; Chen et al., 2017; Reddy et al., 2019; Sarkies et al., 2013). The IPR promotes defense against infection, but IPR overactivation can slow organismal development and shorten lifespan (Reddy et al., 2019). ZIP-1 is a bZIP transcription factor that controls induction of about 1/3 of IPR genes, and promotes defense against viral infection. How ZIP-1 protein expression is regulated and where ZIP1 acts to control immunity have not been carefully explored.
Our previous data indicate that ZIP-1 can be expressed in the intestine or the epidermis, depending on the trigger. Specifically, an endogenously tagged ZIP-1::GFP protein (hereafter referred to as zip-1p::ZIP-1::GFP) is not visible under baseline conditions, but upon infection with microsporidia or the Orsay virus becomes visible in intestinal nuclei (Lazetic et al., 2022). zip-1p::ZIP-1::GFP is also visible in intestinal nuclei after 4 hours of treatment with the proteasome inhibitor bortezomib, which induces IPR mRNA expression, as well as zip-1 mRNA expression. In contrast, zip-1p::ZIP-1::GFP is expressed prominently in epidermal nuclei when the IPR is genetically activated by loss of the IPR inhibitor PALS-22 (Gang et al., 2022). To better understand the roles ZIP-1 has in the intestine and the epidermis, we developed tissue-specific ZIP-1 expression strains. We generated single-copy transgenic strains with ZIP-1::GFP expression under the control of the vha-6p intestinal-specific promoter or the dpy-7p epidermal-specific promoter. ZIP-1 expression in these strains was compared against zip-1p::ZIP-1::GFP (Figure 1A). Given that zip-1 mRNA is also upregulated by IPR triggers, these tissue-specific ZIP-1 strains also allowed us to investigate whether ZIP-1 protein levels might be induced by IPR triggers independently of the zip-1 promoter.
Similar to zip-1p::ZIP-1::GFP, we observed no expression of vha-6p::ZIP-1::GFP or dpy-7p::ZIP-1::GFP under baseline conditions (Figure 1B). However, when we treated animals with bortezomib for 4 hours (h), we saw vha-6p::ZIP-1::GFP expression in intestinal nuclei, and dpy-7p::ZIP-1::GFP expression in epidermal nuclei after bortezomib treatment (Figure 1B). The bortezomib-induced expression of nuclear ZIP-1::GFP in the tissue-specific strains is consistent with our observations using endogenously tagged protein (Figure 1B), which was previously reported (Lazetic et al., 2022). Thus, the intestinal-specific and epidermal-specific promoters drive expression in the expected tissues, and these results indicate that ZIP-1::GFP protein expression can be induced by bortezomib independently of the zip-1 promoter. Under the control of constitutively active tissue-specific promoters, absence of ZIP-1 protein expression at baseline suggests that ZIP-1 protein is basally degraded. This degradation is mediated either directly or indirectly by the proteasome, as proteasomal blockade results in stabilization and nuclear expression of ZIP-1.
We next examined ZIP-1::GFP expression with these transgenes in a zip-1(jy13) null mutant background. Similar to the wild-type background, vha-6p::ZIP-1::GFP was induced in intestinal nuclei upon 4h bortezomib treatment in a zip-1 mutant background (Figure 1C). In contrast, dpy-7p::ZIP-1::GFP was not induced upon 4h bortezomib in a zip-1(jy13) mutant background (Figure 1C), unlike in the wild-type background. Given that endogenous zip-1p::ZIP-1::GFP is induced in the intestine by bortezomib, we hypothesized that bortezomib first affects the intestine, where wild-type intestinal ZIP-1 might be required to signal to the epidermis to induce epidermal ZIP-1::GFP expression. To investigate this possibility, we performed a time-course analysis to assess where and when ZIP-1::GFP is expressed after bortezomib treatment (Figure 1D). Here we found that zip-1p::ZIP-1::GFP is induced first in intestinal nuclei, and then later in epidermal nuclei. Intestinal nuclear expression is observed in roughly 50% of animals after 2 h of treatment. Similar levels of epidermal nuclear expression are only observed after 6 h of bortezomib treatment. Furthermore, all cases of epidermal nuclear expression were observed in animals that also had intestinal ZIP-1::GFP nuclear localization, epidermal nuclear expression alone was not observed. This result is consistent with the model that intestinal ZIP-1 is required to send a signal to the epidermis to induce ZIP-1::GFP, although the specific tissue in which ZIP-1 is required for this signaling has not yet been investigated.
We next tested whether these tissue-specific ZIP-1::GFP expression constructs could rescue pals-5 mRNA expression in zip-1(jy13) mutants. zip-1(jy13) mutants are defective in inducing mRNA of the IPR gene pals-5 after 30 minutes of bortezomib treatment. Previous results using qRT-PCR with tissue-specific RNAi suggested that ZIP-1 was required in the intestine, but not the epidermis, for this effect (Lazetic et al., 2022). Here we found that intestinal-specific vha-6p::ZIP-1::GFP expression was sufficient to rescue the pals-5 gene induction defect of zip-1(jy13) mutants (Figure 1E). Furthermore, intestinal-specific rescue of zip-1 resulted in significantly increased expression of skr-5 over wild-type and over zip-1(jy13) mutant levels. Surprisingly, epidermal-specific dpy-7p::ZIP-1::GFP expression appeared sufficient to rescue pals-5 induction, although the effect was not significant (Figure 1E). Thus, epidermal expression of ZIP-1 may be sufficient, but not required for inducing pals-5 mRNA expression. Similarly, previous work showed a partial, non-significant reduction in pals-5 induction with epidermal-specific zip-1 RNAi (Lazetic et al., 2022)..
Finally, we examined where ZIP-1 expression is sufficient to rescue the viral susceptibility of zip-1(jy13) mutants. We infected animals with the Orsay virus, and then measured viral load with qRT-PCR for the Orsay virus genomic RNA1 segment. We infected zip-1p::zip-1::gfp animals, zip-1(jy13) mutants, and zip-1(jy13) mutants rescued with vha-6p::zip-1::gfp or dpy-7p::zip-1::gfp. Upon normalizing all data to zip-1p::zip-1::gfp animals, we found that intestinal-specific vha-6p::ZIP-1::GFP expression was sufficient to rescue zip-1(jy13) mutant susceptibility to viral infection. In contrast, epidermal-specific expression of ZIP-1::GFP was not sufficient to affect resistance to viral infection in a zip-1(jy13) mutant background (Figure 1F).
In this work, we generated tissue-specific zip-1 expression and rescue strains to examine the regulation of protein expression and the tissue-specific effects of ZIP-1. We demonstrated that the regulation of ZIP-1 occurs in a promoter-independent manner, suggesting that ZIP-1 is being degraded under baseline conditions. We also observed that epidermal nuclear expression of ZIP-1 is dependent on the presence of ZIP-1 in other tissues. In assessing the tissue-specific effects of ZIP-1, we demonstrated that both intestinal and epidermal zip-1 appear sufficient to induce mRNA expression of IPR gene pals-5, whereas only intestinal zip-1 rescued viral susceptibility in zip-1(jy13) mutants. However, visible expression and subsequent upregulation of ZIP-1::GFP in a particular tissue is not necessary for IPR activation, as dpy-7p::ZIP-1::GFP in a zip-1(jy13) background displays a similar IPR activation profile following 30 minutes of bortezomib treatment to wild-type strains, despite not being visible later at 4h. These findings support earlier findings that ZIP-1 has a functional role even when ZIP-1::GFP is not visible, and highlight the distinct roles of ZIP-1 at early and late stages of the IPR (Lazetic et al., 2022). Future studies could investigate where ZIP-1 is degraded basally – is it in the nucleus or the cytoplasm? What is the relationship between nuclear accumulation of ZIP-1 protein and IPR activation across tissues? Furthermore, we demonstrated that intestinal expression of zip-1 is sufficient for defense against the Orsay virus, an intestinal pathogen. Future studies could examine defense against other intestinal pathogens like microsporidia, as well as defense against other types of pathogens, including those that infect the epidermis.
","references":[{"reference":"Bakowski MA, Desjardins CA, Smelkinson MG, Dunbar TA, Lopez-Moyado IF, Rifkin SA, Cuomo CA, Troemel ER. 2014. Ubiquitin-Mediated Response to Microsporidia and Virus Infection in C. elegans. PLoS Pathogens 10: e1004200.
","pubmedId":"","doi":"10.1371/journal.ppat.1004200"},{"reference":"Castiglioni VG, Olmo-Uceda MaJ, Villena-Giménez A, Muñoz-Sánchez JC, Legarda EG, Elena SF. 2024. Story of an infection: Viral dynamics and host responses in the\n Caenorhabditis elegans\n –Orsay virus pathosystem. Science Advances 10: 10.1126/sciadv.adn5945.
","pubmedId":"","doi":"10.1126/sciadv.adn5945"},{"reference":"Chen K, Franz CJ, Jiang H, Jiang Y, Wang D. 2017. An evolutionarily conserved transcriptional response to viral infection in Caenorhabditis nematodes. BMC Genomics 18: 10.1186/s12864-017-3689-3.
","pubmedId":"","doi":"10.1186/s12864-017-3689-3"},{"reference":"Gang SS, Grover M, Reddy KC, Raman D, Chang YT, Ekiert DC, Barkoulas M, Troemel ER. 2022. A pals-25 gain-of-function allele triggers systemic resistance against natural pathogens of C. elegans. PLOS Genetics 18: e1010314.
","pubmedId":"","doi":"10.1371/journal.pgen.1010314"},{"reference":"Lažetić V, Wu F, Cohen LB, Reddy KC, Chang YT, Gang SS, Bhabha G, Troemel ER. 2022. The transcription factor ZIP-1 promotes resistance to intracellular infection in Caenorhabditis elegans. Nature Communications 13: 10.1038/s41467-021-27621-w.
","pubmedId":"","doi":"10.1038/s41467-021-27621-w"},{"reference":"Reddy KC, Dror T, Sowa JN, Panek J, Chen K, Lim ES, Wang D, Troemel ER. 2017. An Intracellular Pathogen Response Pathway Promotes Proteostasis in C. elegans. Current Biology 27: 3544-3553.e5.
","pubmedId":"","doi":"10.1016/j.cub.2017.10.009"},{"reference":"Sarkies P, Ashe A, Le Pen Jrm, McKie MA, Miska EA. 2013. Competition between virus-derived and endogenous small RNAs regulates gene expression inCaenorhabditis elegans. Genome Research 23: 1258-1270.
","pubmedId":"","doi":"10.1101/gr.153296.112"}],"title":"Intestinal and epidermal-specific analysis of ZIP-1 function and expression in Caenorhabditis elegans
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Daniela Raciti"},"openAcknowledgement":false,"submitted":null}]},{"id":"0de8efad-e735-4ce1-9f44-90c9df792e85","decision":"revise","abstract":"In the nematode Caenorhabditis elegans, infection with intracellular intestinal pathogens, including microsporidia and the Orsay virus, activates a transcriptional immune response called the intracellular pathogen response (IPR). Upregulation of about 1/3 of IPR genes requires a bZIP transcription factor ZIP-1. Previous work has demonstrated ZIP-1 promotes anti-viral immunity, but how ZIP-1 protein is regulated and where it controls immune defense remains unclear. Here we show that intestinal-specific rescue of ZIP-1 drives IPR gene expression and promotes resistance to viral infection. We also show that ZIP-1::GFP protein is likely degraded by the proteasome under baseline conditions.
","acknowledgements":"We thank Lakshmi Batachari, Max Strul, and Jessica Raygoza for helpful comments on the manuscript, and Mario Bardan Sarmiento and Lakshmi Batachari for generating Orsay virus preps.
","authors":[{"affiliations":["UC San Diego, San Diego, CA, US"],"departments":["Department of Cell and Developmental Biology"],"credit":["conceptualization","investigation","writing_originalDraft","writing_reviewEditing"],"email":"jtirtorahardjo@ucsd.edu","firstName":"James A.","lastName":"Tirtorahardjo","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["UC San Diego, San Diego, CA, US","The George Washington University, Washington, DC, US"],"departments":["Department of Cell and Developmental Biology","Department of Biological Sciences"],"credit":["conceptualization","fundingAcquisition","investigation","writing_reviewEditing"],"email":"vladimir.lazetic@email.gwu.edu","firstName":"Vladimir","lastName":"Lažetić","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":" https://orcid.org/0000-0001-5825-6584 "},{"affiliations":["UC San Diego, San Diego, CA, US"],"departments":["Department of Cell and Developmental Biology"],"credit":["conceptualization","fundingAcquisition","supervision","writing_originalDraft","writing_reviewEditing"],"email":"etroemel@ucsd.edu","firstName":"Emily R.","lastName":"Troemel","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0003-2422-0473"}],"awards":[{"awardId":"2301657","funderName":"National Science Foundation (United States)","awardRecipient":"Emily R. Troemel"},{"awardId":"AI176639","funderName":"National Institute of Allergy and Infectious Diseases (United States)","awardRecipient":"Emily R. Troemel"},{"awardId":"GM114139","funderName":"National Institute of General Medical Sciences (United States)","awardRecipient":"Emily R. Troemel"},{"awardId":"AG052622","funderName":"National Institute of Aging","awardRecipient":"Emily R. Troemel"},{"awardId":"19POST34460023","funderName":"American Heart Association (United States)","awardRecipient":"Vladimir Lazetic"},{"awardId":"P40 OD010440","funderName":"NIH Office of Research Infrastructure Programs","awardRecipient":"Caenorhabditis Genetics Center (CGC)"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":null,"extendedData":[{"description":"Tables 1, 2, 3","doi":null,"resourceType":"Dataset","name":"2026_03_20 zip-1 Micropublication Tables.xlsx","url":"https://portal.micropublication.org/uploads/4abd1b558b6c38147faddae355459acd.xlsx"}],"funding":"Some strains used in this study were provided by the Caenorhabditis Genetics Center (CGC), which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). This work was supported by NIH under R01 AG052622, GM114139, AI176639 and by NSF 2301657 to E.R.T and the American Heart Association postdoctoral award 19POST34460023 to V.L.
","image":{"url":"https://portal.micropublication.org/uploads/fad517711afe3b2d296adc362d023671.png"},"imageCaption":"A) Diagram of zip-1::gfp constructs. Top: vha-6p drives intestinal expression, Middle: dpy-7p drives epidermal expression, Bottom: endogenous tag. 100 bp scale bars.
B) Fluorescent micrographs of ZIP-1::GFP expression in a wild-type background after 4 hours of bortezomib treatment. Merge of GFP in green, and autofluorescence in blue.
C) Fluorescent micrographs of ZIP-1::GFP expression in a zip-1(jy13) background after 4 hours of bortezomib treatment. Merge of GFP in green, autofluorescence in blue, and bright-field Nomarski.
D) Time course of ZIP-1::GFP nuclear expression during bortezomib treatment. Average of 3 independent experiments shown, with 20 worms per experiment. Error bars are standard deviation (SD).
E) IPR gene activation as quantified by qRT-PCR. Animals treated at the L4 stage with bortezomib for 30 minutes, normalized against a DMSO-treated wild-type control. Average of 3 to 6 independent experiments shown, with each experiment including 10,000 animals per replicate. Welch's T-test, unpaired, one-tailed * p<0.05. Error bars are standard error of the mean (SEM).
F) Orsay viral load as quantified by qRT-PCR of Orsay RNA1. Animals infected at the L4 stage (see Methods), quantified at 24 hpi. Average of 8 independent experiment, with each experiment including 2000 infected animals per sample. Welch's T-test, unpaired, one-tailed * p<0.05, ****p<0.0001. Error bars are SD.
B-E) All bortezomib treatments were at final concentration of 20 µM bortezomib compared to DMSO vehicle control.
B, C) Arrows indicate intestinal nuclei, arrowheads indicate epidermal nuclei. 25 µm scale bars.
","imageTitle":"Analysis of tissue-specific ZIP-1::GFP expression and function
","methods":"C. elegans maintenance
C. elegans were maintained at 20°C on Escherichia coli OP50-1 plated onto Nematode Growth Media (NGM) agar plates. Table 1 describes the strains used in this work.
C. elegans strain generation
Plasmids containing a tissue-specific promoter driving the expression of optimized zip-1a with syntrons (Table 2) were used to carry out Mos1-mediated single copy insertion by InVivo Biosystems. Strains were backcrossed to N2 wild-type worms in the Troemel lab three times before use.
Bortezomib treatment
Bortezomib (Selleck Chemicals), catalog number S1013 was dissolved in DMSO to generate a 10 mM stock solution, which was diluted in M9 buffer, and added to NGM plates to achieve a final concentration of 20 μM on the plates. Synchronized L1s were grown on OP50-1 until L4, then treated with bortezomib or DMSO control. Plates were dried for 20 minutes, then incubated at 20°C for 30 minutes to 6 hours. Animals were either imaged immediately, or washed off plates with M9, then stored in Tri-reagent for RNA extraction and qRT-PCR.
RNA extraction and qRT-PCR
Total RNA was isolated as previously described (Lazetic et al., 2022), then used for cDNA synthesis via the iScript cDNA kit (Bio-Rad). At least 3 independent biological replicates per group were performed in each qRT-PCR analysis. Sequences for qRT-PCR primers are provided in Table 3. All qRT-PCR data was normalized against housekeeping gene snb-1, using the Pfaffl method. For IPR activation assays, groups were normalized against a DMSO treated, N2 wild-type control. For Orsay virus infection, groups were normalized against an infected, zip-1p::zip-1::gfp control.
Orsay virus infection
Gravid adults were bleached to obtain synchronized L1 animals, which were grown on OP50-1 until L4 and then infected with a mixture of Orsay Virus, M9 buffer, and OP50-1 culture. After 24hrs at 20°C, animals were washed off plates, and RNA was extracted for cDNA synthesis and qRT-PCR.
Imaging
Imaging in Figure 1B was performed on a Zeiss AxioImager M1 compound microscope. Imaging in Figure 1C was performed on a Zeiss LSM700 confocal microscope. Images were processed with ZEN2010 software.
","reagents":"","patternDescription":"Transcriptional induction of immune genes needs to be carefully controlled to promote defense against pathogen infection, without causing collateral damage to the host. In the nematode C. elegans, infection with natural pathogens of the intestine, including species of microsporidia (intracellular fungi) and a single-stranded RNA virus known as the Orsay virus, activates a transcriptional innate immune program called the intracellular pathogen response (IPR) (Bakowski et al., 2014; Castiglioni et al., 2024; Chen et al., 2017; Reddy et al., 2019; Sarkies et al., 2013). The IPR promotes defense against infection, but IPR overactivation can slow organismal development and shorten lifespan (Reddy et al., 2019). ZIP-1 is a bZIP transcription factor that controls induction of about 1/3 of IPR genes, and promotes defense against viral infection. How ZIP-1 protein expression is regulated and where ZIP1 acts to control immunity have not been carefully explored.
Our previous data indicate that ZIP-1 can be expressed in the intestine or the epidermis, depending on the trigger. Specifically, an endogenously tagged ZIP-1::GFP protein (hereafter referred to as zip-1p::ZIP-1::GFP) is not visible under baseline conditions, but upon infection with microsporidia or the Orsay virus becomes visible in intestinal nuclei (Lazetic et al., 2022). zip-1p::ZIP-1::GFP is also visible in intestinal nuclei after 4 hours of treatment with the proteasome inhibitor bortezomib, which induces IPR mRNA expression, as well as zip-1 mRNA expression. In contrast, zip-1p::ZIP-1::GFP is expressed prominently in epidermal nuclei when the IPR is genetically activated by loss of the IPR inhibitor PALS-22 (Gang et al., 2022). To better understand the roles ZIP-1 has in the intestine and the epidermis, we developed tissue-specific ZIP-1 expression strains. We generated single-copy transgenic strains with ZIP-1::GFP expression under the control of the vha-6p intestinal-specific promoter or the dpy-7p epidermal-specific promoter. ZIP-1 expression in these strains was compared against zip-1p::ZIP-1::GFP (Figure 1A). Given that zip-1 mRNA is also upregulated by IPR triggers, these tissue-specific ZIP-1 strains also allowed us to investigate whether ZIP-1 protein levels might be induced by IPR triggers independently of the zip-1 promoter.
Similar to zip-1p::ZIP-1::GFP, we observed no expression of vha-6p::ZIP-1::GFP or dpy-7p::ZIP-1::GFP under baseline conditions (Figure 1B). However, when we treated animals with bortezomib for 4 hours (h), we saw vha-6p::ZIP-1::GFP expression in intestinal nuclei, and dpy-7p::ZIP-1::GFP expression in epidermal nuclei after bortezomib treatment (Figure 1B). The bortezomib-induced expression of nuclear ZIP-1::GFP in the tissue-specific strains is consistent with our observations using endogenously tagged protein (Figure 1B), which was previously reported (Lazetic et al., 2022). Thus, the intestinal-specific and epidermal-specific promoters drive expression in the expected tissues, and these results indicate that ZIP-1::GFP protein expression can be induced by bortezomib independently of the zip-1 promoter. Under the control of constitutively active tissue-specific promoters, absence of ZIP-1 protein expression at baseline suggests that ZIP-1 protein is basally degraded. This degradation is mediated either directly or indirectly by the proteasome, as proteasomal blockade results in stabilization and nuclear expression of ZIP-1.
We next examined ZIP-1::GFP expression with these transgenes in a zip-1(jy13) null mutant background. Similar to the wild-type background, vha-6p::ZIP-1::GFP was induced in intestinal nuclei upon 4h bortezomib treatment in a zip-1 mutant background (Figure 1C). In contrast, dpy-7p::ZIP-1::GFP was not induced upon 4h bortezomib in a zip-1(jy13) mutant background (Figure 1C), unlike in the wild-type background. Given that endogenous zip-1p::ZIP-1::GFP is induced in the intestine by bortezomib, we hypothesized that bortezomib first affects the intestine, where wild-type intestinal ZIP-1 might be required to signal to the epidermis to induce epidermal ZIP-1::GFP expression. To investigate this possibility, we performed a time-course analysis to assess where and when ZIP-1::GFP is expressed after bortezomib treatment (Figure 1D). Here we found that zip-1p::ZIP-1::GFP is induced first in intestinal nuclei, and then later in epidermal nuclei. Intestinal nuclear expression is observed in roughly 50% of animals after 2 h of treatment. Similar levels of epidermal nuclear expression are only observed after 6 h of bortezomib treatment. Furthermore, all cases of epidermal nuclear expression were observed in animals that also had intestinal ZIP-1::GFP nuclear localization, epidermal nuclear expression alone was not observed. This result is consistent with the model that intestinal ZIP-1 is required to send a signal to the epidermis to induce ZIP-1::GFP, although the specific tissue in which ZIP-1 is required for this signaling has not yet been investigated.
We next tested whether these tissue-specific ZIP-1::GFP expression constructs could rescue pals-5 mRNA expression in zip-1(jy13) mutants. zip-1(jy13) mutants are defective in inducing mRNA of the IPR gene pals-5 after 30 minutes of bortezomib treatment. Previous results using qRT-PCR with tissue-specific RNAi suggested that ZIP-1 was required in the intestine, but not the epidermis, for this effect (Lazetic et al., 2022). Here we found that intestinal-specific vha-6p::ZIP-1::GFP expression was sufficient to rescue the pals-5 gene induction defect of zip-1(jy13) mutants (Figure 1E). Furthermore, intestinal-specific rescue of zip-1 resulted in significantly increased expression of skr-5 over wild-type and over zip-1(jy13) mutant levels. Surprisingly, epidermal-specific dpy-7p::ZIP-1::GFP expression appeared sufficient to rescue pals-5 induction, although the effect was not significant (Figure 1E). Thus, epidermal expression of ZIP-1 may be sufficient, but not required for inducing pals-5 mRNA expression. Similarly, previous work showed a partial, non-significant reduction in pals-5 induction with epidermal-specific zip-1 RNAi (Lazetic et al., 2022)..
Finally, we examined where ZIP-1 expression is sufficient to rescue the viral susceptibility of zip-1(jy13) mutants. We infected animals with the Orsay virus, and then measured viral load with qRT-PCR for the Orsay virus genomic RNA1 segment. We infected zip-1p::zip-1::gfp animals, zip-1(jy13) mutants, and zip-1(jy13) mutants rescued with vha-6p::zip-1::gfp or dpy-7p::zip-1::gfp. Upon normalizing all data to zip-1p::zip-1::gfp animals, we found that intestinal-specific vha-6p::ZIP-1::GFP expression was sufficient to rescue zip-1(jy13) mutant susceptibility to viral infection. In contrast, epidermal-specific expression of ZIP-1::GFP was not sufficient to affect resistance to viral infection in a zip-1(jy13) mutant background (Figure 1F).
In this work, we generated tissue-specific zip-1 expression and rescue strains to examine the regulation of protein expression and the tissue-specific effects of ZIP-1. We demonstrated that the regulation of ZIP-1 occurs in a promoter-independent manner, suggesting that ZIP-1 is being degraded under baseline conditions. We also observed that epidermal nuclear expression of ZIP-1 is dependent on the presence of ZIP-1 in other tissues. In assessing the tissue-specific effects of ZIP-1, we demonstrated that both intestinal and epidermal zip-1 appear sufficient to induce mRNA expression of IPR gene pals-5, whereas only intestinal zip-1 rescued viral susceptibility in zip-1(jy13) mutants. However, visible expression and subsequent upregulation of ZIP-1::GFP in a particular tissue is not necessary for IPR activation, as dpy-7p::ZIP-1::GFP in a zip-1(jy13) background displays a similar IPR activation profile following 30 minutes of bortezomib treatment to wild-type strains, despite not being visible later at 4h. These findings support earlier findings that ZIP-1 has a functional role even when ZIP-1::GFP is not visible, and highlight the distinct roles of ZIP-1 at early and late stages of the IPR (Lazetic et al., 2022). Future studies could investigate where ZIP-1 is degraded basally – is it in the nucleus or the cytoplasm? What is the relationship between nuclear accumulation of ZIP-1 protein and IPR activation across tissues? Furthermore, we demonstrated that intestinal expression of zip-1 is sufficient for defense against the Orsay virus, an intestinal pathogen. Future studies could examine defense against other intestinal pathogens like microsporidia, as well as defense against other types of pathogens, including those that infect the epidermis.
","references":[{"reference":"Bakowski MA, Desjardins CA, Smelkinson MG, Dunbar TA, Lopez-Moyado IF, Rifkin SA, Cuomo CA, Troemel ER. 2014. Ubiquitin-Mediated Response to Microsporidia and Virus Infection in C. elegans. PLoS Pathogens 10: e1004200.
","pubmedId":"","doi":"10.1371/journal.ppat.1004200"},{"reference":"Castiglioni VG, Olmo-Uceda MaJ, Villena-Giménez A, Muñoz-Sánchez JC, Legarda EG, Elena SF. 2024. Story of an infection: Viral dynamics and host responses in the\n Caenorhabditis elegans\n –Orsay virus pathosystem. Science Advances 10: 10.1126/sciadv.adn5945.
","pubmedId":"","doi":"10.1126/sciadv.adn5945"},{"reference":"Chen K, Franz CJ, Jiang H, Jiang Y, Wang D. 2017. An evolutionarily conserved transcriptional response to viral infection in Caenorhabditis nematodes. BMC Genomics 18: 10.1186/s12864-017-3689-3.
","pubmedId":"","doi":"10.1186/s12864-017-3689-3"},{"reference":"Gang SS, Grover M, Reddy KC, Raman D, Chang YT, Ekiert DC, Barkoulas M, Troemel ER. 2022. A pals-25 gain-of-function allele triggers systemic resistance against natural pathogens of C. elegans. PLOS Genetics 18: e1010314.
","pubmedId":"","doi":"10.1371/journal.pgen.1010314"},{"reference":"Lažetić V, Wu F, Cohen LB, Reddy KC, Chang YT, Gang SS, Bhabha G, Troemel ER. 2022. The transcription factor ZIP-1 promotes resistance to intracellular infection in Caenorhabditis elegans. Nature Communications 13: 10.1038/s41467-021-27621-w.
","pubmedId":"","doi":"10.1038/s41467-021-27621-w"},{"reference":"Reddy KC, Dror T, Sowa JN, Panek J, Chen K, Lim ES, Wang D, Troemel ER. 2017. An Intracellular Pathogen Response Pathway Promotes Proteostasis in C. elegans. Current Biology 27: 3544-3553.e5.
","pubmedId":"","doi":"10.1016/j.cub.2017.10.009"},{"reference":"Sarkies P, Ashe A, Le Pen Jrm, McKie MA, Miska EA. 2013. Competition between virus-derived and endogenous small RNAs regulates gene expression inCaenorhabditis elegans. Genome Research 23: 1258-1270.
","pubmedId":"","doi":"10.1101/gr.153296.112"}],"title":"Intestinal and epidermal-specific analysis of ZIP-1 function and expression in Caenorhabditis elegans
","reviews":[{"reviewer":{"displayName":"Marie-Anne Felix"},"openAcknowledgement":false,"status":{"submitted":true}}],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Daniela Raciti"},"openAcknowledgement":false,"submitted":null}]},{"id":"340885b9-9b66-4070-87ef-35342f8e8f6c","decision":"accept","abstract":"In the nematode Caenorhabditis elegans, infection with intracellular intestinal pathogens, including microsporidia and the Orsay virus, activates a transcriptional immune response called the intracellular pathogen response (IPR). Upregulation of about 1/3 of IPR genes requires a bZIP transcription factor ZIP-1. Previous work has demonstrated ZIP-1 promotes anti-viral immunity, but how ZIP-1 protein is regulated and where it controls immune defense remains unclear. Here we show that intestinal-specific rescue of ZIP-1 drives IPR gene expression and promotes resistance to viral infection. We also show that proteasome blockade increases ZIP-1::GFP protein levels independently of the zip-1 promoter.
","acknowledgements":"We thank Lakshmi Batachari, Max Strul, and Jessica Raygoza for helpful comments on the manuscript, and Mario Bardan Sarmiento and Lakshmi Batachari for generating Orsay virus preps.
","authors":[{"affiliations":["UC San Diego, San Diego, CA, US"],"departments":["Department of Cell and Developmental Biology"],"credit":["conceptualization","investigation","writing_originalDraft","writing_reviewEditing"],"email":"jtirtorahardjo@ucsd.edu","firstName":"James A.","lastName":"Tirtorahardjo","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["UC San Diego, San Diego, CA, US","The George Washington University, Washington, DC, US"],"departments":["Department of Cell and Developmental Biology","Department of Biological Sciences"],"credit":["conceptualization","fundingAcquisition","investigation","writing_reviewEditing"],"email":"vladimir.lazetic@email.gwu.edu","firstName":"Vladimir","lastName":"Lažetić","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":" https://orcid.org/0000-0001-5825-6584 "},{"affiliations":["UC San Diego, San Diego, CA, US"],"departments":["Department of Cell and Developmental Biology"],"credit":["conceptualization","fundingAcquisition","supervision","writing_originalDraft","writing_reviewEditing"],"email":"etroemel@ucsd.edu","firstName":"Emily R.","lastName":"Troemel","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0003-2422-0473"}],"awards":[{"awardId":"2301657","funderName":"National Science Foundation (United States)","awardRecipient":"Emily R. Troemel"},{"awardId":"AI176639","funderName":"National Institute of Allergy and Infectious Diseases (United States)","awardRecipient":"Emily R. Troemel"},{"awardId":"GM114139","funderName":"National Institute of General Medical Sciences (United States)","awardRecipient":"Emily R. Troemel"},{"awardId":"AG052622","funderName":"National Institute of Aging","awardRecipient":"Emily R. Troemel"},{"awardId":"19POST34460023","funderName":"American Heart Association (United States)","awardRecipient":"Vladimir Lazetic"},{"awardId":"P40 OD010440","funderName":"NIH Office of Research Infrastructure Programs","awardRecipient":"Caenorhabditis Genetics Center (CGC)"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"pNU3111 plasmid sequence and annotation as Genbank file
","doi":"10.22002/n687b-1hr11","resourceType":"Dataset","name":"pnu3111-vlaz01-ki-of-dpy-7pzip-1gfp3xflageft-3-3utr-in-ttti5605.gb","url":"https://portal.micropublication.org/uploads/6132d400b062be67e759ab7e7d5246a8.gb"},{"description":"pNU3112 plasmid sequence and annotation as Genbank file
","doi":"10.22002/1k6z0-hf130","resourceType":"Dataset","name":"pnu3112-vlaz02-ki-of-vha-6pzip-1gfp3xflageft-3-3-utr-in-ttti5605.gb","url":"https://portal.micropublication.org/uploads/326ed500018a67704ecafe838a631efc.gb"},{"description":"Raw Data Panel D
","doi":"10.22002/azyg7-h5021","resourceType":"Dataset","name":"zip-1 GFP quant BTZ time course.prism","url":"https://portal.micropublication.org/uploads/c4da6ebd0289a42d13cb461aaa22777a.prism"},{"description":"Raw data panel E
","doi":"10.22002/y8vxr-rpy89","resourceType":"Dataset","name":"IPR qPCR in BTZ treated worms.prism","url":"https://portal.micropublication.org/uploads/c16ed23a75e2887f6c8736bbdf83e4a8.prism"},{"description":"Raw data Panel F
","doi":"10.22002/560q9-dys15","resourceType":"Dataset","name":"OV pathogen load qPCR zip-1.prism","url":"https://portal.micropublication.org/uploads/66d952a036cafb1f107befef7992da1b.prism"}],"funding":"Some strains used in this study were provided by the Caenorhabditis Genetics Center (CGC), which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). This work was supported by NIH under R01 AG052622, GM114139, AI176639 and by NSF 2301657 to E.R.T and the American Heart Association postdoctoral award 19POST34460023 to V.L.
","image":{"url":"https://portal.micropublication.org/uploads/513a2ce3cbfd266e553183762711b3c4.png"},"imageCaption":"A) Diagram of zip-1::gfp constructs. Top: vha-6p drives intestinal expression, Middle: dpy-7p drives epidermal expression, Bottom: endogenous tag. 100 bp scale bars.
B) Fluorescent micrographs of ZIP-1::GFP expression in a wild-type background after 4 hours of bortezomib treatment. Merge of GFP in green, and autofluorescence in blue.
C) Fluorescent micrographs of ZIP-1::GFP expression in a zip-1(jy13) background after 4 hours of bortezomib treatment. Merge of GFP in green, autofluorescence in blue, and bright-field Nomarski.
D) Time course of ZIP-1::GFP nuclear expression during bortezomib treatment. Average of 3 independent experiments shown, with 20 worms per experiment. Error bars are standard deviation (SD).
E) IPR gene activation as quantified by qRT-PCR. Animals treated at the L4 stage with bortezomib for 30 minutes, normalized against a DMSO-treated wild-type control. Average of 3 to 6 independent experiments shown, with each experiment including 10,000 animals per replicate. Welch's T-test, unpaired, one-tailed * p<0.05. Error bars are standard error of the mean (SEM).
F) Orsay viral load as quantified by qRT-PCR of Orsay RNA1. Animals infected at the L4 stage (see Methods), quantified at 24 hpi. Average of 8 independent experiment, with each experiment including 2000 infected animals per sample. Welch's T-test, unpaired, one-tailed * p<0.05, ****p<0.0001. Error bars are SD.
B-E) All bortezomib treatments were at final concentration of 20 µM bortezomib compared to DMSO vehicle control.
B, C) Arrows indicate intestinal nuclei, arrowheads indicate epidermal nuclei. 25 µm scale bars.
","imageTitle":"Analysis of tissue-specific ZIP-1::GFP expression and function
","methods":"Table 1 | C. elegans strains and plasmids | ||
Strain | Genotype | Description | Source |
Wild-type | Wild-type | Troemel Lab Collection | |
Full deletion of zip-1 | Lažetić et al., 2022 | ||
Endogenous ZIP-1 tagged with GFP | Lažetić et al., 2022 | ||
knuSi895[pNU3112(vha-6p::zip-1::gfp::3xFlag::eft-3 3'UTR, unc-119(+))] II | Intestinal expression of ZIP-1::GFP in wild-type background; backcrossed to N2 | This study. pNU3112 plasmid details: https://invivobiosystems.benchling.com/s/seq-56QzKYzufpEX3HfhjBDb | |
knuSi895[pNU3112(vha-6p::zip-1::gfp::3xFlag::eft-3 3'UTR, unc-119(+))] II; zip-1(jy13) III | |||
knuSi1111[pNU3111(dpy-7p::zip-1::gfp::3xFlag::eft-3 3'UTR, unc-119(+))] II | Epidermal expression of ZIP-1::GFP in wild-type background; backcrossed to N2 | This study. pNU3111 plasmid details: https://invivobiosystems.benchling.com/s/seq-gtvMqwCerkaGCLWt9bVV | |
knuSi1111[pNU3111(dpy-7p::zip-1::gfp::3xFlag::eft-3 3'UTR, unc-119(+))] II; zip-1(jy13) III |
Table 2 | Primers | |
Gene Name | Primer Description | Sequence |
snb-1 qRT-PCR Forward | ccggataagaccatcttgacg | |
snb-1 qRT-PCR Reverse | gacgacttcatcaacctgagc | |
pals-5 qRT-PCR Forward | cattggaaagcgatattgga | |
pals-5 qRT-PCR Reverse | tctccaggcacctatcttgtag | |
skr-3 qRT-PCR Forward | ccgacagccagaaacaaatca | |
skr-3 qRT-PCR Reverse | tctgtgatggtcttggattgac | |
skr-4 qRT-PCR Forward | ccgacagccagaaacaaatca | |
skr-4 qRT-PCR Reverse | ggtcttggattggctgatcac | |
skr-5 qRT-PCR Forward | cgaagagcaagatgtcaaaattg | |
skr-5 qRT-PCR Reverse | agaagcttggattgattggca | |
cul-6 qRT-PCR Forward | ctgggcttactcacaatgcc | |
cul-6 qRT-PCR Reverse | gcagagttggcttgctgtaa | |
F26F2.1 qRT-PCR Forward | tggaaccaggtcagagacac | |
F26F2.1 qRT-PCR Reverse | ttgtgagaatttccgcgata | |
F26F2.3 qRT-PCR Forward | ggaaagggaatgcattatgg | |
F26F2.3 qRT-PCR Reverse | ccgcacggttatttctcat | |
F26F2.4 qRT-PCR Forward | caacaatacactgcggatgg | |
F26F2.4 qRT-PCR Reverse | tcgcactgttattcatctcca | |
chil-27 qRT-PCR Forward | tcaagtggaggactgcaaca | |
chil-27 qRT-PCR Reverse | tgagttattttcggtagattccagt | |
Orsay RNA1 | Orsay RNA1 qRT-PCR Forward | gacgcttccaagattggtattggt |
Orsay RNA1 | Orsay RNA1 qRT-PCR Reverse | acctcacaactgccatctaca |
zip-1::gfp | zip-1::gfp genotyping Forward | cttctggccttcctcattgat |
zip-1::gfp | zip-1::gfp genotyping Reverse | gtcttgtagttcccgtcatct |
cgcgattctcgtagatcaaac | ||
ggagttcaaagtcgctgattg |
C. elegans maintenance
C. elegans were maintained at 20°C on Escherichia coli OP50-1 plated onto Nematode Growth Media (NGM) agar plates. Strains in Table 1.
C. elegans strain generation
Plasmids containing a tissue-specific promoter driving the expression of optimized zip-1a with syntrons (Table 1) were used to carry out Mos1-mediated single copy insertion by InVivo Biosystems. Strains were backcrossed to N2 wild-type worms in the Troemel lab three times before use. Genotyping primers in Table 2.
Bortezomib treatment
Bortezomib (Selleck Chemicals), catalog number S1013 was dissolved in DMSO to generate a 10 mM stock solution, which was diluted in M9 buffer, and added to NGM plates to achieve a final concentration of 20 μM on the plates. Synchronized L1s were grown on OP50-1 until L4, then treated with bortezomib or DMSO control. Plates were dried for 20 minutes, then incubated at 20°C for 30 minutes to 6 hours. Animals were either imaged immediately, or washed off plates with M9, then stored in Tri-reagent for RNA extraction and qRT-PCR.
RNA extraction and qRT-PCR
Total RNA was isolated as previously described (Lazetic et al., 2022), then used for cDNA synthesis via the iScript cDNA kit (Bio-Rad). At least 3 independent biological replicates per group were performed in each qRT-PCR analysis using Bio-Rad CFX Connect machine with manager 3.1. Sequences for qRT-PCR primers are provided in Table 2. All qRT-PCR data was normalized against housekeeping gene snb-1, using the Pfaffl method. For IPR activation assays, groups were normalized against a DMSO treated, N2 wild-type control. For Orsay virus infection, groups were normalized against an infected, zip-1p::zip-1::gfp control.
Orsay virus infection
Gravid adults were bleached to obtain synchronized L1 animals, which were grown on OP50-1 until L4 and then infected with a mixture of Orsay Virus, M9 buffer, and OP50-1 culture. After 24 hours at 20°C, animals were washed off plates, and RNA was extracted for cDNA synthesis and qRT-PCR.
Imaging
Imaging in Figure 1B was performed on a Zeiss AxioImager M1 compound microscope using ZEN Version 3.9.3. Imaging in Figure 1C was performed on a Zeiss LSM700 confocal microscope using ZEN 2010 Version 6.0.0.309. Image processing was done in Paint.NET Version 5.1.12.
Statistical analysis
Prism 10 was used for statistical analysis
","reagents":"","patternDescription":"Transcriptional induction of immune genes needs to be carefully controlled to promote defense against pathogen infection, without causing collateral damage to the host. In the nematode C. elegans, infection with natural pathogens of the intestine, including species of microsporidia (intracellular fungi) and a single-stranded RNA virus known as the Orsay virus, activates a transcriptional innate immune program called the intracellular pathogen response (IPR) (Bakowski et al., 2014; Castiglioni et al., 2024; Chen et al., 2017; Reddy et al., 2019; Sarkies et al., 2013). The IPR promotes defense against infection, but IPR overactivation can slow organismal development and shorten lifespan (Reddy et al., 2019). ZIP-1 is a bZIP transcription factor that controls induction of about 1/3 of IPR genes, and promotes defense against viral infection. How ZIP-1 protein expression is regulated and where ZIP-1 acts to control immunity have not been carefully explored.
Our previous data indicate that ZIP-1 can be expressed in the intestine or the epidermis, depending on the trigger. Specifically, an endogenously tagged ZIP-1::GFP protein (hereafter referred to as zip-1p::ZIP-1::GFP) is not visible under baseline conditions, but upon infection with microsporidia or the Orsay virus becomes visible in intestinal nuclei (Lazetic et al., 2022). zip-1p::ZIP-1::GFP is also visible in intestinal nuclei after 4 hours (h) of treatment with the proteasome inhibitor bortezomib, which induces mRNA expression of IPR genes, as well as zip-1 mRNA expression. In contrast, zip-1p::ZIP-1::GFP is expressed prominently in epidermal nuclei when the IPR is genetically activated by loss of the IPR inhibitor PALS-22 (Gang et al., 2022). To better understand the roles ZIP-1 has in the intestine and the epidermis, we developed tissue-specific ZIP-1 expression strains. We generated single-copy transgenic strains with ZIP-1::GFP expression under the control of the vha-6p intestinal-specific promoter or the dpy-7p epidermal-specific promoter. ZIP-1 expression in these strains was compared against zip-1p::ZIP-1::GFP (Figure 1A). Given that zip-1 mRNA is also upregulated by IPR triggers, these tissue-specific ZIP-1 strains also allowed us to investigate whether ZIP-1 protein levels might be induced by IPR triggers independently of the zip-1 promoter.
Similar to zip-1p::ZIP-1::GFP, we observed no expression of vha-6p::ZIP-1::GFP or dpy-7p::ZIP-1::GFP under baseline conditions (Figure 1B). However, when we treated animals with bortezomib for 4 h, we saw vha-6p::ZIP-1::GFP expression in intestinal nuclei, and dpy-7p::ZIP-1::GFP expression in epidermal nuclei after bortezomib treatment (Figure 1B). The bortezomib-induced expression of nuclear ZIP-1::GFP in the tissue-specific strains is consistent with our observations using endogenously tagged protein (Figure 1B), which was previously reported (Lazetic et al., 2022). Thus, the intestinal-specific and epidermal-specific promoters drive expression in the expected tissues, and these results indicate that ZIP-1::GFP protein expression can be induced by bortezomib independently of the zip-1 promoter. Under the control of constitutively active tissue-specific promoters, absence of ZIP-1 protein expression at baseline suggests that ZIP-1 protein is basally degraded. This degradation is mediated either directly or indirectly by the proteasome, as proteasomal blockade results in stabilization and nuclear expression of ZIP-1.
We next examined ZIP-1::GFP expression with these transgenes in a zip-1(jy13) null mutant background. Similar to the wild-type background, vha-6p::ZIP-1::GFP was induced in intestinal nuclei upon 4 h bortezomib treatment in a zip-1 mutant background (Figure 1C). In contrast, dpy-7p::ZIP-1::GFP was not induced upon 4 h bortezomib treatment in a zip-1(jy13) mutant background (Figure 1C), unlike in the wild-type background. Given that endogenous zip-1p::ZIP-1::GFP is induced in the intestine by bortezomib, we hypothesized that bortezomib first affects the intestine, where wild-type intestinal ZIP-1 might be required to signal to the epidermis to induce epidermal ZIP-1::GFP expression. To investigate this possibility, we performed a time-course analysis to assess where and when ZIP-1::GFP is expressed after bortezomib treatment (Figure 1D). Here we found that zip-1p::ZIP-1::GFP is induced first in intestinal nuclei, and then later in epidermal nuclei. Intestinal nuclear expression is observed in roughly 50% of animals after 2 h of treatment. Similar levels of epidermal nuclear expression are only observed after 6 h of bortezomib treatment. Furthermore, all cases of epidermal nuclear expression were observed in animals that also had intestinal ZIP-1::GFP nuclear localization. Epidermal nuclear expression alone was not observed. This result is consistent with the model that intestinal ZIP-1 is required to send a signal to the epidermis to induce ZIP-1::GFP, although the specific tissue in which ZIP-1 is required for this signaling has not yet been investigated.
We next tested whether these tissue-specific ZIP-1::GFP expression constructs could rescue mRNA expression of the IPR gene pals-5 in zip-1(jy13) mutants. zip-1(jy13) mutants are defective in inducing pals-5 mRNA after 30 minutes of bortezomib treatment. Previous results using qRT-PCR with tissue-specific RNAi suggested that ZIP-1 was required in the intestine, but not the epidermis, for this effect (Lazetic et al., 2022). Here we found that intestinal-specific vha-6p::ZIP-1::GFP expression was sufficient to rescue the pals-5 gene induction defect of zip-1(jy13) mutants (Figure 1E). Furthermore, intestinal-specific rescue of zip-1 resulted in significantly increased expression of another IPR gene, skr-5, over wild-type and over zip-1(jy13) mutant levels. Surprisingly, epidermal-specific dpy-7p::ZIP-1::GFP expression appeared sufficient to rescue pals-5 induction, although the effect was not significant (Figure 1E). Thus, epidermal expression of ZIP-1 may be sufficient, but not required for inducing pals-5 mRNA expression. Of note, previous work showed a partial, non-significant reduction in pals-5 induction with epidermal-specific zip-1 RNAi (Lazetic et al., 2022).
Finally, we examined where ZIP-1 expression is sufficient to rescue the viral susceptibility of zip-1(jy13) mutants. We infected animals with the Orsay virus, and then measured viral load with qRT-PCR for the Orsay virus genomic RNA1 segment. We infected zip-1p::zip-1::gfp animals, zip-1(jy13) mutants, and zip-1(jy13) mutants rescued with vha-6p::zip-1::gfp or dpy-7p::zip-1::gfp. Upon normalizing all data to zip-1p::zip-1::gfp animals, we found that intestinal-specific vha-6p::ZIP-1::GFP expression was sufficient to rescue zip-1(jy13) mutant susceptibility to viral infection. In contrast, epidermal-specific expression of ZIP-1::GFP was not sufficient to affect resistance to viral infection in a zip-1(jy13) mutant background (Figure 1F).
In this work, we generated tissue-specific zip-1 expression and rescue strains to examine the regulation of protein expression and the tissue-specific effects of ZIP-1. We demonstrated that the regulation of ZIP-1 occurs in a promoter-independent manner, suggesting that ZIP-1 is being degraded under baseline conditions. We also observed that epidermal nuclear expression of ZIP-1 is dependent on the presence of ZIP-1 in other tissues. In assessing the tissue-specific effects of ZIP-1, we demonstrated that both intestinal and epidermal zip-1 appear sufficient to induce mRNA expression of IPR gene pals-5, whereas only intestinal zip-1 rescued viral susceptibility in zip-1(jy13) mutants. However, visible expression and subsequent upregulation of ZIP-1::GFP in a particular tissue is not necessary for IPR activation, as dpy-7p::ZIP-1::GFP in a zip-1(jy13) background displays a similar IPR activation profile following 30 minutes of bortezomib treatment to wild-type strains, despite not being visible later at 4 h. These findings support earlier findings that ZIP-1 has a functional role even when ZIP-1::GFP is not visible, and highlight the distinct roles of ZIP-1 at early and late stages of the IPR (Lazetic et al., 2022). Future studies could investigate where ZIP-1 is degraded basally – is it in the nucleus or the cytoplasm? What is the relationship between nuclear accumulation of ZIP-1 protein and IPR activation across tissues? Furthermore, we demonstrated that intestinal expression of zip-1 is sufficient for defense against the Orsay virus, an intestinal pathogen. Future studies could examine defense against other intestinal pathogens like microsporidia, as well as defense against other types of pathogens, including those that infect the epidermis.
","references":[{"reference":"Bakowski MA, Desjardins CA, Smelkinson MG, Dunbar TA, Lopez-Moyado IF, Rifkin SA, Cuomo CA, Troemel ER. 2014. Ubiquitin-Mediated Response to Microsporidia and Virus Infection in C. elegans. PLoS Pathogens 10: e1004200.
","pubmedId":"","doi":"10.1371/journal.ppat.1004200"},{"reference":"Castiglioni VG, Olmo-Uceda MaJ, Villena-Giménez A, Muñoz-Sánchez JC, Legarda EG, Elena SF. 2024. Story of an infection: Viral dynamics and host responses in the\n Caenorhabditis elegans\n –Orsay virus pathosystem. Science Advances 10: 10.1126/sciadv.adn5945.
","pubmedId":"","doi":"10.1126/sciadv.adn5945"},{"reference":"Chen K, Franz CJ, Jiang H, Jiang Y, Wang D. 2017. An evolutionarily conserved transcriptional response to viral infection in Caenorhabditis nematodes. BMC Genomics 18: 10.1186/s12864-017-3689-3.
","pubmedId":"","doi":"10.1186/s12864-017-3689-3"},{"reference":"Gang SS, Grover M, Reddy KC, Raman D, Chang YT, Ekiert DC, Barkoulas M, Troemel ER. 2022. A pals-25 gain-of-function allele triggers systemic resistance against natural pathogens of C. elegans. PLOS Genetics 18: e1010314.
","pubmedId":"","doi":"10.1371/journal.pgen.1010314"},{"reference":"Lažetić V, Wu F, Cohen LB, Reddy KC, Chang YT, Gang SS, Bhabha G, Troemel ER. 2022. The transcription factor ZIP-1 promotes resistance to intracellular infection in Caenorhabditis elegans. Nature Communications 13: 10.1038/s41467-021-27621-w.
","pubmedId":"","doi":"10.1038/s41467-021-27621-w"},{"reference":"Reddy KC, Dror T, Sowa JN, Panek J, Chen K, Lim ES, Wang D, Troemel ER. 2017. An Intracellular Pathogen Response Pathway Promotes Proteostasis in C. elegans. Current Biology 27: 3544-3553.e5.
","pubmedId":"","doi":"10.1016/j.cub.2017.10.009"},{"reference":"Sarkies P, Ashe A, Le Pen Jrm, McKie MA, Miska EA. 2013. Competition between virus-derived and endogenous small RNAs regulates gene expression inCaenorhabditis elegans. Genome Research 23: 1258-1270.
","pubmedId":"","doi":"10.1101/gr.153296.112"}],"title":"Intestinal and epidermal-specific analysis of ZIP-1 function and expression in Caenorhabditis elegans
","reviews":[],"curatorReviews":[{"curator":{"displayName":"Daniela Raciti"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Daniela Raciti"},"openAcknowledgement":true,"submitted":"1775770461234"},{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":"1776091453889"},{"curator":{"displayName":"Daniela Raciti"},"openAcknowledgement":false,"submitted":null}]},{"id":"b4570bf6-0abe-4ebb-876b-6d5463dcc364","decision":"edit","abstract":"In the nematode Caenorhabditis elegans, infection with intracellular intestinal pathogens, including microsporidia and the Orsay virus, activates a transcriptional immune response called the intracellular pathogen response (IPR). Upregulation of about 1/3 of IPR genes requires a bZIP transcription factor ZIP-1. Previous work has demonstrated that ZIP-1 promotes anti-viral immunity, but how ZIP-1 protein is regulated and where it controls immune defense remains unclear. Here we show that intestinal-specific rescue of ZIP-1 drives IPR gene expression and promotes resistance to viral infection. We also show that proteasome blockade increases ZIP-1::GFP protein levels independently of the zip-1 promoter.
","acknowledgements":"We thank Lakshmi Batachari, Max Strul, and Jessica Raygoza for helpful comments on the manuscript, and Mario Bardan Sarmiento and Lakshmi Batachari for generating Orsay virus preps.
","authors":[{"affiliations":["UC San Diego, San Diego, CA, US"],"departments":["Department of Cell and Developmental Biology"],"credit":["conceptualization","investigation","writing_originalDraft","writing_reviewEditing"],"email":"jtirtorahardjo@ucsd.edu","firstName":"James A.","lastName":"Tirtorahardjo","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["UC San Diego, San Diego, CA, US","The George Washington University, Washington, DC, US"],"departments":["Department of Cell and Developmental Biology","Department of Biological Sciences"],"credit":["conceptualization","fundingAcquisition","investigation","writing_reviewEditing"],"email":"vladimir.lazetic@email.gwu.edu","firstName":"Vladimir","lastName":"Lažetić","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":" https://orcid.org/0000-0001-5825-6584 "},{"affiliations":["UC San Diego, San Diego, CA, US"],"departments":["Department of Cell and Developmental Biology"],"credit":["conceptualization","fundingAcquisition","supervision","writing_originalDraft","writing_reviewEditing"],"email":"etroemel@ucsd.edu","firstName":"Emily R.","lastName":"Troemel","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0003-2422-0473"}],"awards":[{"awardId":"2301657","funderName":"National Science Foundation (United States)","awardRecipient":"Emily R. Troemel"},{"awardId":"AI176639","funderName":"National Institute of Allergy and Infectious Diseases (United States)","awardRecipient":"Emily R. Troemel"},{"awardId":"GM114139","funderName":"National Institute of General Medical Sciences (United States)","awardRecipient":"Emily R. Troemel"},{"awardId":"AG052622","funderName":"National Institute of Aging","awardRecipient":"Emily R. Troemel"},{"awardId":"19POST34460023","funderName":"American Heart Association (United States)","awardRecipient":"Vladimir Lazetic"},{"awardId":"P40 OD010440","funderName":"NIH Office of Research Infrastructure Programs","awardRecipient":"Caenorhabditis Genetics Center (CGC)"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"pNU3111 plasmid sequence and annotation as Genbank file
","doi":"10.22002/n687b-1hr11","resourceType":"Dataset","name":"pnu3111-vlaz01-ki-of-dpy-7pzip-1gfp3xflageft-3-3utr-in-ttti5605.gb","url":"https://portal.micropublication.org/uploads/6132d400b062be67e759ab7e7d5246a8.gb"},{"description":"pNU3112 plasmid sequence and annotation as Genbank file
","doi":"10.22002/1k6z0-hf130","resourceType":"Dataset","name":"pnu3112-vlaz02-ki-of-vha-6pzip-1gfp3xflageft-3-3-utr-in-ttti5605.gb","url":"https://portal.micropublication.org/uploads/326ed500018a67704ecafe838a631efc.gb"},{"description":"Raw Data Panel D
","doi":"10.22002/azyg7-h5021","resourceType":"Dataset","name":"zip-1 GFP quant BTZ time course.prism","url":"https://portal.micropublication.org/uploads/c4da6ebd0289a42d13cb461aaa22777a.prism"},{"description":"Raw data panel E
","doi":"10.22002/y8vxr-rpy89","resourceType":"Dataset","name":"IPR qPCR in BTZ treated worms.prism","url":"https://portal.micropublication.org/uploads/c16ed23a75e2887f6c8736bbdf83e4a8.prism"},{"description":"Raw data Panel F
","doi":"10.22002/560q9-dys15","resourceType":"Dataset","name":"OV pathogen load qPCR zip-1.prism","url":"https://portal.micropublication.org/uploads/66d952a036cafb1f107befef7992da1b.prism"}],"funding":"Some strains used in this study were provided by the Caenorhabditis Genetics Center (CGC), which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). This work was supported by NIH under R01 AG052622, GM114139, AI176639 and by NSF 2301657 to E.R.T and the American Heart Association postdoctoral award 19POST34460023 to V.L.
","image":{"url":"https://portal.micropublication.org/uploads/5f21850823c2deedbf3cc5ea280ec9c6.png"},"imageCaption":"A) Diagram of zip-1::gfp constructs. Top: vha-6p drives intestinal expression, Middle: dpy-7p drives epidermal expression, Bottom: endogenous tag. 100 bp scale bars.
B) Fluorescent micrographs of ZIP-1::GFP expression in a wild-type background after 4 hours of bortezomib treatment. Merge of GFP in green, and autofluorescence in blue.
C) Fluorescent micrographs of ZIP-1::GFP expression in a zip-1(jy13) background after 4 hours of bortezomib treatment. Merge of GFP in green, autofluorescence in blue, and bright-field Nomarski.
D) Time course of ZIP-1::GFP nuclear expression during bortezomib treatment. Average of 3 independent experiments shown, with 20 worms per experiment. Error bars are standard deviation (SD).
E) IPR gene activation as quantified by qRT-PCR. Animals treated at the L4 stage with bortezomib for 30 minutes, normalized against a DMSO-treated wild-type control. Average of 3 to 6 independent experiments shown, with each experiment including 10,000 animals per replicate. Welch's T-test, unpaired, one-tailed * p<0.05. Error bars are standard error of the mean (SEM).
F) Orsay viral load as quantified by qRT-PCR of Orsay RNA1. Animals infected at the L4 stage (see Methods), quantified at 24 hpi. Average of 8 independent experiment, with each experiment including 2000 infected animals per sample. Welch's T-test, unpaired, one-tailed * p<0.05, ****p<0.0001. Error bars are SD.
B-E) All bortezomib treatments were at final concentration of 20 µM bortezomib compared to DMSO vehicle control.
B, C) Arrows indicate intestinal nuclei, arrowheads indicate epidermal nuclei. 25 µm scale bars.
","imageTitle":"Analysis of tissue-specific ZIP-1::GFP expression and function
","methods":"Table 1 | C. elegans strains and plasmids | ||
Strain | Genotype | Description | Source |
Wild type | Wild type | Troemel Lab Collection | |
Full deletion of zip-1 | Lažetić et al., 2022 | ||
Endogenous ZIP-1 tagged with GFP | Lažetić et al., 2022 | ||
knuSi895[pNU3112(vha-6p::zip-1::gfp::3xFlag::eft-3 3'UTR, unc-119(+))] II | Intestinal expression of ZIP-1::GFP in wild-type background; backcrossed to N2 | This study. pNU3112 plasmid details: https://invivobiosystems.benchling.com/s/seq-56QzKYzufpEX3HfhjBDb | |
knuSi895[pNU3112(vha-6p::zip-1::gfp::3xFlag::eft-3 3'UTR, unc-119(+))] II; zip-1(jy13) III | |||
knuSi1111[pNU3111(dpy-7p::zip-1::gfp::3xFlag::eft-3 3'UTR, unc-119(+))] II | Epidermal expression of ZIP-1::GFP in wild-type background; backcrossed to N2 | This study. pNU3111 plasmid details: https://invivobiosystems.benchling.com/s/seq-gtvMqwCerkaGCLWt9bVV | |
knuSi1111[pNU3111(dpy-7p::zip-1::gfp::3xFlag::eft-3 3'UTR, unc-119(+))] II; zip-1(jy13) III |
Table 2 | Primers | |
Gene Name | Primer Description | Sequence |
snb-1 qRT-PCR Forward | ccggataagaccatcttgacg | |
snb-1 qRT-PCR Reverse | gacgacttcatcaacctgagc | |
pals-5 qRT-PCR Forward | cattggaaagcgatattgga | |
pals-5 qRT-PCR Reverse | tctccaggcacctatcttgtag | |
skr-3 qRT-PCR Forward | ccgacagccagaaacaaatca | |
skr-3 qRT-PCR Reverse | tctgtgatggtcttggattgac | |
skr-4 qRT-PCR Forward | ccgacagccagaaacaaatca | |
skr-4 qRT-PCR Reverse | ggtcttggattggctgatcac | |
skr-5 qRT-PCR Forward | cgaagagcaagatgtcaaaattg | |
skr-5 qRT-PCR Reverse | agaagcttggattgattggca | |
cul-6 qRT-PCR Forward | ctgggcttactcacaatgcc | |
cul-6 qRT-PCR Reverse | gcagagttggcttgctgtaa | |
F26F2.1 qRT-PCR Forward | tggaaccaggtcagagacac | |
F26F2.1 qRT-PCR Reverse | ttgtgagaatttccgcgata | |
F26F2.3 qRT-PCR Forward | ggaaagggaatgcattatgg | |
F26F2.3 qRT-PCR Reverse | ccgcacggttatttctcat | |
F26F2.4 qRT-PCR Forward | caacaatacactgcggatgg | |
F26F2.4 qRT-PCR Reverse | tcgcactgttattcatctcca | |
chil-27 qRT-PCR Forward | tcaagtggaggactgcaaca | |
chil-27 qRT-PCR Reverse | tgagttattttcggtagattccagt | |
Orsay RNA1 | Orsay RNA1 qRT-PCR Forward | gacgcttccaagattggtattggt |
Orsay RNA1 | Orsay RNA1 qRT-PCR Reverse | acctcacaactgccatctaca |
zip-1::gfp | zip-1::gfp genotyping Forward | cttctggccttcctcattgat |
zip-1::gfp | zip-1::gfp genotyping Reverse | gtcttgtagttcccgtcatct |
cgcgattctcgtagatcaaac | ||
ggagttcaaagtcgctgattg |
C. elegans maintenance
C. elegans were maintained at 20°C on Escherichia coli OP50-1 plated onto Nematode Growth Media (NGM) agar plates. Strains in Table 1.
C. elegans strain generation
Plasmids containing a tissue-specific promoter driving the expression of optimized zip-1a with syntrons (Table 1) were used to carry out Mos1-mediated single copy insertion by InVivo Biosystems. Strains were backcrossed to N2 wild-type worms in the Troemel lab three times before use. Genotyping primers in Table 2.
Bortezomib treatment
Bortezomib (Selleck Chemicals), catalog number S1013 was dissolved in DMSO to generate a 10 mM stock solution, which was diluted in M9 buffer, and added to NGM plates to achieve a final concentration of 20 μM on the plates. Synchronized L1s were grown on OP50-1 until L4, then treated with bortezomib or DMSO control. Plates were dried for 20 minutes, then incubated at 20°C for 30 minutes to 6 hours. Animals were either imaged immediately, or washed off plates with M9, then stored in Tri-reagent for RNA extraction and qRT-PCR.
RNA extraction and qRT-PCR
Total RNA was isolated as previously described (Lazetic et al., 2022), then used for cDNA synthesis via the iScript cDNA kit (Bio-Rad). At least 3 independent biological replicates per group were performed in each qRT-PCR analysis using Bio-Rad CFX Connect machine with Bio-Rad CFX manager 3.1. Sequences for qRT-PCR primers are provided in Table 2. All qRT-PCR data was normalized against housekeeping gene snb-1, using the Pfaffl method (Pfaffl, 2001). For IPR activation assays, groups were normalized against a DMSO treated, N2 wild-type control. For Orsay virus infection, groups were normalized against an infected, zip-1p::zip-1::gfp control.
Orsay virus infection
Gravid adults were bleached to obtain synchronized L1 animals, which were grown on OP50-1 until L4 and then infected with a mixture of Orsay Virus, M9 buffer, and OP50-1 culture. After 24 hours at 20°C, animals were washed off plates, and RNA was extracted for cDNA synthesis and qRT-PCR.
Imaging
Imaging in Figure 1B was performed on a Zeiss AxioImager M1 compound microscope using ZEN Version 3.9.3. Imaging in Figure 1C was performed on a Zeiss LSM700 confocal microscope using ZEN 2010 Version 6.0.0.309. Image processing was done in Paint.NET Version 5.1.12.
Statistical analysis
Prism 10 was used for statistical analysis.
","reagents":"","patternDescription":"Transcriptional induction of immune genes needs to be carefully controlled to promote defense against pathogen infection, without causing collateral damage to the host. In the nematode C. elegans, infection with natural pathogens of the intestine, including species of microsporidia (intracellular fungi) and a single-stranded RNA virus known as the Orsay virus, activates a transcriptional innate immune program called the intracellular pathogen response (IPR) (Bakowski et al., 2014; Castiglioni et al., 2024; Chen et al., 2017; Reddy et al., 2019; Sarkies et al., 2013). The IPR promotes defense against infection, but IPR overactivation can slow organismal development and shorten lifespan (Reddy et al., 2019). ZIP-1 is a bZIP transcription factor that controls induction of about 1/3 of IPR genes, and promotes defense against viral infection (Lazetic et., 2022). How ZIP-1 protein expression is regulated and where ZIP-1 acts to control immunity have not been carefully explored.
Our previous data indicate that ZIP-1 can be expressed in the intestine or the epidermis, depending on the trigger. Specifically, an endogenously tagged ZIP-1::GFP protein (hereafter referred to as zip-1p::ZIP-1::GFP) is not visible under baseline conditions, but upon infection with microsporidia or the Orsay virus becomes visible in intestinal nuclei (Lazetic et al., 2022). zip-1p::ZIP-1::GFP is also visible in intestinal nuclei after 4 hours (h) of treatment with the proteasome inhibitor bortezomib, which induces mRNA expression of IPR genes, as well as zip-1 mRNA expression. In contrast, zip-1p::ZIP-1::GFP is expressed prominently in epidermal nuclei when the IPR is genetically activated by loss of the IPR inhibitor PALS-22 (Gang et al., 2022). To better understand the roles ZIP-1 has in the intestine and the epidermis, we developed tissue-specific ZIP-1 expression strains. We generated single-copy transgenic strains with ZIP-1::GFP expression under the control of the vha-6p intestinal-specific promoter or the dpy-7p epidermal-specific promoter. ZIP-1 expression in these strains was compared against zip-1p::ZIP-1::GFP (Figure 1A). Given that zip-1 mRNA is also upregulated by IPR triggers, these tissue-specific ZIP-1 strains also allowed us to investigate whether ZIP-1 protein levels might be induced by IPR triggers independently of the zip-1 promoter.
Similar to zip-1p::ZIP-1::GFP, we observed no expression of vha-6p::ZIP-1::GFP or dpy-7p::ZIP-1::GFP under baseline conditions (Figure 1B). However, when we treated animals with bortezomib for 4 h, we saw vha-6p::ZIP-1::GFP expression in intestinal nuclei, and dpy-7p::ZIP-1::GFP expression in epidermal nuclei after bortezomib treatment (Figure 1B). The bortezomib-induced expression of nuclear ZIP-1::GFP in the tissue-specific strains is consistent with our observations using endogenously tagged protein (Figure 1B), which was previously reported (Lazetic et al., 2022). Thus, the intestinal-specific and epidermal-specific promoters drive expression in the expected tissues, and these results indicate that ZIP-1::GFP protein expression can be induced by bortezomib independently of the zip-1 promoter. Under the control of constitutively active tissue-specific promoters, absence of ZIP-1 protein expression at baseline suggests that ZIP-1 protein is basally degraded. This degradation is mediated either directly or indirectly by the proteasome, as proteasomal blockade results in stabilization and nuclear expression of ZIP-1.
We next examined ZIP-1::GFP expression with these transgenes in a zip-1(jy13) null mutant background. Similar to the wild-type background, vha-6p::ZIP-1::GFP was induced in intestinal nuclei upon 4 h bortezomib treatment in a zip-1 mutant background (Figure 1C). In contrast, dpy-7p::ZIP-1::GFP was not induced upon 4 h bortezomib treatment in a zip-1(jy13) mutant background (Figure 1C), unlike in the wild-type background. Given that endogenous zip-1p::ZIP-1::GFP is induced in the intestine by bortezomib, we hypothesized that bortezomib first affects the intestine, where wild-type intestinal ZIP-1 might be required to signal to the epidermis to induce epidermal ZIP-1::GFP expression. To investigate this possibility, we performed a time-course analysis to assess where and when ZIP-1::GFP is expressed after bortezomib treatment (Figure 1D). Here we found that zip-1p::ZIP-1::GFP is induced first in intestinal nuclei, and then later in epidermal nuclei. Intestinal nuclear expression is observed in roughly 50% of animals after 2 h of treatment. Similar levels of epidermal nuclear expression are only observed after 6 h of bortezomib treatment. Furthermore, all cases of epidermal nuclear expression were observed in animals that also had intestinal ZIP-1::GFP nuclear localization. Epidermal nuclear expression alone was not observed. This result is consistent with the model that intestinal ZIP-1 is required to send a signal to the epidermis to induce ZIP-1::GFP, although the specific tissue in which ZIP-1 is required for this signaling has not yet been investigated.
We next tested whether these tissue-specific ZIP-1::GFP expression constructs could rescue mRNA expression of the IPR gene pals-5 in zip-1(jy13) mutants. zip-1(jy13) mutants are defective in inducing pals-5 mRNA after 30 minutes of bortezomib treatment. Previous results using qRT-PCR with tissue-specific RNAi suggested that ZIP-1 was required in the intestine, but not the epidermis, for this effect (Lazetic et al., 2022). Here we found that intestinal-specific vha-6p::ZIP-1::GFP expression was sufficient to rescue the pals-5 gene induction defect of zip-1(jy13) mutants (Figure 1E). Furthermore, intestinal-specific rescue of zip-1 resulted in significantly increased expression of another IPR gene, skr-5, over wild-type and over zip-1(jy13) mutant levels. Surprisingly, epidermal-specific dpy-7p::ZIP-1::GFP expression appeared sufficient to rescue pals-5 induction, although the effect was not significant (Figure 1E). Thus, epidermal expression of ZIP-1 may be sufficient, but not required for inducing pals-5 mRNA expression. Of note, previous work showed a partial, non-significant reduction in pals-5 induction with epidermal-specific zip-1 RNAi (Lazetic et al., 2022).
Finally, we examined where ZIP-1 expression is sufficient to rescue the viral susceptibility of zip-1(jy13) mutants. We infected animals with the Orsay virus, and then measured viral load with qRT-PCR for the Orsay virus genomic RNA1 segment. We infected zip-1p::zip-1::gfp animals, zip-1(jy13) mutants, and zip-1(jy13) mutants rescued with vha-6p::zip-1::gfp or dpy-7p::zip-1::gfp. Upon normalizing all data to zip-1p::zip-1::gfp animals, we found that intestinal-specific vha-6p::ZIP-1::GFP expression was sufficient to rescue zip-1(jy13) mutant susceptibility to viral infection. In contrast, epidermal-specific expression of ZIP-1::GFP was not sufficient to affect resistance to viral infection in a zip-1(jy13) mutant background (Figure 1F).
In this work, we generated tissue-specific zip-1 expression and rescue strains to examine the regulation of protein expression and the tissue-specific effects of ZIP-1. We demonstrated that the regulation of ZIP-1 occurs in a promoter-independent manner, suggesting that ZIP-1 is being degraded under baseline conditions. We also observed that epidermal nuclear expression of ZIP-1 is dependent on the presence of ZIP-1 in other tissues. In assessing the tissue-specific effects of ZIP-1, we demonstrated that both intestinal and epidermal zip-1 appear sufficient to induce mRNA expression of IPR gene pals-5, whereas only intestinal zip-1 rescued viral susceptibility in zip-1(jy13) mutants. However, visible expression and subsequent upregulation of ZIP-1::GFP in a particular tissue is not necessary for IPR activation, as dpy-7p::ZIP-1::GFP in a zip-1(jy13) background displays a similar IPR activation profile following 30 minutes of bortezomib treatment to wild-type strains, despite not being visible later at 4 h. These findings support earlier findings that ZIP-1 has a functional role even when ZIP-1::GFP is not visible, and highlight the distinct roles of ZIP-1 at early and late stages of the IPR (Lazetic et al., 2022). Future studies could investigate where ZIP-1 is degraded basally – is it in the nucleus or the cytoplasm? What is the relationship between nuclear accumulation of ZIP-1 protein and IPR activation across tissues? Furthermore, we demonstrated that intestinal expression of zip-1 is sufficient for defense against the Orsay virus, an intestinal pathogen. Future studies could examine defense against other intestinal pathogens like microsporidia, as well as defense against other types of pathogens, including those that infect the epidermis.
","references":[{"reference":"Bakowski MA, Desjardins CA, Smelkinson MG, Dunbar TA, Lopez-Moyado IF, Rifkin SA, Cuomo CA, Troemel ER. 2014. Ubiquitin-Mediated Response to Microsporidia and Virus Infection in C. elegans. PLoS Pathogens 10: e1004200.
","pubmedId":"","doi":"10.1371/journal.ppat.1004200"},{"reference":"Castiglioni VG, Olmo-Uceda MaJ, Villena-Giménez A, Muñoz-Sánchez JC, Legarda EG, Elena SF. 2024. Story of an infection: Viral dynamics and host responses in the\n Caenorhabditis elegans\n –Orsay virus pathosystem. Science Advances 10: 10.1126/sciadv.adn5945.
","pubmedId":"","doi":"10.1126/sciadv.adn5945"},{"reference":"Chen K, Franz CJ, Jiang H, Jiang Y, Wang D. 2017. An evolutionarily conserved transcriptional response to viral infection in Caenorhabditis nematodes. BMC Genomics 18: 10.1186/s12864-017-3689-3.
","pubmedId":"","doi":"10.1186/s12864-017-3689-3"},{"reference":"Gang SS, Grover M, Reddy KC, Raman D, Chang YT, Ekiert DC, Barkoulas M, Troemel ER. 2022. A pals-25 gain-of-function allele triggers systemic resistance against natural pathogens of C. elegans. PLOS Genetics 18: e1010314.
","pubmedId":"","doi":"10.1371/journal.pgen.1010314"},{"reference":"Lažetić V, Wu F, Cohen LB, Reddy KC, Chang YT, Gang SS, Bhabha G, Troemel ER. 2022. The transcription factor ZIP-1 promotes resistance to intracellular infection in Caenorhabditis elegans. Nature Communications 13: 10.1038/s41467-021-27621-w.
","pubmedId":"","doi":"10.1038/s41467-021-27621-w"},{"reference":"Reddy KC, Dror T, Sowa JN, Panek J, Chen K, Lim ES, Wang D, Troemel ER. 2017. An Intracellular Pathogen Response Pathway Promotes Proteostasis in C. elegans. Current Biology 27: 3544-3553.e5.
","pubmedId":"","doi":"10.1016/j.cub.2017.10.009"},{"reference":"Sarkies P, Ashe A, Le Pen Jrm, McKie MA, Miska EA. 2013. Competition between virus-derived and endogenous small RNAs regulates gene expression inCaenorhabditis elegans. Genome Research 23: 1258-1270.
","pubmedId":"","doi":"10.1101/gr.153296.112"},{"reference":"Pfaffl MW. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research 29: 45e-45.
","pubmedId":"","doi":"10.1093/nar/29.9.e45"}],"title":"Intestinal and epidermal-specific analysis of ZIP-1 function and expression in Caenorhabditis elegans
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Daniela Raciti"},"openAcknowledgement":false,"submitted":null}]},{"id":"767b5926-618d-4587-9d01-3530809be27b","decision":"publish","abstract":"In the nematode Caenorhabditis elegans, infection with intracellular intestinal pathogens, including microsporidia and the Orsay virus, activates a transcriptional immune response called the intracellular pathogen response (IPR). Upregulation of about 1/3 of IPR genes requires a bZIP transcription factor ZIP-1. Previous work has demonstrated that ZIP-1 promotes anti-viral immunity, but how ZIP-1 protein is regulated and where it controls immune defense remains unclear. Here we show that intestinal-specific rescue of ZIP-1 drives IPR gene expression and promotes resistance to viral infection. We also show that proteasome blockade increases ZIP-1::GFP protein levels independently of the zip-1 promoter.
","acknowledgements":"We thank Lakshmi Batachari, Max Strul, and Jessica Raygoza for helpful comments on the manuscript, and Mario Bardan Sarmiento and Lakshmi Batachari for generating Orsay virus preps.
","authors":[{"affiliations":["UC San Diego, San Diego, CA, US"],"departments":["Department of Cell and Developmental Biology"],"credit":["conceptualization","investigation","writing_originalDraft","writing_reviewEditing"],"email":"jtirtorahardjo@ucsd.edu","firstName":"James A.","lastName":"Tirtorahardjo","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["UC San Diego, San Diego, CA, US","The George Washington University, Washington, DC, US"],"departments":["Department of Cell and Developmental Biology","Department of Biological Sciences"],"credit":["conceptualization","fundingAcquisition","investigation","writing_reviewEditing"],"email":"vladimir.lazetic@email.gwu.edu","firstName":"Vladimir","lastName":"Lažetić","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":" https://orcid.org/0000-0001-5825-6584 "},{"affiliations":["UC San Diego, San Diego, CA, US"],"departments":["Department of Cell and Developmental Biology"],"credit":["conceptualization","fundingAcquisition","supervision","writing_originalDraft","writing_reviewEditing"],"email":"etroemel@ucsd.edu","firstName":"Emily R.","lastName":"Troemel","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0003-2422-0473"}],"awards":[{"awardId":"2301657","funderName":"National Science Foundation (United States)","awardRecipient":"Emily R. Troemel"},{"awardId":"AI176639","funderName":"National Institute of Allergy and Infectious Diseases (United States)","awardRecipient":"Emily R. Troemel"},{"awardId":"GM114139","funderName":"National Institute of General Medical Sciences (United States)","awardRecipient":"Emily R. Troemel"},{"awardId":"AG052622","funderName":"National Institute of Aging","awardRecipient":"Emily R. Troemel"},{"awardId":"19POST34460023","funderName":"American Heart Association (United States)","awardRecipient":"Vladimir Lazetic"},{"awardId":"P40 OD010440","funderName":"NIH Office of Research Infrastructure Programs","awardRecipient":"Caenorhabditis Genetics Center (CGC)"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"pNU3111 plasmid sequence and annotation as Genbank file
","doi":"10.22002/n687b-1hr11","resourceType":"Dataset","name":"pnu3111-vlaz01-ki-of-dpy-7pzip-1gfp3xflageft-3-3utr-in-ttti5605.gb","url":"https://portal.micropublication.org/uploads/6132d400b062be67e759ab7e7d5246a8.gb"},{"description":"pNU3112 plasmid sequence and annotation as Genbank file
","doi":"10.22002/1k6z0-hf130","resourceType":"Dataset","name":"pnu3112-vlaz02-ki-of-vha-6pzip-1gfp3xflageft-3-3-utr-in-ttti5605.gb","url":"https://portal.micropublication.org/uploads/326ed500018a67704ecafe838a631efc.gb"},{"description":"Raw Data Panel D
","doi":"10.22002/azyg7-h5021","resourceType":"Dataset","name":"zip-1 GFP quant BTZ time course.prism","url":"https://portal.micropublication.org/uploads/c4da6ebd0289a42d13cb461aaa22777a.prism"},{"description":"Raw data panel E
","doi":"10.22002/y8vxr-rpy89","resourceType":"Dataset","name":"IPR qPCR in BTZ treated worms.prism","url":"https://portal.micropublication.org/uploads/c16ed23a75e2887f6c8736bbdf83e4a8.prism"},{"description":"Raw data Panel F
","doi":"10.22002/560q9-dys15","resourceType":"Dataset","name":"OV pathogen load qPCR zip-1.prism","url":"https://portal.micropublication.org/uploads/66d952a036cafb1f107befef7992da1b.prism"}],"funding":"Some strains used in this study were provided by the Caenorhabditis Genetics Center (CGC), which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). This work was supported by NIH under R01 AG052622, GM114139, AI176639 and by NSF 2301657 to E.R.T and the American Heart Association postdoctoral award 19POST34460023 to V.L.
","image":{"url":"https://portal.micropublication.org/uploads/5f21850823c2deedbf3cc5ea280ec9c6.png"},"imageCaption":"A) Diagram of zip-1::gfp constructs. Top: vha-6p drives intestinal expression, Middle: dpy-7p drives epidermal expression, Bottom: endogenous tag. 100 bp scale bars.
B) Fluorescent micrographs of ZIP-1::GFP expression in a wild-type background after 4 hours of bortezomib treatment. Merge of GFP in green, and autofluorescence in blue.
C) Fluorescent micrographs of ZIP-1::GFP expression in a zip-1(jy13) background after 4 hours of bortezomib treatment. Merge of GFP in green, autofluorescence in blue, and bright-field Nomarski.
D) Time course of ZIP-1::GFP nuclear expression during bortezomib treatment. Average of 3 independent experiments shown, with 20 worms per experiment. Error bars are standard deviation (SD).
E) IPR gene activation as quantified by qRT-PCR. Animals treated at the L4 stage with bortezomib for 30 minutes, normalized against a DMSO-treated wild-type control. Average of 3 to 6 independent experiments shown, with each experiment including 10,000 animals per replicate. Welch's T-test, unpaired, one-tailed * p<0.05. Error bars are standard error of the mean (SEM).
F) Orsay viral load as quantified by qRT-PCR of Orsay RNA1. Animals infected at the L4 stage (see Methods), quantified at 24 hpi. Average of 8 independent experiment, with each experiment including 2000 infected animals per sample. Welch's T-test, unpaired, one-tailed * p<0.05, ****p<0.0001. Error bars are SD.
B-E) All bortezomib treatments were at final concentration of 20 µM bortezomib compared to DMSO vehicle control.
B, C) Arrows indicate intestinal nuclei, arrowheads indicate epidermal nuclei. 25 µm scale bars.
","imageTitle":"Analysis of tissue-specific ZIP-1::GFP expression and function
","methods":"Table 1 | C. elegans strains and plasmids | ||
Strain | Genotype | Description | Source |
Wild type | Wild type | Troemel Lab Collection | |
Full deletion of zip-1 | Lažetić et al., 2022 | ||
Endogenous ZIP-1 tagged with GFP | Lažetić et al., 2022 | ||
knuSi895[pNU3112(vha-6p::zip-1::gfp::3xFlag::eft-3 3'UTR, unc-119(+))] II | Intestinal expression of ZIP-1::GFP in wild-type background; backcrossed to N2 | This study. pNU3112 plasmid details: https://invivobiosystems.benchling.com/s/seq-56QzKYzufpEX3HfhjBDb | |
knuSi895[pNU3112(vha-6p::zip-1::gfp::3xFlag::eft-3 3'UTR, unc-119(+))] II; zip-1(jy13) III | |||
knuSi1111[pNU3111(dpy-7p::zip-1::gfp::3xFlag::eft-3 3'UTR, unc-119(+))] II | Epidermal expression of ZIP-1::GFP in wild-type background; backcrossed to N2 | This study. pNU3111 plasmid details: https://invivobiosystems.benchling.com/s/seq-gtvMqwCerkaGCLWt9bVV | |
knuSi1111[pNU3111(dpy-7p::zip-1::gfp::3xFlag::eft-3 3'UTR, unc-119(+))] II; zip-1(jy13) III |
Table 2 | Primers | |
Gene Name | Primer Description | Sequence |
snb-1 qRT-PCR Forward | ccggataagaccatcttgacg | |
snb-1 qRT-PCR Reverse | gacgacttcatcaacctgagc | |
pals-5 qRT-PCR Forward | cattggaaagcgatattgga | |
pals-5 qRT-PCR Reverse | tctccaggcacctatcttgtag | |
skr-3 qRT-PCR Forward | ccgacagccagaaacaaatca | |
skr-3 qRT-PCR Reverse | tctgtgatggtcttggattgac | |
skr-4 qRT-PCR Forward | ccgacagccagaaacaaatca | |
skr-4 qRT-PCR Reverse | ggtcttggattggctgatcac | |
skr-5 qRT-PCR Forward | cgaagagcaagatgtcaaaattg | |
skr-5 qRT-PCR Reverse | agaagcttggattgattggca | |
cul-6 qRT-PCR Forward | ctgggcttactcacaatgcc | |
cul-6 qRT-PCR Reverse | gcagagttggcttgctgtaa | |
F26F2.1 qRT-PCR Forward | tggaaccaggtcagagacac | |
F26F2.1 qRT-PCR Reverse | ttgtgagaatttccgcgata | |
F26F2.3 qRT-PCR Forward | ggaaagggaatgcattatgg | |
F26F2.3 qRT-PCR Reverse | ccgcacggttatttctcat | |
F26F2.4 qRT-PCR Forward | caacaatacactgcggatgg | |
F26F2.4 qRT-PCR Reverse | tcgcactgttattcatctcca | |
chil-27 qRT-PCR Forward | tcaagtggaggactgcaaca | |
chil-27 qRT-PCR Reverse | tgagttattttcggtagattccagt | |
Orsay RNA1 | Orsay RNA1 qRT-PCR Forward | gacgcttccaagattggtattggt |
Orsay RNA1 | Orsay RNA1 qRT-PCR Reverse | acctcacaactgccatctaca |
zip-1::gfp | zip-1::gfp genotyping Forward | cttctggccttcctcattgat |
zip-1::gfp | zip-1::gfp genotyping Reverse | gtcttgtagttcccgtcatct |
cgcgattctcgtagatcaaac | ||
ggagttcaaagtcgctgattg |
C. elegans maintenance
C. elegans were maintained at 20°C on Escherichia coli OP50-1 plated onto Nematode Growth Media (NGM) agar plates. Strains in Table 1.
C. elegans strain generation
Plasmids containing a tissue-specific promoter driving the expression of optimized zip-1a with syntrons (Table 1) were used to carry out Mos1-mediated single copy insertion by InVivo Biosystems. Strains were backcrossed to N2 wild-type worms in the Troemel lab three times before use. Genotyping primers in Table 2.
Bortezomib treatment
Bortezomib (Selleck Chemicals), catalog number S1013 was dissolved in DMSO to generate a 10 mM stock solution, which was diluted in M9 buffer, and added to NGM plates to achieve a final concentration of 20 μM on the plates. Synchronized L1s were grown on OP50-1 until L4, then treated with bortezomib or DMSO control. Plates were dried for 20 minutes, then incubated at 20°C for 30 minutes to 6 hours. Animals were either imaged immediately, or washed off plates with M9, then stored in Tri-reagent for RNA extraction and qRT-PCR.
RNA extraction and qRT-PCR
Total RNA was isolated as previously described (Lazetic et al., 2022), then used for cDNA synthesis via the iScript cDNA kit (Bio-Rad). At least 3 independent biological replicates per group were performed in each qRT-PCR analysis using Bio-Rad CFX Connect machine with Bio-Rad CFX manager 3.1. Sequences for qRT-PCR primers are provided in Table 2. All qRT-PCR data was normalized against housekeeping gene snb-1, using the Pfaffl method (Pfaffl, 2001). For IPR activation assays, groups were normalized against a DMSO treated, N2 wild-type control. For Orsay virus infection, groups were normalized against an infected, zip-1p::zip-1::gfp control.
Orsay virus infection
Gravid adults were bleached to obtain synchronized L1 animals, which were grown on OP50-1 until L4 and then infected with a mixture of Orsay Virus, M9 buffer, and OP50-1 culture. After 24 hours at 20°C, animals were washed off plates, and RNA was extracted for cDNA synthesis and qRT-PCR.
Imaging
Imaging in Figure 1B was performed on a Zeiss AxioImager M1 compound microscope using ZEN Version 3.9.3. Imaging in Figure 1C was performed on a Zeiss LSM700 confocal microscope using ZEN 2010 Version 6.0.0.309. Image processing was done in Paint.NET Version 5.1.12.
Statistical analysis
Prism 10 Version 10.5.0 (774) was used for statistical analysis.
","reagents":"","patternDescription":"Transcriptional induction of immune genes needs to be carefully controlled to promote defense against pathogen infection, without causing collateral damage to the host. In the nematode C. elegans, infection with natural pathogens of the intestine, including species of microsporidia (intracellular fungi) and a single-stranded RNA virus known as the Orsay virus, activates a transcriptional innate immune program called the intracellular pathogen response (IPR) (Bakowski et al., 2014; Castiglioni et al., 2024; Chen et al., 2017; Reddy et al., 2019; Sarkies et al., 2013). The IPR promotes defense against infection, but IPR overactivation can slow organismal development and shorten lifespan (Reddy et al., 2019). ZIP-1 is a bZIP transcription factor that controls induction of about 1/3 of IPR genes, and promotes defense against viral infection (Lazetic et., 2022). How ZIP-1 protein expression is regulated and where ZIP-1 acts to control immunity have not been carefully explored.
Our previous data indicate that ZIP-1 can be expressed in the intestine or the epidermis, depending on the trigger. Specifically, an endogenously tagged ZIP-1::GFP protein (hereafter referred to as zip-1p::ZIP-1::GFP) is not visible under baseline conditions, but upon infection with microsporidia or the Orsay virus becomes visible in intestinal nuclei (Lazetic et al., 2022). zip-1p::ZIP-1::GFP is also visible in intestinal nuclei after 4 hours (h) of treatment with the proteasome inhibitor bortezomib, which induces mRNA expression of IPR genes, as well as zip-1 mRNA expression. In contrast, zip-1p::ZIP-1::GFP is expressed prominently in epidermal nuclei when the IPR is genetically activated by loss of the IPR inhibitor PALS-22 (Gang et al., 2022). To better understand the roles ZIP-1 has in the intestine and the epidermis, we developed tissue-specific ZIP-1 expression strains. We generated single-copy transgenic strains with ZIP-1::GFP expression under the control of the vha-6p intestinal-specific promoter or the dpy-7p epidermal-specific promoter. ZIP-1 expression in these strains was compared against zip-1p::ZIP-1::GFP (Figure 1A). Given that zip-1 mRNA is also upregulated by IPR triggers, these tissue-specific ZIP-1 strains also allowed us to investigate whether ZIP-1 protein levels might be induced by IPR triggers independently of the zip-1 promoter.
Similar to zip-1p::ZIP-1::GFP, we observed no expression of vha-6p::ZIP-1::GFP or dpy-7p::ZIP-1::GFP under baseline conditions (Figure 1B). However, when we treated animals with bortezomib for 4 h, we saw vha-6p::ZIP-1::GFP expression in intestinal nuclei, and dpy-7p::ZIP-1::GFP expression in epidermal nuclei after bortezomib treatment (Figure 1B). The bortezomib-induced expression of nuclear ZIP-1::GFP in the tissue-specific strains is consistent with our observations using endogenously tagged protein (Figure 1B), which was previously reported (Lazetic et al., 2022). Thus, the intestinal-specific and epidermal-specific promoters drive expression in the expected tissues, and these results indicate that ZIP-1::GFP protein expression can be induced by bortezomib independently of the zip-1 promoter. Under the control of constitutively active tissue-specific promoters, absence of ZIP-1 protein expression at baseline suggests that ZIP-1 protein is basally degraded. This degradation is mediated either directly or indirectly by the proteasome, as proteasomal blockade results in stabilization and nuclear expression of ZIP-1.
We next examined ZIP-1::GFP expression with these transgenes in a zip-1(jy13) null mutant background. Similar to the wild-type background, vha-6p::ZIP-1::GFP was induced in intestinal nuclei upon 4 h bortezomib treatment in a zip-1 mutant background (Figure 1C). In contrast, dpy-7p::ZIP-1::GFP was not induced upon 4 h bortezomib treatment in a zip-1(jy13) mutant background (Figure 1C), unlike in the wild-type background. Given that endogenous zip-1p::ZIP-1::GFP is induced in the intestine by bortezomib, we hypothesized that bortezomib first affects the intestine, where wild-type intestinal ZIP-1 might be required to signal to the epidermis to induce epidermal ZIP-1::GFP expression. To investigate this possibility, we performed a time-course analysis to assess where and when ZIP-1::GFP is expressed after bortezomib treatment (Figure 1D). Here we found that zip-1p::ZIP-1::GFP is induced first in intestinal nuclei, and then later in epidermal nuclei. Intestinal nuclear expression is observed in roughly 50% of animals after 2 h of treatment. Similar levels of epidermal nuclear expression are only observed after 6 h of bortezomib treatment. Furthermore, all cases of epidermal nuclear expression were observed in animals that also had intestinal ZIP-1::GFP nuclear localization. Epidermal nuclear expression alone was not observed. This result is consistent with the model that intestinal ZIP-1 is required to send a signal to the epidermis to induce ZIP-1::GFP, although the specific tissue in which ZIP-1 is required for this signaling has not yet been investigated.
We next tested whether these tissue-specific ZIP-1::GFP expression constructs could rescue mRNA expression of the IPR gene pals-5 in zip-1(jy13) mutants. zip-1(jy13) mutants are defective in inducing pals-5 mRNA after 30 minutes of bortezomib treatment. Previous results using qRT-PCR with tissue-specific RNAi suggested that ZIP-1 was required in the intestine, but not the epidermis, for this effect (Lazetic et al., 2022). Here we found that intestinal-specific vha-6p::ZIP-1::GFP expression was sufficient to rescue the pals-5 gene induction defect of zip-1(jy13) mutants (Figure 1E). Furthermore, intestinal-specific rescue of zip-1 resulted in significantly increased expression of another IPR gene, skr-5, over wild-type and over zip-1(jy13) mutant levels. Surprisingly, epidermal-specific dpy-7p::ZIP-1::GFP expression appeared sufficient to rescue pals-5 induction, although the effect was not significant (Figure 1E). Thus, epidermal expression of ZIP-1 may be sufficient, but not required for inducing pals-5 mRNA expression. Of note, previous work showed a partial, non-significant reduction in pals-5 induction with epidermal-specific zip-1 RNAi (Lazetic et al., 2022).
Finally, we examined where ZIP-1 expression is sufficient to rescue the viral susceptibility of zip-1(jy13) mutants. We infected animals with the Orsay virus, and then measured viral load with qRT-PCR for the Orsay virus genomic RNA1 segment. We infected zip-1p::zip-1::gfp animals, zip-1(jy13) mutants, and zip-1(jy13) mutants rescued with vha-6p::zip-1::gfp or dpy-7p::zip-1::gfp. Upon normalizing all data to zip-1p::zip-1::gfp animals, we found that intestinal-specific vha-6p::ZIP-1::GFP expression was sufficient to rescue zip-1(jy13) mutant susceptibility to viral infection. In contrast, epidermal-specific expression of ZIP-1::GFP was not sufficient to affect resistance to viral infection in a zip-1(jy13) mutant background (Figure 1F).
In this work, we generated tissue-specific zip-1 expression and rescue strains to examine the regulation of protein expression and the tissue-specific effects of ZIP-1. We demonstrated that the regulation of ZIP-1 occurs in a promoter-independent manner, suggesting that ZIP-1 is being degraded under baseline conditions. We also observed that epidermal nuclear expression of ZIP-1 is dependent on the presence of ZIP-1 in other tissues. In assessing the tissue-specific effects of ZIP-1, we demonstrated that both intestinal and epidermal zip-1 appear sufficient to induce mRNA expression of IPR gene pals-5, whereas only intestinal zip-1 rescued viral susceptibility in zip-1(jy13) mutants. However, visible expression and subsequent upregulation of ZIP-1::GFP in a particular tissue is not necessary for IPR activation, as dpy-7p::ZIP-1::GFP in a zip-1(jy13) background displays a similar IPR activation profile following 30 minutes of bortezomib treatment to wild-type strains, despite not being visible later at 4 h. These findings support earlier findings that ZIP-1 has a functional role even when ZIP-1::GFP is not visible, and highlight the distinct roles of ZIP-1 at early and late stages of the IPR (Lazetic et al., 2022). Future studies could investigate where ZIP-1 is degraded basally – is it in the nucleus or the cytoplasm? What is the relationship between nuclear accumulation of ZIP-1 protein and IPR activation across tissues? Furthermore, we demonstrated that intestinal expression of zip-1 is sufficient for defense against the Orsay virus, an intestinal pathogen. Future studies could examine defense against other intestinal pathogens like microsporidia, as well as defense against other types of pathogens, including those that infect the epidermis.
","references":[{"reference":"Bakowski MA, Desjardins CA, Smelkinson MG, Dunbar TA, Lopez-Moyado IF, Rifkin SA, Cuomo CA, Troemel ER. 2014. Ubiquitin-Mediated Response to Microsporidia and Virus Infection in C. elegans. PLoS Pathogens 10: e1004200.
","pubmedId":"","doi":"10.1371/journal.ppat.1004200"},{"reference":"Castiglioni VG, Olmo-Uceda MaJ, Villena-Giménez A, Muñoz-Sánchez JC, Legarda EG, Elena SF. 2024. Story of an infection: Viral dynamics and host responses in the\n Caenorhabditis elegans\n –Orsay virus pathosystem. Science Advances 10: 10.1126/sciadv.adn5945.
","pubmedId":"","doi":"10.1126/sciadv.adn5945"},{"reference":"Chen K, Franz CJ, Jiang H, Jiang Y, Wang D. 2017. An evolutionarily conserved transcriptional response to viral infection in Caenorhabditis nematodes. BMC Genomics 18: 10.1186/s12864-017-3689-3.
","pubmedId":"","doi":"10.1186/s12864-017-3689-3"},{"reference":"Gang SS, Grover M, Reddy KC, Raman D, Chang YT, Ekiert DC, Barkoulas M, Troemel ER. 2022. A pals-25 gain-of-function allele triggers systemic resistance against natural pathogens of C. elegans. PLOS Genetics 18: e1010314.
","pubmedId":"","doi":"10.1371/journal.pgen.1010314"},{"reference":"Lažetić V, Wu F, Cohen LB, Reddy KC, Chang YT, Gang SS, Bhabha G, Troemel ER. 2022. The transcription factor ZIP-1 promotes resistance to intracellular infection in Caenorhabditis elegans. Nature Communications 13: 10.1038/s41467-021-27621-w.
","pubmedId":"","doi":"10.1038/s41467-021-27621-w"},{"reference":"Reddy KC, Dror T, Sowa JN, Panek J, Chen K, Lim ES, Wang D, Troemel ER. 2017. An Intracellular Pathogen Response Pathway Promotes Proteostasis in C. elegans. Current Biology 27: 3544-3553.e5.
","pubmedId":"","doi":"10.1016/j.cub.2017.10.009"},{"reference":"Sarkies P, Ashe A, Le Pen Jrm, McKie MA, Miska EA. 2013. Competition between virus-derived and endogenous small RNAs regulates gene expression inCaenorhabditis elegans. Genome Research 23: 1258-1270.
","pubmedId":"","doi":"10.1101/gr.153296.112"},{"reference":"Pfaffl MW. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research 29: 45e-45.
","pubmedId":"","doi":"10.1093/nar/29.9.e45"}],"title":"Intestinal and epidermal-specific analysis of ZIP-1 function and expression in Caenorhabditis elegans
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Daniela Raciti"},"openAcknowledgement":false,"submitted":null}]}]}},"species":{"species":[{"value":"acer saccharum","label":"Acer saccharum","imageSrc":"","imageAlt":"","mod":"TreeGenes","modLink":"https://treegenesdb.org","linkVariable":""},{"value":"achillea millefolium","label":"Achillea millefolium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"acinetobacter baylyi","label":"Acinetobacter baylyi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"actinobacteria bacterium","label":"Actinobacteria bacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adelges tsugae","label":"Adelges tsugae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adenocaulon chilense","label":"Adenocaulon chilense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aedes japonicus","label":"Aedes japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aegorhinus vitulus","label":"Aegorhinus vitulus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alaimidae","label":"Alaimidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"allobates femoralis","label":"Allobates femoralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alnus glutinosa","label":"Alnus glutinosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa aestivalis","label":"Alosa aestivalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa pseudoharengus","label":"Alosa pseudoharengus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alternaria alternata","label":"Alternaria alternata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"amynthas agrestis","label":"Amynthas Agrestis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma caninum","label":"Ancylostoma caninum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma ceylanicum","label":"Ancylostoma ceylanicum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anemone multifida","label":"Anemone multifida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anguilla rostrata","label":"Anguilla rostrata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anisakis simplex","label":"Anisakis simplex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anomala albopilosa","label":"Anomala albopilosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arabidopsis","label":"Arabidopsis","imageSrc":"arabidopsis.png","imageAlt":"Arabidopsis graphic by Zoe Zorn CC BY 4.0","mod":"TAIR","modLink":"https://arabidopsis.org","linkVariable":""},{"value":"architeuthis dux","label":"Architeuthis dux","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arion vulgaris","label":"Arion vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"armeria","label":"Armeria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"artemia","label":"Artemia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arthrobacter sp.","label":"Arthrobacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia","label":"Ascaridia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia galli","label":"Ascaridia galli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"asparagopsis taxiformis","label":"Asparagopsis taxiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"astatotilapia burtoni","label":"Astatotilapia burtoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"avena sativa","label":"Avena sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aves","label":"Aves","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus","label":"Bacillus (firmicutes)","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus cereus","label":"Bacillus cereus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus mycoides","label":"Bacillus mycoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus subtilis","label":"Bacillus subtilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus thuringiensis","label":"Bacillus thuringiensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus toyonensis","label":"Bacillus toyonensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus wiedmannii","label":"Bacillus wiedmannii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteria","label":"Bacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteriophage","label":"Bacteriophage","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bactrocera","label":"Bactrocera sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"batrachospermum gelatinosum","label":"Batrachospermum gelatinosum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula lenta","label":"Betula lenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula nigra","label":"Betula nigra","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus dahlbohmii","label":"Bombus dahlbohmii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus terrestris","label":"Bombus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombyx mori","label":"Bombyx mori","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bos taurus","label":"Bos Taurus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brachygobius doriae","label":"Brachygobius doriae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica oleracea","label":"Brassica oleracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica rapa","label":"Brassica rapa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brugia malayi","label":"Brugia malayi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"burkholderia thailandensis","label":"Burkholderia thailandensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"buttiauxella","label":"Buttiauxella","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis brenneri","label":"Caenorhabditis brenneri","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis briggsae","label":"Caenorhabditis briggsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"c. elegans","label":"Caenorhabditis elegans","imageSrc":"c-elegans.jpg","imageAlt":"C. elegans graphic by Zoe Zorn CC BY 4.0","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"caenorhabditis inopinata","label":"Caenorhabditis inopinata","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis japonica","label":"Caenorhabditis japonica","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis nigoni","label":"Caenorhabditis nigoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis remanei","label":"Caenorhabditis remanei","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis tropicalis","label":"Caenorhabditis tropicalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus","label":"Calidifontibacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus erzuremensis","label":"Calidifontibacillus erzuremensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calliphora sp","label":"Calliphora sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caltha sagittata","label":"Caltha sagittata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cambarus latimanus","label":"Cambarus latimanus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"candida albicans","label":"Candida albicans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"canis familiaris","label":"Canis familiaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cannabis sativa","label":"Cannabis sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caretta caretta","label":"Caretta caretta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cassiopea xamachana","label":"Cassiopea xamachana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caulobacter vibrioides","label":"Caulobacter vibrioides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cephalopods","label":"Cephalopoda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cerastium arvense","label":"Cerastium arvense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceriodaphnia","label":"Ceriodaphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceroglossus suturalis","label":"Ceroglossus suturalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chaetoceros","label":"Chaetoceros","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chamaecrista fasciculata","label":"Chamaecrista fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chilicola chalcidiformis","label":"Chilicola chalcidiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chitinimonas","label":"Chitinimonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chlamydomonas reinhardtii","label":"Chlamydomonas reinhardtii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chromobacterium","label":"Chromobacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysemys picta","label":"Chrysemys picta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysoperla rufilabris","label":"Chrysoperla rufilabris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"citrus","label":"Citrus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"clavibacter sp.","label":"Clavibacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"colinus virginianus","label":"Colinus virginianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crassostrea virginica","label":"Crassostrea virginica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crithidia fasciculata","label":"Crithidia fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cutibacterium acnes","label":"Cutibacterium acnes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cyanobacteria","label":"Cyanobacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia","label":"Daphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia pulex","label":"Daphnia pulex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera","label":"Diabrotica virgifera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera virgifera virus 1","label":"Diabrotica virgifera virgifera virus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"d. discoideum","label":"Dictyostelium discoideum","imageSrc":"dicty.png","imageAlt":"D. discoideum","mod":"dictyBase","modLink":"http://dictybase.org","linkVariable":""},{"value":"diptera","label":"Diptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dotocryptus bellicosus","label":"Dotocryptus bellicosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drechmeria coniospora","label":"Drechmeria coniospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drosophila","label":"Drosophila","imageSrc":"drosophila.png","imageAlt":"Drosophila graphic by Zoe Zorn CC BY 4.0","mod":"FlyBase","modLink":"https://flybase.org/doi/","linkVariable":"doi"},{"value":"dryopteris campyloptera","label":"Dryopteris campyloptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris expansa","label":"Dryopteris expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris intermedia","label":"Dryopteris intermedia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dugesia dorotocephala","label":"Dugesia dorotocephala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"elasmobranchii","label":"Elasmobranchii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"embryophyta","label":"Embryophyta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enoploteuthis chunii","label":"Enoploteuthis chunii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterobacter aerogenes","label":"Enterobacter aerogenes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterococcus raffinosus","label":"Enterococcus raffinosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"epichloë coenophiala","label":"Epichloë coenophiala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"equus caballus","label":"Equus caballus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erigeron sp","label":"Erigeron sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eristalis","label":"Eristalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eruca vesicaria","label":"Eruca vesicaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erwinia carotovora","label":"Erwinia carotovora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erythronium americanum","label":"Erythronium americanum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"escherichia coli","label":"Escherichia coli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eukaryota","label":"Eukaryotes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"felis catus","label":"Felis catus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella novicida","label":"Francisella novicida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella tularensis","label":"Francisella tularensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fraxinus americana","label":"Fraxinus americana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fucus distichus","label":"Fucus distichus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fungi","label":"Fungi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gasteropelecus sp.","label":"Gasteropelecus sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"geranium sp","label":"Geranium sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"girardia","label":"Girardia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glaucomys volans","label":"Glaucomys volans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glycine max","label":"Glycine max","imageSrc":"","imageAlt":"","mod":"Soybase","modLink":"https://soybase.org","linkVariable":""},{"value":"glyptemys insculpta","label":"Glyptemys insculpta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gossypium hirsutum","label":"Gossypium hirsutum","imageSrc":"","imageAlt":"","mod":"CottonGen","modLink":"https://www.cottongen.org/","linkVariable":""},{"value":"gromphadorhina portentosa","label":"Gromphadorhina portentosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gryllodes sigillatus","label":"Gryllodes sigillatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"haliotis rufescens","label":"Haliotis rufescens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hepacivirus hominis","label":"Hepatitis C Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"herpes simplex virus type 1","label":"Herpes simplex virus type 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human","label":"Human","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human coronavirus oc43","label":"Human coronavirus OC43","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydra vulgaris","label":"Hydra vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydropsyche sp","label":"Hydropsyche sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hymenoptera","label":"Hymenoptera","imageSrc":"","imageAlt":"","mod":"Hymenoptera Genome Database","modLink":"https://hymenoptera.elsiklab.missouri.edu/","linkVariable":""},{"value":"hypochaeris radicata","label":"Hypochaeris radicata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hypodynerus vespiformis","label":"Hypodynerus vespiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflaviridae","label":"Iflaviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflavuris","label":"Iflavirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ipomoea hederacea","label":"Ipomoea hederacea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera","label":"Ischnomera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera ruficollis","label":"Ischnomera ruficollis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"julidochromis marlieri","label":"Julidochromis marlieri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"juniperus virginiana","label":"Juniperus virginiana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"kluyveromyces marxianus","label":"Kluyveromyces marxianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"l. casei","label":"L. casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lacticaseibacillus casei","label":"Lacticaseibacillus casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"larentiinae sp","label":"Larentiinae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"laurus nobilis","label":"Laurus nobilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lepidoptera","label":"Lepidoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"leucanthemum vulgare","label":"Leucanthemum vulgare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"linepithema humile","label":"Linepithema humile","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"liometopum occidentale","label":"Liometopum occidentale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lolium arundinaceum","label":"Lolium arundinaceum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbriculus variegatus","label":"Lumbriculus variegatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbricus terrestris","label":"Lumbricus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lupinus polyphyllus","label":"Lupinus polyphyllus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lycorma delicatula","label":"Lycorma delicatula","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lynx rufus","label":"Lynx rufus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"magnaporthe oryzae","label":"Magnaporthe oryzae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mammalia","label":"Mammalia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"manihot esculenta","label":"Manihot esculenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"medicago lupulina","label":"Medicago lupulina","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"meloidogyne","label":"Meloidogyne","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mimus polyglottos","label":"Mimus polyglottos","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bryophyta","label":"Mosses","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mouse","label":"Mouse","imageSrc":"","imageAlt":"","mod":"MGI","modLink":"https://informatics.jax.org","linkVariable":""},{"value":"m. minutoides","label":"Mus minutoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mycobacterium smegmatis","label":"Mycobacterium smegmatis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nakaseomyces glabratus","label":"Nakaseomyces glabratus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nauphoeta cinerea","label":"Nauphoeta cinerea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"neurospora","label":"Neurospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"n. benthamiana","label":"Nicotiana benthamiana","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/Nicotiana_benthamiana/genome","linkVariable":""},{"value":"nicotiana tabacum","label":"Nicotiana tabacum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae","label":"Noctuidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae sp","label":"Noctuidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nothobranchius furzeri","label":"Nothobranchius furzeri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"onchocerca volvulus","label":"Onchocerca volvulus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"orconectes virilis","label":"Orconectes virilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ormia ochracea","label":"Ormia ochracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"o. sativa","label":"Oryza sativa","imageSrc":"","imageAlt":"","mod":"Gramene","modLink":"https://www.gramene.org/","linkVariable":""},{"value":"other","label":"Other","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"oxalis enneaphylla","label":"Oxalis enneaphylla","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea","label":"Pantoea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea agglomerans","label":"Pantoea agglomerans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"papaver sp","label":"Papaver sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paramecium bursaria","label":"Paramecium bursaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"partitiviridae","label":"Partitiviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pelodiscus sinensis","label":"Pelodiscus sinensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"perezia recurvata","label":"Perezia recurvata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"petromyzon marinus","label":"Petromyzon marinus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis","label":"Photinus pyralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis associated partiti-like virus","label":"Photinus pyralis associated partiti-like virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis iflavirus 1","label":"Photinus pyralis iflavirus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"physcomitrium patens","label":"Physcomitrium patens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus strobus","label":"Pinus strobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus taeda","label":"Pinus taeda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"platycheirus","label":"Platycheirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"plectus sambesii","label":"Plectus sambesii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pogonomyrmex occidentalis","label":"Pogonomyrmex occidentalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"poncirus trifoliata","label":"Poncirus trifoliata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"populus deltoides","label":"Populus deltoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"potato virus y","label":"Potato virus Y","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"primula magellanica","label":"Primula magellanica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pristionchus pacificus","label":"Pristionchus pacificus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"prunus persica","label":"Prunus persica","imageSrc":"","imageAlt":"","mod":"Genome Database for Rosaceae","modLink":"https://www.rosaceae.org/","linkVariable":""},{"value":"psalmopoeus iriminia","label":"Psalmopoeus iriminia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudanabaena sp.","label":"Pseudanabaena sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas","label":"Pseudomonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas aeruginosa","label":"Pseudomonas aeruginosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas glycinae","label":"Pseudomonas glycinae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas putida","label":"Pseudomonas putida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas syringae","label":"Pseudomonas syringae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pterophyllum scalare","label":"Pterophyllum scalare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"python regius","label":"Python regius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"quercus macrocarpa","label":"Quercus macrocarpa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ralstonia solanacearum","label":"Ralstonia solanacearum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranitomeya imitator","label":"Ranitomeya imitator","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranunculus peduncularis","label":"Ranunculus peduncularis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"rat","label":"Rat","imageSrc":"","imageAlt":"","mod":"RGD","modLink":"https://rgd.mcw.edu","linkVariable":""},{"value":"rheinheimera","label":"Rheinheimera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ribes rubrum","label":"Ribes rubrum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"sars-cov-2","label":"SARS-CoV-2","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. cerevisiae","label":"Saccharomyces cerevisiae","imageSrc":"yeast.png","imageAlt":"Yeast graphic by Zoe Zorn CC BY 4.0","mod":"SGD","modLink":"https://yeastgenome.org","linkVariable":""},{"value":"saccharomyces paradoxus","label":"Saccharomyces paradoxus ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. uvarum","label":"Saccharomyces uvarum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schistosoma","label":"Schistosoma","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schizosaccharomyces japonicus","label":"Schizosaccharomyces japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. pombe","label":"Schizosaccharomyces pombe","imageSrc":"pombe.png","imageAlt":"Pombe graphic by Zoe Zorn © Caltech","mod":"PomBase","modLink":"https://www.pombase.org/reference/PMID:","linkVariable":"pmId"},{"value":"schmidtea mediterranea","label":"Schmidtea mediterranea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"senecio sp","label":"Senecio sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"simocephalus","label":"Simocephalus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"siraitia grosvenorii","label":"Siraitia grosvenorii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"solanum lycopersicum","label":"Solanum lycopersicum","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/1/view/","linkVariable":""},{"value":"sorghum","label":"Sorghum","imageSrc":"","imageAlt":"","mod":"SorghumBase","modLink":"https://www.sorghumbase.org","linkVariable":""},{"value":"spiroplasma eriocheiris","label":"Spiroplasma eriocheiris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus aureus","label":"Staphylococcus aureus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus epidermidis","label":"Staphylococcus epidermidis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"steinernema carpocapsae","label":"Steinernema carpocapsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"steinernema hermaphroditum","label":"Steinernema hermaphroditum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stenotrophomonas geniculata","label":"Stenotrophomonas geniculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus gordonii ","label":"Streptococcus gordonii ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus mutans","label":"Streptococcus mutans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":" streptococcus pneumoniae","label":"Streptococcus pneumoniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. purpuratus","label":"Strongylocentrotus purpuratus","imageSrc":"","imageAlt":"","mod":"Echinobase","modLink":"https://www.echinobase.org","linkVariable":""},{"value":"strongyloides ratti","label":"Strongyloides ratti","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"sulfolobus","label":"Sulfolobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"symphoricarpos albus","label":"Symphoricarpos albus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syncirsodes","label":"Syncirsodes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"synechococcus elongatus","label":"Synechococcus elongatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syrphidae","label":"Syrphidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tarantobelus jeffdanielsi","label":"Tarantobelus jeffdanielsi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"taraxacum officinale","label":"Taraxacum officinale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tatochila theodice","label":"Tatochila theodice","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetrahymena","label":"Tetrahymena","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetramorium immigrans","label":"Tetramorium immigrans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tomato brown rugose fruit virus","label":"ToBRFV","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trachemys scripta","label":"Trachemys scripta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tribolium castaneum","label":"Tribolium castaneum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichoptera","label":"Trichoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichuris muris","label":"Trichuris muris","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"trifolium repens","label":"Trifolium repens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trypoxylus dichotomus","label":"Trypoxylus dichotomus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tsuga canadensis","label":"Tsuga canadensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ulva expansa","label":"Ulva expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"universal","label":"Universal","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"vargula hilgendorfii","label":"Vargula hilgendorfii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"vespula vulgaris","label":"Vespula vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"virus","label":"Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"watasenia scintillans","label":"Watasenia scintillans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"wolbachia pipientis","label":"Wolbachia pipientis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"xenopus","label":"Xenopus","imageSrc":"xenopus.png","imageAlt":"Xenopus graphic by Zoe Zorn CC BY 4.0","mod":"XenBase","modLink":"https://xenbase.org","linkVariable":""},{"value":"xenorhabdus griffiniae","label":"Xenorhabdus griffiniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"yramea cytheris","label":"Yramea cytheris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zaprionus indianus","label":"Zaprionus indianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zea mays","label":"Zea mays","imageSrc":"","imageAlt":"","mod":"MaizeGDB","modLink":"https://www.maizegdb.org","linkVariable":""},{"value":"zebrafish","label":"Zebrafish","imageSrc":"zebrafish.png","imageAlt":"Zebrafish graphic by Zoe Zorn CC BY 4.0","mod":"ZFIN","modLink":"https://zfin.org","linkVariable":""}]}},"pageContext":{"id":"fddeadf9-0c8f-40f2-b5a0-26518b1a327d","citedBy":[],"parsedCsv":{"csvHeader":[],"csvData":[]}}}, "staticQueryHashes": ["2114697108"]}