The evolutionarily conserved RNA-binding protein Muscleblind can function as both a splicing regulator in the nucleus and a mRNA stabilizer in the cytosol. C. elegans mbl-1/Muscleblind undergoes alternative splicing to generate long and short isoforms that contain one or two KR motifs needed for nuclear localization. We generate three alleles that express MBL-1 proteins with two, one, or no KR motifs and find that the proteins with two KR motifs are restricted in the nucleus and could not promote neurite growth in a sensitized background. Surprisingly, proteins with one or no KR motifs are located in both cytoplasm and nucleus.
","acknowledgements":"We thank the National BioResource Project (NBRP), which is funded by the Japanese government, for providing strains.
","authors":[{"affiliations":["The University of Hong Kong"],"departments":["School of Biological Sciences"],"credit":["investigation","formalAnalysis","dataCuration","validation","visualization","writing_originalDraft"],"email":"tlhm20@connect.hku.hk","firstName":"Ho Ming Terence","lastName":"Lee","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["The University of Hong Kong"],"departments":["School of Biological Sciences"],"credit":["fundingAcquisition","conceptualization","project","supervision","writing_reviewEditing"],"email":"cgzheng@hku.hk","firstName":"Chaogu","lastName":"Zheng","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0002-5048-4520"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":null,"extendedData":[],"funding":"This work is supported by the Research Grants Council of Hong Kong (GRF 17106322).
","image":{"url":"https://portal.micropublication.org/uploads/2c73b4bf11c34a9e4562b423622d9ab7.jpg"},"imageCaption":"(A) Gene structure of mbl-1 and the molecular change of various alleles. Transcription of mbl-1 can start from exon 1 or exon 3. Exon 7 and 8 can be included or skipped to generate the long or short isoforms of mbl-1 through alternative splicing. Genomic DNA of mbl-1 from unk249, unk344, and unk276 were cloned, fused with GFP, and expressed under the mec-17 promoter. (B) Fluorescent images of TRNs (labelled by uIs115[mec-17p::TagRFP]) in mec-7(u278) and mec-7(u278); mbl-1(unk276) mutants. Scale bars, 100 mm. The quantification below showed the ALM-PN length in various strains. Three asterisks indicate p < 0.001 in a Dunnett’s test compare the strains with mec-7(u278). Wild-type animals do not have a prominent ALM-PN. (C) The fluorescent signals of GFP fusion with various MBL-1 mutants. The diffusive TagRFP signal labels the entire cell body. Scale bars, 5 mm.
","imageTitle":"Cytoplasmic localization of MBL-1 is required for its function in promoting neurite growth.
","methods":"To generate the three mbl-1 mutant alleles, we used CRISPR/Cas9-mediated genome editing to introduce double-strained breaks at two targeted sites (exons 6 and 9) in the endogenous mbl-1 locus. Specifically, pairs of single guide RNAs (sgRNAs) were synthesized using the EnGen sgRNA Synthesis Kit (NEB, E3322V). A total of 1μg of each sgRNA pair, combined with 20 pmol of recombinant Cas9 protein (EnGen S. pyogenes Cas9 NLS, NEB, M0646T), was microinjected into the gonads of young adult C. elegans. For precise editing of join selected exons, we followed an established protocol that uses single-stranded DNA oligonucleotides (0.1 μg/μl) as homologous repair templates (Dokshin et al., 2018). To prevent re-cleavage by Cas9, synonymous mutations were incorporated into the repair templates at the protospacer-adjacent motif (PAM) sites.
To create TRN-specific fluorescent reporter constructs for the three mbl-1 mutant alleles, we amplified the corresponding mutant genomic sequences and inserted them into a vector downstream of a 1.9 kb mec-17 promoter and in-frame with GFP using Gibson Assembly (ClonExpress II One Step Cloning Kit, Vazyme Biotech, Nanjing, China). These plasmid constructs were then microinjected into the gonads of young adult C. elegans to generate transgenic lines carrying extrachromosomal arrays.
Fluorescence imaging was performed on a Leica DMi8 inverted microscope equipped with a Leica K5 monochrome camera. Images were acquired and analyzed using Leica Application Suite X software (version 3.7.2.22383). Measurements of ALM-PN length were obtained from day-1 adult animals cultivated at 20 °C, with at least 20 individuals scored per genotype.
","reagents":"Strain | Allele | Full Genotype |
CGZ1032 | uIs115 | uIs115[mec-17p::TagRFP] IV |
TU4879 | mec-7(u278) | mec-7(u278) X; uIs115[mec-17p::TagRFP] IV |
TU6020 | mec-7(u278) mbl-1(tm1563) | mec-7(u278) X; mbl-1(tm1563) X; uIs115[mec-17p::TagRFP] IV |
CGZ2408 | mec-7(u278) mbl-1(unk249) | mec-7(u278) X; mbl-1(unk249) X; uIs115[mec-17p::TagRFP] IV |
CGZ2825 | mec-7(u278) mbl-1(unk344) | mec-7(u278) X; mbl-1(unk344) X; uIs115[mec-17p::TagRFP] IV |
CGZ2654 | mec-7(u278) mbl-1(unk276) | mec-7(u278) X; mbl-1(unk276) X; uIs115[mec-17p::TagRFP] IV |
CGZ2660 | unkEx898 | unkEx898[mec-17p-mbl-1(del_ex7-8)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV |
CGZ2720 | mec-7(u278); unkEx898 | mec-7(u278) X; unkEx898[mec-17p-mbl-1(del_ex7-8)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV |
CGZ2715 | mec-7(u278) mbl-1(tm1563); unkEx898 | mec-7(u278) X; mbl-1(tm1563) X; unkEx898[mec-17p-mbl-1(del_ex7-8)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV |
CGZ2716 | unkEx899 | unkEx899[mec-17p-mbl-1(join_ex6-9)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV |
CGZ2717 | mec-7(u278); unkEx899 | mec-7(u278) X; unkEx899[mec-17p-mbl-1(join_ex6-9)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV |
CGZ2661 | mec-7(u278) mbl-1(tm1563); unkEx899 | mec-7(u278) X; mbl-1(tm1563) X; unkEx899[mec-17p-mbl-1(join_ex6-9)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV |
CGZ2946 | unkEx1041 | unkEx1041(mec-17p-mbl-1(del_ex7-8_KR-motifs)-GFP-unc-54-3'utr; ceh-22p::GFP); uIs115[mec-17p::TagRFP] IV |
CGZ2912 | mec-7(u278); unkEx1041 | mec-7(u278) X; unkEx1041(mec-17p-mbl-1(del_ex7-8_KR-motifs)-GFP-unc-54-3'utr; ceh-22p::GFP); uIs115[mec-17p::TagRFP] IV |
CGZ2947 | mec-7(u278) mbl-1(tm1563); unkEx1041 | mec-7(u278) X; mbl-1(tm1563) X; unkEx1041(mec-17p-mbl-1(del_ex7-8_KR-motifs)-GFP-unc-54-3'utr; ceh-22p::GFP); uIs115[mec-17p::TagRFP] IV |
CRISPR Reagents | Sequence | Purpose |
mbl-1-crispr-ex6 | TCAAGACCCTTATACAGCAG | Exon 6 target site - wild type background |
mbl-1-crispr-ex9 | GCTCCGTTCTTGTCGAGAGT | Exon 9 target site - wild type background |
mbl-1-repair-del8 | TACTACAACGGCATGATGTATCCACAAGTA CTACAGGATCCATACACTGCTGCGGCAGTGA ATCAG GGAGCTGTACCAATGAAGCGACCAA CACTGGATAAAAATGGTGCAATGTTATACTC ACCGGTAGCTCAGCAGGC | Repair templates - joining of exon 6 and 9 together (removal of exon 8 and adjacent introns) |
mbl-1-crispr-ex6_2 | TATGGATCCTGTAGTACTTG | Exon 6 target site - unk249 background |
mbl-1-crispr-ex9_2 | ACCAATGAAGCGACCAACAC | Exon 9 target site - unk249 background |
mbl-1-repair-ex8 | TACCCACCCTACTACAACGGCATGATGTATC CACAAGTACTTCAAGACCCTTATACAGCAGC GGCAGTGAATCAGCAGCTACAAACTGCCGC CTTGCTTGGCAACGTCGGAGGACTGCTTTC GGCTC AATCGGCGGCCGCCTTCATGGCCAA CTCGTCGGCAGCGGCTGCAGCAGCCCAACA AACGCCCT CACCGTTGCTTCGTCTGCAAAG GAAACGAGCGCTGGAAGAGGAGAACACGA ATGGCAACGATATGACGTCAGCAGCAGCGG CTCACACACAATTGCTCTCATTGGCCGCGG GAGCTGTACCAATGAAGCGACCAACTCTCG ACAAGA ACGGAGCAATGTTATACTCACCGG T | Repair templates - insert exon 8 between exon 6 and 9 |
mbl-1-repair-ex9 | TACCCACCCTACTACAACGGCATGATGTATC CACAAGTACTTCAAGACCCTTATACAGCAG CGGCAGTGAATCAGGGAGCTGTACCAATGC CAACTCTCGACAAGAACGGAGCAATGTTAT ACTCACCGGTAGCTCAGCAGGCACAACAATT | Repair templates - removal of KR motifs on exon 9 |
Primers | Sequence | Purpose |
S-mbl-1-ex6-F | ccgttccagCAACAACAAGC | CRISPR sequencing |
S-mbl-1-3'UTR-R | attcacatgactagcctcccag | CRISPR sequencing |
m17p-mbl-1-F | tgtgagacgattcgatcATGTTCGACGAAAACAGTAATGCCG | TRN-specific fluorescent reporter constructs cloning |
mbl-1-GFP-R | TTCTCCTTTACTGAATGGTGGTGGCTGCATGT | TRN-specific fluorescent reporter constructs cloning |
The Muscleblind family comprises a group of evolutionarily conserved RNA-binding proteins that play key roles in various aspects of RNA metabolism, most notably in the regulation of alternative splicing. A defining feature of these proteins is the presence of tandem zinc finger domains, each composed of three cysteine residues and one histidine residue (Fernandez-Costa et al., 2011). Caenorhabditis elegans has a single ortholog of Muscleblind protein, MBL-1, which shows prominent expression in the nervous system. Loss-of-function studies have shown that mbl-1 is essential for the synaptic formation at the neuromuscular junctions (Spilker et al., 2012), dendritic morphogenesis in PVD sensory neurons (Xie et al., 2023), microtubule stability and axonal growth in touch receptor neurons (TRNs), and alternative splicing of terminal selectors like mec-3 (Lee et al., 2024). In addition to its classic role as a regulator of RNA splicing, recent studies have shown that MBL-1 also modulates mRNA stability through direct binding to target transcripts (Puri et al., 2023; Verbeeren et al., 2023). Since certain MBL-1 isoforms possess a pair of nuclear localization signals (NLS) while other isoforms do not, the protein may function both as a splicing regulator in the nucleus and an mRNA stabilizer in the cytoplasm. To disentangle the two functions, we engineered three alleles that produced MBL-1 proteins exclusively with or without the NLS and found that its presence in the cytoplasm is necessary to promote axonal growth in the TRNs.
Previous studies identified a bipartite nuclear localization signal (NLS) in mammalian Muscleblind MBNL proteins, consisting of two repeats of lysine-arginine residues (KR motifs) that regulate their subcellular localization (Kino et al., 2015). This bipartite KR motif is evolutionarily conserved in C. elegans MBL-1, with one located near the end of exon 8 and the second at the beginning of exon 9 (Verbeeren et al., 2023). Since exon 8 can be selectively included in some but not all isoforms, the gene can code for MBL-1 isoforms with one or two KR motifs (Figure 1A). To perturb the NLS in MBL-1, Verbeeren et al. previously generated the mbl-1(syb4318) and mbl-1(syb4345) alleles. The syb4318 allele featured a deletion of exon 7 and 8 and part of the flanking introns, resulting in the expression of isoforms with only one KR motif, whereas the syb4345 allele involves a deletion of exon 7 and its flanking introns, leading to the expression of MBL-1 isoform with two KR motifs if the connected exons 6 and 8 are included in the mRNA. However, if the exon 6&8 is skipped, which would happen in the alternative splicing of mbl-1 mRNA, the syb4345 would still produces proteins with only one KR motif. Moreover, whether the single KR motif could still contribute to nuclear localization is unclear.
To address the above issues, we created three additional mbl-1 alleles through CRISPR/Cas9-mediated gene editing. First, the unk249 allele deleted exons 7 and 8 along with their flanking intronic sequences (thereby directly joining exons 6 and 9) and produced MBL-1 proteins with only one KR motif. Second, the unk344 allele was built on top of unk249 by further deleting the remaining KR motif, thus generating MBL-1 proteins with no KR motifs. Third, the unk276 allele, in which exon 7, the introns flanking exon 7, and the intron between exons 8 and 9 were deleted, resulting in the fusion of exon 6, 8, and 9 and the production of MBL-1 proteins with two KR motifs only.
To understand the functional significance of these MBL-1 isoforms in promoting axonal growth, we cross the above mbl-1 alleles into the mec-7(u278) mutants, which served as a sensitized background to test for the effects on neurite growth. mec-7 codes for a TRN-specific b-tubulin, and the u278(C303Y) is a gain-of-function mutation that led to the growth of a very long ectopic posteriorly directed neurite in the ALM neurons (termed as ALM-PN) (Zheng et al., 2017). This ALM-PN does not exist or is very short in the wild-type animals. We previously found that the loss of mbl-1 completely suppressed the growth of ALM-PN in the mec-7(u278) mutants, suggesting that MBL-1 promotes neurite growth (Lee et al., 2024). Similar to the mbl-1 null allele, the unk276 allele (which only produces MBL-1 proteins with two KR motifs) also suppressed the ALM-PN growth, suggesting that the cytoplasmic presence of MBL-1 is required for its activity in promoting neurite growth. Both unk249 and unk344 alleles (which produces MBL-1 proteins with one or no KR motif) failed to suppress ALM-PN growth, suggesting that the KR motifs and nuclear localization may not be required for MBL-1’s function in inducing neurite growth in the mec-7(u278) background.
To confirm the subcellular localization of the MBL-1 proteins produced by the above three alleles, we cloned the mbl-1 gene from the mutants, fused them with GFP-coding sequences and expressed the fusion proteins under the TRN-specific mec-17 promoter. These reporters were introduced into the wild-type, mec-7(u278), and mec-7(u278) mbl-1(-) animals. As expected, the proteins with two KR motifs were restricted to the nucleus, whereas the proteins with one KR motif showed diffusive expression throughout the TRN cell body. To our surprise, MBL-1 proteins with no KR motifs still showed a diffusive localization pattern in the cells and was not excluded from the nucleus. This result hinted that MBL-1 may be able to enter the nucleus in a mechanism that is independent of the two KR motifs. The shorter isoforms (which skipped exon 7 and 8) likely have both cytoplasmic and nuclear localizations.
MBL-1 is known to interact and stabilize the mRNAs of microtubule-related genes (such as mec-17/tubulin acetyltransferase, mec-7/b-tubulin, and mec-12/a-tubulin) (Puri et al., 2023), and we suspect that this mRNA-stabilizing role in the cytoplasm is essential for MBL-1’s function in promoting microtubule stability and neurite growth. However, since we were not able to generate a version of MBL-1 that is exclusively cytoplasmic, it remains unclear whether its nuclear localization is also required for its function in neurite extension. Our previous work found that MBL-1 promotes the splicing of mec-3, which activates the expression of mec-17, mec-7, and mec-12. It is likely that MBL-1’s canonical function as a splicing regulator in the nucleus also contribute to microtubule stabilization and neuronal morphogenesis.
","references":[{"reference":"Dokshin GA, Ghanta KS, Piscopo KM, Mello CC. 2018. Robust Genome Editing with Short Single-Stranded and Long, Partially Single-Stranded DNA Donors in\n Caenorhabditis elegans. Genetics 210: 781-787.
","pubmedId":"","doi":"10.1534/genetics.118.301532 "},{"reference":"Fernandez-Costa JM, Llamusi MB, Garcia-Lopez A, Artero R. 2011. Alternative splicing regulation by Muscleblind proteins: from development to disease. Biological Reviews 86: 947-958.
","pubmedId":"","doi":"10.1111/j.1469-185X.2011.00180.x"},{"reference":"Kino Y, Washizu C, Kurosawa M, Oma Y, Hattori N, Ishiura S, Nukina N. 2014. Nuclear localization of MBNL1: splicing-mediated autoregulation and repression of repeat-derived aberrant proteins. Human Molecular Genetics 24: 740-756.
","pubmedId":"","doi":"10.1093/hmg/ddu492"},{"reference":"Lee HMT, Lim HY, He H, Lau CY, Zheng C. 2024. MBL-1/Muscleblind regulates neuronal differentiation and controls the splicing of a terminal selector in Caenorhabditis elegans. PLOS Genetics 20: e1011276.
","pubmedId":"","doi":"10.1371/journal.pgen.1011276"},{"reference":"Puri D, Sharma S, Samaddar S, Ravivarma S, Banerjee S, Ghosh-Roy A. 2023. Muscleblind-1 interacts with tubulin mRNAs to regulate the microtubule cytoskeleton in C. elegans mechanosensory neurons. PLOS Genetics 19: e1010885.
","pubmedId":"","doi":"10.1371/journal.pgen.1010885"},{"reference":"Spilker KA, Wang GJ, Tugizova MS, Shen K. 2012. Caenorhabditis elegans Muscleblind homolog mbl-1 functions in neurons to regulate synapse formation. Neural Development 7: 10.1186/1749-8104-7-7.
","pubmedId":"","doi":"10.1186/1749-8104-7-7"},{"reference":"Verbeeren J, Teixeira J, Garcia SMDA. 2023. The Muscleblind-like protein MBL-1 regulates microRNA expression in Caenorhabditis elegans through an evolutionarily conserved autoregulatory mechanism. PLOS Genetics 19: e1011109.
","pubmedId":"","doi":"10.1371/journal.pgen.1011109"},{"reference":"Xie J, Zou W, Tugizova M, Shen K, Wang X. 2023. MBL-1 and EEL-1 affect the splicing and protein levels of MEC-3 to control dendrite complexity. PLOS Genetics 19: e1010941.
","pubmedId":"","doi":"10.1371/journal.pgen.1010941"},{"reference":"Zheng C, Diaz-Cuadros M, Nguyen KCQ, Hall DH, Chalfie M. 2017. Distinct effects of tubulin isotype mutations on neurite growth in\n Caenorhabditis elegans. Molecular Biology of the Cell 28: 2786-2801.
","pubmedId":"","doi":"10.1091/mbc.E17-06-0424"}],"title":"Cytosolic localization of MBL-1/Muscleblind is required for neurite growth in the C. elegans touch receptor neurons
","reviews":[{"reviewer":{"displayName":"Adam Norris"},"openAcknowledgement":false,"status":{"submitted":true}}],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null}]},{"id":"6e54d793-7595-4fb4-96d4-1a356ed65cc0","decision":"revise","abstract":"The evolutionarily conserved RNA-binding protein Muscleblind can function as both a splicing regulator in the nucleus and a mRNA stabilizer in the cytosol. C. elegans mbl-1/Muscleblind undergoes alternative splicing to generate long and short isoforms that contain one or two KR motifs needed for nuclear localization. We generate three alleles that express MBL-1 proteins with two, one, or no KR motifs and find that the proteins with two KR motifs are restricted in the nucleus and could not promote neurite growth in a sensitized background. Surprisingly, proteins with one or no KR motifs are located in both cytoplasm and nucleus.
","acknowledgements":"We thank the National BioResource Project (NBRP), which is funded by the Japanese government, for providing strains.
","authors":[{"affiliations":["The University of Hong Kong"],"departments":["School of Biological Sciences"],"credit":["investigation","formalAnalysis","dataCuration","validation","visualization","writing_originalDraft"],"email":"tlhm20@connect.hku.hk","firstName":"Ho Ming Terence","lastName":"Lee","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["The University of Hong Kong"],"departments":["School of Biological Sciences"],"credit":["fundingAcquisition","conceptualization","project","supervision","writing_reviewEditing"],"email":"cgzheng@hku.hk","firstName":"Chaogu","lastName":"Zheng","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0002-5048-4520"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"Extended Data Figure 1 and Figure 2
","doi":null,"resourceType":"Image","name":"Extended Data Figure.pdf","url":"https://portal.micropublication.org/uploads/770353b620cc624ad92e337fdcfe05e3.pdf"}],"funding":"This work is supported by the Research Grants Council of Hong Kong (GRF 17106322).
","image":{"url":"https://portal.micropublication.org/uploads/2c73b4bf11c34a9e4562b423622d9ab7.jpg"},"imageCaption":"(A) Gene structure of mbl-1 and the molecular change of various alleles. Transcription of mbl-1 can start from exon 1 or exon 3. Exon 7 and 8 can be included or skipped to generate the long or short isoforms of mbl-1 through alternative splicing. Genomic DNA of mbl-1 from unk249, unk344, and unk276 were cloned, fused with GFP, and expressed under the mec-17 promoter. (B) Fluorescent images of TRNs (labelled by uIs115[mec-17p::TagRFP]) in mec-7(u278) and mec-7(u278); mbl-1(unk276) mutants. Scale bars, 100 mm. The quantification below showed the ALM-PN length in various strains. Three asterisks indicate p < 0.001 in a Dunnett's test compare the strains with mec-7(u278). Wild-type animals do not have a prominent ALM-PN. (C) The fluorescent signals of GFP fusion with various MBL-1 mutants. The diffusive TagRFP signal labels the entire cell body. Scale bars, 5 mm.
","imageTitle":"Cytoplasmic localization of MBL-1 is required for its function in promoting neurite growth.
","methods":"To generate the three mbl-1 mutant alleles, we used CRISPR/Cas9-mediated genome editing to introduce double-strained breaks at two targeted sites (exons 6 and 9) in the endogenous mbl-1 locus. Specifically, pairs of single guide RNAs (sgRNAs) were synthesized using the EnGen sgRNA Synthesis Kit (NEB, E3322V). A total of 1μg of each sgRNA pair, combined with 20 pmol of recombinant Cas9 protein (EnGen S. pyogenes Cas9 NLS, NEB, M0646T), was microinjected into the gonads of young adult C. elegans. For precise editing of join selected exons, we followed an established protocol that uses single-stranded DNA oligonucleotides (0.1 μg/μl) as homologous repair templates (Dokshin et al., 2018). To prevent re-cleavage by Cas9, synonymous mutations were incorporated into the repair templates at the protospacer-adjacent motif (PAM) sites.
To create TRN-specific fluorescent reporter constructs for the three mbl-1 mutant alleles, we amplified the corresponding mutant genomic sequences and inserted them into a vector downstream of a 1.9 kb mec-17 promoter and in-frame with GFP using Gibson Assembly (ClonExpress II One Step Cloning Kit, Vazyme Biotech, Nanjing, China). These plasmid constructs were then microinjected into the gonads of young adult C. elegans to generate transgenic lines carrying extrachromosomal arrays.
To conduct RT-PCR, total RNA was extracted from L4 animals using TRIzol reagent (Thermo Fisher). cDNA libraries were prepared through reverse transcription of the total RNA using SuperScript II Reverse Transcriptase with oligo(dT)s (Thermo Fisher). Four candidates were selected for semi-quantitative RT-PCR using isoform-specific primers based on previous studies (Lee et al., 2024). ama-1 was used as an internal control for RT-PCR.
Fluorescence imaging was performed on a Leica DMi8 inverted microscope equipped with a Leica K5 monochrome camera. Images were acquired and analyzed using Leica Application Suite X software (version 3.7.2.22383). Measurements of ALM-PN length were obtained from day-1 adult animals cultivated at 20 °C, with at least 20 individuals scored per genotype.
","reagents":"Strain | Allele | Full Genotype |
unkEx898[mec-17p-mbl-1(del_ex7-8)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV | ||
mec-7(u278) X; unkEx898[mec-17p-mbl-1(del_ex7-8)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV | ||
mec-7(u278) X; mbl-1(tm1563) X; unkEx898[mec-17p-mbl-1(del_ex7-8)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV | ||
unkEx899[mec-17p-mbl-1(join_ex6-9)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV | ||
mec-7(u278) X; unkEx899[mec-17p-mbl-1(join_ex6-9)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV | ||
mec-7(u278) X; mbl-1(tm1563) X; unkEx899[mec-17p-mbl-1(join_ex6-9)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV | ||
unkEx1041(mec-17p-mbl-1(del_ex7-8_KR-motifs)-GFP-unc-54-3'utr; ceh-22p::GFP); uIs115[mec-17p::TagRFP] IV | ||
mec-7(u278) X; unkEx1041(mec-17p-mbl-1(del_ex7-8_KR-motifs)-GFP-unc-54-3'utr; ceh-22p::GFP); uIs115[mec-17p::TagRFP] IV | ||
mec-7(u278) X; mbl-1(tm1563) X; unkEx1041(mec-17p-mbl-1(del_ex7-8_KR-motifs)-GFP-unc-54-3'utr; ceh-22p::GFP); uIs115[mec-17p::TagRFP] IV |
CRISPR Reagents | Sequence | Purpose |
mbl-1-crispr-ex6 | TCAAGACCCTTATACAGCAG | Exon 6 target site - wild type background |
mbl-1-crispr-ex9 | GCTCCGTTCTTGTCGAGAGT | Exon 9 target site - wild type background |
mbl-1-repair-del8 | TACTACAACGGCATGATGTATCCACAAGTA CTACAGGATCCATACACTGCTGCGGCAGTGA ATCAG GGAGCTGTACCAATGAAGCGACCAA CACTGGATAAAAATGGTGCAATGTTATACTC ACCGGTAGCTCAGCAGGC | Repair templates - joining of exon 6 and 9 together (removal of exon 8 and adjacent introns) |
mbl-1-crispr-ex6_2 | TATGGATCCTGTAGTACTTG | Exon 6 target site - unk249 background |
mbl-1-crispr-ex9_2 | ACCAATGAAGCGACCAACAC | Exon 9 target site - unk249 background |
mbl-1-repair-ex8 | TACCCACCCTACTACAACGGCATGATGTATC CACAAGTACTTCAAGACCCTTATACAGCAGC GGCAGTGAATCAGCAGCTACAAACTGCCGC CTTGCTTGGCAACGTCGGAGGACTGCTTTC GGCTC AATCGGCGGCCGCCTTCATGGCCAA CTCGTCGGCAGCGGCTGCAGCAGCCCAACA AACGCCCT CACCGTTGCTTCGTCTGCAAAG GAAACGAGCGCTGGAAGAGGAGAACACGA ATGGCAACGATATGACGTCAGCAGCAGCGG CTCACACACAATTGCTCTCATTGGCCGCGG GAGCTGTACCAATGAAGCGACCAACTCTCG ACAAGA ACGGAGCAATGTTATACTCACCGG T | Repair templates - insert exon 8 between exon 6 and 9 |
mbl-1-repair-ex9 | TACCCACCCTACTACAACGGCATGATGTATC CACAAGTACTTCAAGACCCTTATACAGCAG CGGCAGTGAATCAGGGAGCTGTACCAATGC CAACTCTCGACAAGAACGGAGCAATGTTAT ACTCACCGGTAGCTCAGCAGGCACAACAATT | Repair templates - removal of KR motifs on exon 9 |
Primers | Sequence | Purpose |
S-mbl-1-ex6-F | ccgttccagCAACAACAAGC | CRISPR sequencing |
S-mbl-1-3'UTR-R | attcacatgactagcctcccag | CRISPR sequencing |
m17p-mbl-1-F | tgtgagacgattcgatcATGTTCGACGAAAACAGTAATGCCG | TRN-specific fluorescent reporter constructs cloning |
mbl-1-GFP-R | TTCTCCTTTACTGAATGGTGGTGGCTGCATGT | TRN-specific fluorescent reporter constructs cloning |
mbl-1_ATG_F | ATGTTCGACGAAAACAGTAATGCCG | mbl-1 RT-PCR |
mbl-1_TAG_R | CTAGAATGGTGGTGGCTGCATG | mbl-1 RT-PCR |
ama-1-cDNA-F | CGGAGGAGATTAAACGCATGTC | ama-1 RT-PCR |
ama-1-cDNA-R | CGAGCTCCGTTTTCTCTAATAATATACTTG | ama-1 RT-PCR |
kin-4-cDNA-f | AACTTGTTACGTGATGTACCCTTCTG | kin-4h RT-PCR |
kin-4h-cDNA-r | TGGCGATGGACTTCTCTATCTCATTT | kin-4h RT-PCR |
pqn-52-cDNA-f | CTCCATCGGACATCCGAATTCC | pqn-52c RT-PCR |
pqn-52-cDNA-r | GTGGTTTTTCTTGGGACTGTCC | pqn-52c RT-PCR |
pqn-72-cDNA-f | TCGGAACTTTATACGTCAGCAGTT | pqn-72b RT-PCR |
S-pqn-72-r | TTTCGATGGAACTCGATGAGTC | pqn-72b RT-PCR |
lgc-22-cDNA-f | CGTTGAAGTTGTGTCAATTACCCACT | lgc-22a RT-PCR |
S-lgc-22-r | ACAGTGGATAAAGCGAAGATGACG | lgc-22a RT-PCR |
The Muscleblind family comprises a group of evolutionarily conserved RNA-binding proteins that play key roles in various aspects of RNA metabolism, most notably in the regulation of alternative splicing. A defining feature of these proteins is the presence of tandem zinc finger domains, each composed of three cysteine residues and one histidine residue (Fernandez-Costa et al., 2011). Caenorhabditis elegans has a single ortholog of Muscleblind protein, MBL-1, which shows prominent expression in the nervous system. Loss-of-function studies have shown that mbl-1 is essential for the synaptic formation at the neuromuscular junctions (Spilker et al., 2012), dendritic morphogenesis in PVD sensory neurons (Xie et al., 2023), microtubule stability and axonal growth in touch receptor neurons (TRNs), and alternative splicing of terminal selectors like mec-3 (Lee et al., 2024). In addition to its classic role as a regulator of RNA splicing, recent studies have shown that MBL-1 also modulates mRNA stability through direct binding to target transcripts (Puri et al., 2023; Verbeeren et al., 2023). Since certain MBL-1 isoforms possess a pair of nuclear localization signals (NLS) while other isoforms do not, the protein may function both as a splicing regulator in the nucleus and an mRNA stabilizer in the cytoplasm. To disentangle the two functions, we engineered three alleles that produced MBL-1 proteins exclusively with or without the NLS and found that its presence in the cytoplasm is necessary to promote axonal growth in the TRNs.
Previous studies identified a bipartite nuclear localization signal (NLS) in mammalian Muscleblind MBNL proteins, consisting of two repeats of lysine-arginine residues (KR motifs) that regulate their subcellular localization (Kino et al., 2015). This bipartite KR motif is evolutionarily conserved in C. elegans MBL-1, with one located near the end of exon 8 and the second at the beginning of exon 9 (Verbeeren et al., 2023). Since exon 8 can be selectively included in some but not all isoforms, the gene can code for MBL-1 isoforms with one or two KR motifs (Fig. 1A). To perturb the NLS in MBL-1, Verbeeren et al. previously generated the mbl-1(syb4318) and mbl-1(syb4345) alleles. The syb4318 allele featured a deletion of exon 7 and 8 and part of the flanking introns, resulting in the expression of isoforms with only one KR motif, whereas the syb4345 allele involves a deletion of exon 7 and its flanking introns, leading to the expression of MBL-1 isoform with two KR motifs if the connected exons 6 and 8 are included in the mRNA. However, if the exon 6&8 is skipped, which would happen in the alternative splicing of mbl-1 mRNA, the syb4345 would still produces proteins with only one KR motif. Moreover, whether the single KR motif could still contribute to nuclear localization is unclear.
To address the above issues, we created three additional mbl-1 alleles through CRISPR/Cas9-mediated gene editing. First, the unk249 allele deleted exons 7 and 8 along with their flanking intronic sequences (thereby directly joining exons 6 and 9) and produced MBL-1 proteins with only one KR motif. Second, the unk344 allele was built on top of unk249 by further deleting the remaining KR motif, thus generating MBL-1 proteins with no KR motifs. Third, the unk276 allele, in which exon 7, the introns flanking exon 7, and the intron between exons 8 and 9 were deleted, resulting in the fusion of exon 6, 8, and 9 and the production of MBL-1 proteins with two KR motifs only (Fig. 1A). We conducted RT-PCR to examine and sequence the transcripts of mbl-1 in animals carrying the three alleles and confirmed that the gene editing indeed changed the sequence of the mbl-1 transcripts as expected (Ext. Data Fig. 1).
To understand the functional significance of these MBL-1 isoforms in promoting axonal growth, we cross the above mbl-1 alleles into the mec-7(u278) mutants, which served as a sensitized background to test for the effects on neurite growth. mec-7 codes for a TRN-specific b-tubulin, and the u278(C303Y) is a gain-of-function mutation that led to the growth of a very long ectopic posteriorly directed neurite in the ALM neurons (termed as ALM-PN) (Zheng et al., 2017). This ALM-PN does not exist or is very short in the wild-type animals. We previously found that the loss of mbl-1 completely suppressed the growth of ALM-PN in the mec-7(u278) mutants, suggesting that MBL-1 promotes neurite growth (Lee et al., 2024). Similar to the mbl-1 null allele, the unk276 allele (which only produces MBL-1 proteins with two KR motifs) also suppressed the ALM-PN growth (Fig. 1B), suggesting that the cytoplasmic presence of MBL-1 is required for its activity in promoting neurite growth. Both unk249 and unk344 alleles (which produces MBL-1 proteins with one or no KR motif) failed to suppress ALM-PN growth, suggesting that the KR motifs and nuclear localization may not be required for MBL-1's function in inducing neurite growth in the mec-7(u278) background.
To confirm the subcellular localization of the MBL-1 proteins produced by the above three alleles, we cloned the mbl-1 gene from the mutants, fused them with GFP-coding sequences and expressed the fusion proteins under the TRN-specific mec-17 promoter. These reporters were introduced into the wild-type, mec-7(u278), and mec-7(u278) mbl-1(-) animals. As expected, the proteins with two KR motifs were restricted to the nucleus, whereas the proteins with one KR motif showed diffusive expression throughout the TRN cell body (Fig. 1C). To our surprise, MBL-1 proteins with no KR motifs still showed a diffusive localization pattern in the cells and was not excluded from the nucleus. This result hinted that MBL-1 may be able to enter the nucleus in a mechanism that is independent of the two KR motifs. The shorter isoforms (which skipped exon 7 and 8) likely have both cytoplasmic and nuclear localizations.
To confirm that the nucleus-localized MBL-1 produced by the unk276 allele is capable of splicing target genes, we analyzed four known MBL-1-regulated splicing events (Lee et al., 2024). The unk276 animals could promote the normal splicing of pqn-52c, pqn-72b, lgc-22a, and kin-4h isoforms, suggesting that the long MBL-1 isoform is functional in controlling mRNA splicing. The mbl-1(tm1563) deletion mutants served as a negative control (Ext. Data Fig. 2). The MBL-1 proteins with one or no KR motifs produced by unk249 and unk344 alleles, respectively, could not promote the normal splicing of pqn-52c and pqn-72b but was able to promote the splicing of lgc-22a and kin-4h to the same extent as MBL-1 produced by unk276. Thus, the short MBL-1 isoform may still possess some ability to regular nuclear splicing, which is consistent with their nuclear localization.
MBL-1 is known to interact and stabilize the mRNAs of microtubule-related genes (such as mec-17/tubulin acetyltransferase, mec-7/β-tubulin, and mec-12/α-tubulin) (Puri et al., 2023), and we suspect that this mRNA-stabilizing role in the cytoplasm is essential for MBL-1's function in promoting microtubule stability and neurite growth. However, since we were not able to generate a version of MBL-1 that is exclusively cytoplasmic, it remains unclear whether its nuclear localization is also required for its function in neurite extension. Our previous work found that MBL-1 promotes the splicing of mec-3, which activates the expression of mec-17, mec-7, and mec-12. It is likely that MBL-1's canonical function as a splicing regulator in the nucleus also contribute to microtubule stabilization and neuronal morphogenesis.
","references":[{"reference":"Dokshin GA, Ghanta KS, Piscopo KM, Mello CC. 2018. Robust Genome Editing with Short Single-Stranded and Long, Partially Single-Stranded DNA Donors in\n Caenorhabditis elegans. Genetics 210: 781-787.
","pubmedId":"","doi":"10.1534/genetics.118.301532 "},{"reference":"Fernandez-Costa JM, Llamusi MB, Garcia-Lopez A, Artero R. 2011. Alternative splicing regulation by Muscleblind proteins: from development to disease. Biological Reviews 86: 947-958.
","pubmedId":"","doi":"10.1111/j.1469-185X.2011.00180.x"},{"reference":"Kino Y, Washizu C, Kurosawa M, Oma Y, Hattori N, Ishiura S, Nukina N. 2014. Nuclear localization of MBNL1: splicing-mediated autoregulation and repression of repeat-derived aberrant proteins. Human Molecular Genetics 24: 740-756.
","pubmedId":"","doi":"10.1093/hmg/ddu492"},{"reference":"Lee HMT, Lim HY, He H, Lau CY, Zheng C. 2024. MBL-1/Muscleblind regulates neuronal differentiation and controls the splicing of a terminal selector in Caenorhabditis elegans. PLOS Genetics 20: e1011276.
","pubmedId":"","doi":"10.1371/journal.pgen.1011276"},{"reference":"Puri D, Sharma S, Samaddar S, Ravivarma S, Banerjee S, Ghosh-Roy A. 2023. Muscleblind-1 interacts with tubulin mRNAs to regulate the microtubule cytoskeleton in C. elegans mechanosensory neurons. PLOS Genetics 19: e1010885.
","pubmedId":"","doi":"10.1371/journal.pgen.1010885"},{"reference":"Spilker KA, Wang GJ, Tugizova MS, Shen K. 2012. Caenorhabditis elegans Muscleblind homolog mbl-1 functions in neurons to regulate synapse formation. Neural Development 7: 10.1186/1749-8104-7-7.
","pubmedId":"","doi":"10.1186/1749-8104-7-7"},{"reference":"Verbeeren J, Teixeira J, Garcia SMDA. 2023. The Muscleblind-like protein MBL-1 regulates microRNA expression in Caenorhabditis elegans through an evolutionarily conserved autoregulatory mechanism. PLOS Genetics 19: e1011109.
","pubmedId":"","doi":"10.1371/journal.pgen.1011109"},{"reference":"Xie J, Zou W, Tugizova M, Shen K, Wang X. 2023. MBL-1 and EEL-1 affect the splicing and protein levels of MEC-3 to control dendrite complexity. PLOS Genetics 19: e1010941.
","pubmedId":"","doi":"10.1371/journal.pgen.1010941"},{"reference":"Zheng C, Diaz-Cuadros M, Nguyen KCQ, Hall DH, Chalfie M. 2017. Distinct effects of tubulin isotype mutations on neurite growth in\n Caenorhabditis elegans. Molecular Biology of the Cell 28: 2786-2801.
","pubmedId":"","doi":"10.1091/mbc.E17-06-0424"}],"title":"Cytosolic localization of MBL-1/Muscleblind is required for ectopic neurite outgrowth in a sensitized background in C. elegans
","reviews":[{"reviewer":{"displayName":"Adam Norris"},"openAcknowledgement":false,"status":{"submitted":true}}],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null}]},{"id":"132e70d9-22a6-4e65-a2a3-9a14f68a28fc","decision":"accept","abstract":"The evolutionarily conserved RNA-binding protein Muscleblind can function as both a splicing regulator in the nucleus and a mRNA stabilizer in the cytosol. C. elegans mbl-1/Muscleblind undergoes alternative splicing to generate long and short isoforms that contain one or two KR motifs needed for nuclear localization. We generate three alleles that express MBL-1 proteins with two, one, or no KR motifs and find that the proteins with two KR motifs are restricted in the nucleus and could not promote neurite growth in a sensitized background. Surprisingly, proteins with one or no KR motifs are located in both cytoplasm and nucleus.
","acknowledgements":"We thank the National BioResource Project (NBRP), which is funded by the Japanese government, for providing strains.
","authors":[{"affiliations":["The University of Hong Kong"],"departments":["School of Biological Sciences"],"credit":["investigation","formalAnalysis","dataCuration","validation","visualization","writing_originalDraft"],"email":"tlhm20@connect.hku.hk","firstName":"Ho Ming Terence","lastName":"Lee","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["The University of Hong Kong"],"departments":["School of Biological Sciences"],"credit":["fundingAcquisition","conceptualization","project","supervision","writing_reviewEditing"],"email":"cgzheng@hku.hk","firstName":"Chaogu","lastName":"Zheng","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0002-5048-4520"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"Extended Data Figure 1 and Figure 2
","doi":null,"resourceType":"Image","name":"Extended Data Figure.pdf","url":"https://portal.micropublication.org/uploads/770353b620cc624ad92e337fdcfe05e3.pdf"}],"funding":"This work is supported by the Research Grants Council of Hong Kong (GRF 17106322).
","image":{"url":"https://portal.micropublication.org/uploads/2c73b4bf11c34a9e4562b423622d9ab7.jpg"},"imageCaption":"(A) Gene structure of mbl-1 and the molecular change of various alleles. Transcription of mbl-1 can start from exon 1 or exon 3. Exon 7 and 8 can be included or skipped to generate the long or short isoforms of mbl-1 through alternative splicing. Genomic DNA of mbl-1 from unk249, unk344, and unk276 were cloned, fused with GFP, and expressed under the mec-17 promoter. (B) Fluorescent images of TRNs (labelled by uIs115[mec-17p::TagRFP]) in mec-7(u278) and mec-7(u278); mbl-1(unk276) mutants. Scale bars, 100 mm. The quantification below showed the ALM-PN length in various strains. Three asterisks indicate p < 0.001 in a Dunnett's test compare the strains with mec-7(u278). Wild-type animals do not have a prominent ALM-PN. (C) The fluorescent signals of GFP fusion with various MBL-1 mutants. The diffusive TagRFP signal labels the entire cell body. Scale bars, 5 mm.
","imageTitle":"Cytoplasmic localization of MBL-1 may be required for its function in promoting neurite growth.
","methods":"To generate the three mbl-1 mutant alleles, we used CRISPR/Cas9-mediated genome editing to introduce double-strained breaks at two targeted sites (exons 6 and 9) in the endogenous mbl-1 locus. Specifically, pairs of single guide RNAs (sgRNAs) were synthesized using the EnGen sgRNA Synthesis Kit (NEB, E3322V). A total of 1μg of each sgRNA pair, combined with 20 pmol of recombinant Cas9 protein (EnGen S. pyogenes Cas9 NLS, NEB, M0646T), was microinjected into the gonads of young adult C. elegans. For precise editing of join selected exons, we followed an established protocol that uses single-stranded DNA oligonucleotides (0.1 μg/μl) as homologous repair templates (Dokshin et al., 2018). To prevent re-cleavage by Cas9, synonymous mutations were incorporated into the repair templates at the protospacer-adjacent motif (PAM) sites.
To create TRN-specific fluorescent reporter constructs for the three mbl-1 mutant alleles, we amplified the corresponding mutant genomic sequences and inserted them into a vector downstream of a 1.9 kb mec-17 promoter and in-frame with GFP using Gibson Assembly (ClonExpress II One Step Cloning Kit, Vazyme Biotech, Nanjing, China). These plasmid constructs were then microinjected into the gonads of young adult C. elegans to generate transgenic lines carrying extrachromosomal arrays.
To conduct RT-PCR, total RNA was extracted from L4 animals using TRIzol reagent (Thermo Fisher). cDNA libraries were prepared through reverse transcription of the total RNA using SuperScript II Reverse Transcriptase with oligo(dT)s (Thermo Fisher). Four candidates were selected for semi-quantitative RT-PCR using isoform-specific primers based on previous studies (Lee et al., 2024). ama-1 was used as an internal control for RT-PCR.
Fluorescence imaging was performed on a Leica DMi8 inverted microscope equipped with a Leica K5 monochrome camera. Images were acquired and analyzed using Leica Application Suite X software (version 3.7.2.22383). Measurements of ALM-PN length were obtained from day-1 adult animals cultivated at 20 °C, with at least 20 individuals scored per genotype.
","reagents":"Strain | Allele | Full Genotype |
unkEx898[mec-17p-mbl-1(del_ex7-8)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV | ||
mec-7(u278) X; unkEx898[mec-17p-mbl-1(del_ex7-8)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV | ||
mec-7(u278) X; mbl-1(tm1563) X; unkEx898[mec-17p-mbl-1(del_ex7-8)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV | ||
unkEx899[mec-17p-mbl-1(join_ex6-9)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV | ||
mec-7(u278) X; unkEx899[mec-17p-mbl-1(join_ex6-9)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV | ||
mec-7(u278) X; mbl-1(tm1563) X; unkEx899[mec-17p-mbl-1(join_ex6-9)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV | ||
unkEx1041(mec-17p-mbl-1(del_ex7-8_KR-motifs)-GFP-unc-54-3'utr; ceh-22p::GFP); uIs115[mec-17p::TagRFP] IV | ||
mec-7(u278) X; unkEx1041(mec-17p-mbl-1(del_ex7-8_KR-motifs)-GFP-unc-54-3'utr; ceh-22p::GFP); uIs115[mec-17p::TagRFP] IV | ||
mec-7(u278) X; mbl-1(tm1563) X; unkEx1041(mec-17p-mbl-1(del_ex7-8_KR-motifs)-GFP-unc-54-3'utr; ceh-22p::GFP); uIs115[mec-17p::TagRFP] IV |
CRISPR Reagents | Sequence | Purpose |
mbl-1-crispr-ex6 | TCAAGACCCTTATACAGCAG | Exon 6 target site - wild type background |
mbl-1-crispr-ex9 | GCTCCGTTCTTGTCGAGAGT | Exon 9 target site - wild type background |
mbl-1-repair-del8 | TACTACAACGGCATGATGTATCCACAAGTA CTACAGGATCCATACACTGCTGCGGCAGTGA ATCAG GGAGCTGTACCAATGAAGCGACCAA CACTGGATAAAAATGGTGCAATGTTATACTC ACCGGTAGCTCAGCAGGC | Repair templates - joining of exon 6 and 9 together (removal of exon 8 and adjacent introns) |
mbl-1-crispr-ex6_2 | TATGGATCCTGTAGTACTTG | Exon 6 target site - unk249 background |
mbl-1-crispr-ex9_2 | ACCAATGAAGCGACCAACAC | Exon 9 target site - unk249 background |
mbl-1-repair-ex8 | TACCCACCCTACTACAACGGCATGATGTATC CACAAGTACTTCAAGACCCTTATACAGCAGC GGCAGTGAATCAGCAGCTACAAACTGCCGC CTTGCTTGGCAACGTCGGAGGACTGCTTTC GGCTC AATCGGCGGCCGCCTTCATGGCCAA CTCGTCGGCAGCGGCTGCAGCAGCCCAACA AACGCCCT CACCGTTGCTTCGTCTGCAAAG GAAACGAGCGCTGGAAGAGGAGAACACGA ATGGCAACGATATGACGTCAGCAGCAGCGG CTCACACACAATTGCTCTCATTGGCCGCGG GAGCTGTACCAATGAAGCGACCAACTCTCG ACAAGA ACGGAGCAATGTTATACTCACCGG T | Repair templates - insert exon 8 between exon 6 and 9 |
mbl-1-repair-ex9 | TACCCACCCTACTACAACGGCATGATGTATC CACAAGTACTTCAAGACCCTTATACAGCAG CGGCAGTGAATCAGGGAGCTGTACCAATGC CAACTCTCGACAAGAACGGAGCAATGTTAT ACTCACCGGTAGCTCAGCAGGCACAACAATT | Repair templates - removal of KR motifs on exon 9 |
Primers | Sequence | Purpose |
S-mbl-1-ex6-F | ccgttccagCAACAACAAGC | CRISPR sequencing |
S-mbl-1-3'UTR-R | attcacatgactagcctcccag | CRISPR sequencing |
m17p-mbl-1-F | tgtgagacgattcgatcATGTTCGACGAAAACAGTAATGCCG | TRN-specific fluorescent reporter constructs cloning |
mbl-1-GFP-R | TTCTCCTTTACTGAATGGTGGTGGCTGCATGT | TRN-specific fluorescent reporter constructs cloning |
mbl-1_ATG_F | ATGTTCGACGAAAACAGTAATGCCG | mbl-1 RT-PCR |
mbl-1_TAG_R | CTAGAATGGTGGTGGCTGCATG | mbl-1 RT-PCR |
ama-1-cDNA-F | CGGAGGAGATTAAACGCATGTC | ama-1 RT-PCR |
ama-1-cDNA-R | CGAGCTCCGTTTTCTCTAATAATATACTTG | ama-1 RT-PCR |
kin-4-cDNA-f | AACTTGTTACGTGATGTACCCTTCTG | kin-4h RT-PCR |
kin-4h-cDNA-r | TGGCGATGGACTTCTCTATCTCATTT | kin-4h RT-PCR |
pqn-52-cDNA-f | CTCCATCGGACATCCGAATTCC | pqn-52c RT-PCR |
pqn-52-cDNA-r | GTGGTTTTTCTTGGGACTGTCC | pqn-52c RT-PCR |
pqn-72-cDNA-f | TCGGAACTTTATACGTCAGCAGTT | pqn-72b RT-PCR |
S-pqn-72-r | TTTCGATGGAACTCGATGAGTC | pqn-72b RT-PCR |
lgc-22-cDNA-f | CGTTGAAGTTGTGTCAATTACCCACT | lgc-22a RT-PCR |
S-lgc-22-r | ACAGTGGATAAAGCGAAGATGACG | lgc-22a RT-PCR |
The Muscleblind family comprises a group of evolutionarily conserved RNA-binding proteins that play key roles in various aspects of RNA metabolism, most notably in the regulation of alternative splicing. A defining feature of these proteins is the presence of tandem zinc finger domains, each composed of three cysteine residues and one histidine residue (Fernandez-Costa et al., 2011). Caenorhabditis elegans has a single ortholog of Muscleblind protein, MBL-1, which shows prominent expression in the nervous system. Loss-of-function studies have shown that mbl-1 is essential for the synaptic formation at the neuromuscular junctions (Spilker et al., 2012), dendritic morphogenesis in PVD sensory neurons (Xie et al., 2023), microtubule stability and axonal growth in touch receptor neurons (TRNs), and alternative splicing of terminal selectors like mec-3 (Lee et al., 2024). In addition to its classic role as a regulator of RNA splicing, recent studies have shown that MBL-1 also modulates mRNA stability through direct binding to target transcripts (Puri et al., 2023; Verbeeren et al., 2023). Since certain MBL-1 isoforms possess a pair of nuclear localization signals (NLS) while other isoforms do not, the protein may function both as a splicing regulator in the nucleus and an mRNA stabilizer in the cytoplasm. To disentangle the two functions, we engineered three alleles that produced MBL-1 proteins exclusively with or without the NLS and found that its presence in the cytoplasm is necessary to promote axonal growth in the TRNs.
Previous studies identified a bipartite nuclear localization signal (NLS) in mammalian Muscleblind MBNL proteins, consisting of two repeats of lysine-arginine residues (KR motifs) that regulate their subcellular localization (Kino et al., 2015). This bipartite KR motif is evolutionarily conserved in C. elegans MBL-1, with one located near the end of exon 8 and the second at the beginning of exon 9 (Verbeeren et al., 2023). Since exon 8 can be selectively included in some but not all isoforms, the gene can code for MBL-1 isoforms with one or two KR motifs (Fig. 1A). To perturb the NLS in MBL-1, Verbeeren et al. previously generated the mbl-1(syb4318) and mbl-1(syb4345) alleles. The syb4318 allele featured a deletion of exon 7 and 8 and part of the flanking introns, resulting in the expression of isoforms with only one KR motif, whereas the syb4345 allele involves a deletion of exon 7 and its flanking introns, leading to the expression of MBL-1 isoform with two KR motifs if the connected exons 6 and 8 are included in the mRNA. However, if the exon 6&8 is skipped, which would happen in the alternative splicing of mbl-1 mRNA, the syb4345 would still produces proteins with only one KR motif. Moreover, whether the single KR motif could still contribute to nuclear localization is unclear.
To address the above issues, we created three additional mbl-1 alleles through CRISPR/Cas9-mediated gene editing. First, the unk249 allele deleted exons 7 and 8 along with their flanking intronic sequences (thereby directly joining exons 6 and 9) and produced MBL-1 proteins with only one KR motif. Second, the unk344 allele was built on top of unk249 by further deleting the remaining KR motif, thus generating MBL-1 proteins with no KR motifs. Third, the unk276 allele, in which exon 7, the introns flanking exon 7, and the intron between exons 8 and 9 were deleted, resulting in the fusion of exon 6, 8, and 9 and the production of MBL-1 proteins with two KR motifs only (Fig. 1A). We conducted RT-PCR to examine and sequence the transcripts of mbl-1 in animals carrying the three alleles and confirmed that the gene editing indeed changed the sequence of the mbl-1 transcripts as expected (Ext. Data Fig. 1).
To understand the functional significance of these MBL-1 isoforms in promoting axonal growth, we cross the above mbl-1 alleles into the mec-7(u278) mutants, which served as a sensitized background to test for the effects on neurite growth. mec-7 codes for a TRN-specific b-tubulin, and the u278(C303Y) is a gain-of-function mutation that led to the growth of a very long ectopic posteriorly directed neurite in the ALM neurons (termed as ALM-PN) (Zheng et al., 2017). This ALM-PN does not exist or is very short in the wild-type animals. We previously found that the loss of mbl-1 completely suppressed the growth of ALM-PN in the mec-7(u278) mutants, suggesting that MBL-1 promotes neurite growth (Lee et al., 2024). Similar to the mbl-1 null allele, the unk276 allele (which only produces MBL-1 proteins with two KR motifs) also suppressed the ALM-PN growth (Fig. 1B), suggesting that the cytoplasmic presence of MBL-1 is likely required for its activity in promoting neurite growth. Both unk249 and unk344 alleles (which produces MBL-1 proteins with one or no KR motif) failed to suppress ALM-PN growth, suggesting that the KR motifs and nuclear localization may not be required for MBL-1's function in inducing neurite growth in the mec-7(u278) background.
To confirm the subcellular localization of the MBL-1 proteins produced by the above three alleles, we cloned the mbl-1 gene from the mutants, fused them with GFP-coding sequences and expressed the fusion proteins under the TRN-specific mec-17 promoter. These reporters were introduced into the wild-type, mec-7(u278), and mec-7(u278) mbl-1(-) animals. As expected, the proteins with two KR motifs were restricted to the nucleus, whereas the proteins with one KR motif showed diffusive expression throughout the TRN cell body (Fig. 1C). To our surprise, MBL-1 proteins with no KR motifs still showed a diffusive localization pattern in the cells and was not excluded from the nucleus. This result hinted that MBL-1 may be able to enter the nucleus in a mechanism that is independent of the two KR motifs. The shorter isoforms (which skipped exon 7 and 8) likely have both cytoplasmic and nuclear localizations.
To confirm that the nucleus-localized MBL-1 produced by the unk276 allele is capable of splicing target genes, we analyzed four known MBL-1-regulated splicing events (Lee et al., 2024). The unk276 animals could promote the normal splicing of pqn-52c, pqn-72b, lgc-22a, and kin-4h isoforms, suggesting that the long MBL-1 isoform is functional in controlling mRNA splicing. The mbl-1(tm1563) deletion mutants served as a negative control (Ext. Data Fig. 2). The MBL-1 proteins with one or no KR motifs produced by unk249 and unk344 alleles, respectively, could not promote the normal splicing of pqn-52c and pqn-72b but was able to promote the splicing of lgc-22a and kin-4h to the same extent as MBL-1 produced by unk276. Thus, the short MBL-1 isoform may still possess some ability to regular nuclear splicing, which is consistent with their nuclear localization.
MBL-1 is known to interact and stabilize the mRNAs of microtubule-related genes (such as mec-17/tubulin acetyltransferase, mec-7/β-tubulin, and mec-12/α-tubulin) (Puri et al., 2023), and we suspect that this mRNA-stabilizing role in the cytoplasm is essential for MBL-1's function in promoting microtubule stability and neurite growth. However, since we were not able to generate a version of MBL-1 that is exclusively cytoplasmic, it remains unclear whether its nuclear localization is also required for its function in neurite extension. Our previous work found that MBL-1 promotes the splicing of mec-3, which activates the expression of mec-17, mec-7, and mec-12. It is likely that MBL-1's canonical function as a splicing regulator in the nucleus also contribute to microtubule stabilization and neuronal morphogenesis.
","references":[{"reference":"Dokshin GA, Ghanta KS, Piscopo KM, Mello CC. 2018. Robust Genome Editing with Short Single-Stranded and Long, Partially Single-Stranded DNA Donors in\n Caenorhabditis elegans. Genetics 210: 781-787.
","pubmedId":"","doi":"10.1534/genetics.118.301532 "},{"reference":"Fernandez-Costa JM, Llamusi MB, Garcia-Lopez A, Artero R. 2011. Alternative splicing regulation by Muscleblind proteins: from development to disease. Biological Reviews 86: 947-958.
","pubmedId":"","doi":"10.1111/j.1469-185X.2011.00180.x"},{"reference":"Kino Y, Washizu C, Kurosawa M, Oma Y, Hattori N, Ishiura S, Nukina N. 2014. Nuclear localization of MBNL1: splicing-mediated autoregulation and repression of repeat-derived aberrant proteins. Human Molecular Genetics 24: 740-756.
","pubmedId":"","doi":"10.1093/hmg/ddu492"},{"reference":"Lee HMT, Lim HY, He H, Lau CY, Zheng C. 2024. MBL-1/Muscleblind regulates neuronal differentiation and controls the splicing of a terminal selector in Caenorhabditis elegans. PLOS Genetics 20: e1011276.
","pubmedId":"","doi":"10.1371/journal.pgen.1011276"},{"reference":"Puri D, Sharma S, Samaddar S, Ravivarma S, Banerjee S, Ghosh-Roy A. 2023. Muscleblind-1 interacts with tubulin mRNAs to regulate the microtubule cytoskeleton in C. elegans mechanosensory neurons. PLOS Genetics 19: e1010885.
","pubmedId":"","doi":"10.1371/journal.pgen.1010885"},{"reference":"Spilker KA, Wang GJ, Tugizova MS, Shen K. 2012. Caenorhabditis elegans Muscleblind homolog mbl-1 functions in neurons to regulate synapse formation. Neural Development 7: 10.1186/1749-8104-7-7.
","pubmedId":"","doi":"10.1186/1749-8104-7-7"},{"reference":"Verbeeren J, Teixeira J, Garcia SMDA. 2023. The Muscleblind-like protein MBL-1 regulates microRNA expression in Caenorhabditis elegans through an evolutionarily conserved autoregulatory mechanism. PLOS Genetics 19: e1011109.
","pubmedId":"","doi":"10.1371/journal.pgen.1011109"},{"reference":"Xie J, Zou W, Tugizova M, Shen K, Wang X. 2023. MBL-1 and EEL-1 affect the splicing and protein levels of MEC-3 to control dendrite complexity. PLOS Genetics 19: e1010941.
","pubmedId":"","doi":"10.1371/journal.pgen.1010941"},{"reference":"Zheng C, Diaz-Cuadros M, Nguyen KCQ, Hall DH, Chalfie M. 2017. Distinct effects of tubulin isotype mutations on neurite growth in\n Caenorhabditis elegans. Molecular Biology of the Cell 28: 2786-2801.
","pubmedId":"","doi":"10.1091/mbc.E17-06-0424"}],"title":"Cytosolic localization of MBL-1/Muscleblind may be required for ectopic neurite outgrowth in a sensitized background in C. elegans
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null}]},{"id":"2f461bcf-bcf9-4001-b9f3-e4b01983dc92","decision":"publish","abstract":"The evolutionarily conserved RNA-binding protein Muscleblind can function as both a splicing regulator in the nucleus and a mRNA stabilizer in the cytosol. C. elegans mbl-1/Muscleblind undergoes alternative splicing to generate long and short isoforms that contain one or two KR motifs needed for nuclear localization. We generate three alleles that express MBL-1 proteins with two, one, or no KR motifs and find that the proteins with two KR motifs are restricted in the nucleus and could not promote neurite growth in a sensitized background. Surprisingly, proteins with one or no KR motifs are located in both cytoplasm and nucleus.
","acknowledgements":"We thank the National BioResource Project (NBRP), which is funded by the Japanese government, for providing strains.
","authors":[{"affiliations":["The University of Hong Kong"],"departments":["School of Biological Sciences"],"credit":["investigation","formalAnalysis","dataCuration","validation","visualization","writing_originalDraft"],"email":"tlhm20@connect.hku.hk","firstName":"Ho Ming Terence","lastName":"Lee","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["The University of Hong Kong"],"departments":["School of Biological Sciences"],"credit":["fundingAcquisition","conceptualization","project","supervision","writing_reviewEditing"],"email":"cgzheng@hku.hk","firstName":"Chaogu","lastName":"Zheng","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0002-5048-4520"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work is supported by the Research Grants Council of Hong Kong (GRF 17106322).
","image":{"url":"https://portal.micropublication.org/uploads/3da67948294f1305bfa04075cedb8070.jpg"},"imageCaption":"(A) Gene structure of mbl-1 and the molecular change of various alleles. Transcription of mbl-1 can start from exon 1 or exon 3. Exon 7 and 8 can be included or skipped to generate the long or short isoforms of mbl-1 through alternative splicing. Expected splicing pattern of mbl-1 gene from the three newly generated alleles. A forward primer binding to exon 3 and a reverse primer binding to exon 9 were used to amplify the mbl-1 cDNA. The expected sizes of the PCR fragments were listed. The results of the RT-PCR using the mbl-1 primers (F and R) and cDNA libraries prepared from different mutants are shown on the right. (B) Fluorescent images of TRNs (labelled by uIs115[mec-17p::TagRFP]) in mec-7(u278) and mec-7(u278); mbl-1(unk276) mutants. Scale bars, 100 μm. The quantification below showed the ALM-PN length in various strains. Three asterisks indicate p < 0.001 in a Dunnett’s test comparing the strains with mec-7(u278). Wild-type animals do not have a prominent ALM-PN. (C) Genomic DNA of mbl-1 from unk249, unk344, and unk276 were cloned, fused with GFP, and expressed under the mec-17 promoter. The fluorescent signals of GFP fusion with various MBL-1 mutants. The diffusive TagRFP signal labels the entire cell body. Scale bars, 5 μm. (D) RT-PCR results using primers specific for pqn-52c, pqn-72b, lgc-22a, and kin-4h isoforms and cDNA libraries from different mbl-1 mutants. The images on the right show the isoform-specific primer spanning particular exons. The primer and another primer that binds to an exon common to all isoforms were used to conduct the PCR experiment. ama-1 served as an internal control.
","imageTitle":"Cytoplasmic localization of MBL-1 may be required for its function in promoting neurite growth.
","methods":"To generate the three mbl-1 mutant alleles, we used CRISPR/Cas9-mediated genome editing to introduce double-strained breaks at two targeted sites (exons 6 and 9) in the endogenous mbl-1 locus. Specifically, pairs of single guide RNAs (sgRNAs) were synthesized using the EnGen sgRNA Synthesis Kit (NEB, E3322V). A total of 1 μg of each sgRNA pair, combined with 20 pmol of recombinant Cas9 protein (EnGen S. pyogenes Cas9 NLS, NEB, M0646T), was microinjected into the gonads of young adult C. elegans. For precise editing of selected exons, we followed an established protocol that uses single-stranded DNA oligonucleotides (0.1 μg/μl) as homologous repair templates (Dokshin et al., 2018). To prevent re-cleavage by Cas9, synonymous mutations were incorporated into the repair templates at the protospacer-adjacent motif (PAM) sites.
To create TRN-specific fluorescent reporter constructs for the three mbl-1 mutant alleles, we amplified the corresponding mutant genomic sequences and inserted them into a vector downstream of a 1.9 kb mec-17 promoter and in-frame with GFP using Gibson Assembly (ClonExpress II One Step Cloning Kit, Vazyme Biotech, Nanjing, China). These plasmid constructs were then microinjected into the gonads of young adult C. elegans to generate transgenic lines carrying extrachromosomal arrays.
To conduct RT-PCR, total RNA was extracted from L4 animals using TRIzol reagent (Thermo Fisher). cDNA libraries were prepared through reverse transcription of the total RNA using SuperScript II Reverse Transcriptase with oligo(dT)s (Thermo Fisher). Four candidates were selected for semi-quantitative RT-PCR using isoform-specific primers based on previous studies (Lee et al., 2024). ama-1 was used as an internal control for RT-PCR.
Fluorescence imaging was performed on a Leica DMi8 inverted microscope equipped with a Leica K5 monochrome camera. Images were acquired and analyzed using Leica Application Suite X software (version 3.7.2.22383). Measurements of ALM-PN length were obtained from day-1 adult animals cultivated at 20 °C, with at least 20 individuals scored per genotype.
","reagents":"Strain | Allele | Full Genotype |
unkEx898[mec-17p-mbl-1(del_ex7-8)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV | ||
mec-7(u278) X; unkEx898[mec-17p-mbl-1(del_ex7-8)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV | ||
mec-7(u278) X; mbl-1(tm1563) X; unkEx898[mec-17p-mbl-1(del_ex7-8)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV | ||
unkEx899[mec-17p-mbl-1(join_ex6-9)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV | ||
mec-7(u278) X; unkEx899[mec-17p-mbl-1(join_ex6-9)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV | ||
mec-7(u278) X; mbl-1(tm1563) X; unkEx899[mec-17p-mbl-1(join_ex6-9)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV | ||
unkEx1041(mec-17p-mbl-1(del_ex7-8_KR-motifs)-GFP-unc-54-3'utr; ceh-22p::GFP); uIs115[mec-17p::TagRFP] IV | ||
mec-7(u278) X; unkEx1041(mec-17p-mbl-1(del_ex7-8_KR-motifs)-GFP-unc-54-3'utr; ceh-22p::GFP); uIs115[mec-17p::TagRFP] IV | ||
mec-7(u278) X; mbl-1(tm1563) X; unkEx1041(mec-17p-mbl-1(del_ex7-8_KR-motifs)-GFP-unc-54-3'utr; ceh-22p::GFP); uIs115[mec-17p::TagRFP] IV |
CRISPR Reagents | Sequence | Purpose |
mbl-1-crispr-ex6 | TCAAGACCCTTATACAGCAG | Exon 6 target site - wild type background |
mbl-1-crispr-ex9 | GCTCCGTTCTTGTCGAGAGT | Exon 9 target site - wild type background |
mbl-1-repair-del8 | TACTACAACGGCATGATGTATCCACAAGTA CTACAGGATCCATACACTGCTGCGGCAGTGA ATCAG GGAGCTGTACCAATGAAGCGACCAA CACTGGATAAAAATGGTGCAATGTTATACTC ACCGGTAGCTCAGCAGGC | Repair templates - joining of exon 6 and 9 together (removal of exon 8 and adjacent introns) |
mbl-1-crispr-ex6_2 | TATGGATCCTGTAGTACTTG | Exon 6 target site - unk249 background |
mbl-1-crispr-ex9_2 | ACCAATGAAGCGACCAACAC | Exon 9 target site - unk249 background |
mbl-1-repair-ex8 | TACCCACCCTACTACAACGGCATGATGTATC CACAAGTACTTCAAGACCCTTATACAGCAGC GGCAGTGAATCAGCAGCTACAAACTGCCGC CTTGCTTGGCAACGTCGGAGGACTGCTTTC GGCTC AATCGGCGGCCGCCTTCATGGCCAA CTCGTCGGCAGCGGCTGCAGCAGCCCAACA AACGCCCT CACCGTTGCTTCGTCTGCAAAG GAAACGAGCGCTGGAAGAGGAGAACACGA ATGGCAACGATATGACGTCAGCAGCAGCGG CTCACACACAATTGCTCTCATTGGCCGCGG GAGCTGTACCAATGAAGCGACCAACTCTCG ACAAGA ACGGAGCAATGTTATACTCACCGG T | Repair templates - insert exon 8 between exon 6 and 9 |
mbl-1-repair-ex9 | TACCCACCCTACTACAACGGCATGATGTATC CACAAGTACTTCAAGACCCTTATACAGCAG CGGCAGTGAATCAGGGAGCTGTACCAATGC CAACTCTCGACAAGAACGGAGCAATGTTAT ACTCACCGGTAGCTCAGCAGGCACAACAATT | Repair templates - removal of KR motifs on exon 9 |
Primers | Sequence | Purpose |
S-mbl-1-ex6-F | ccgttccagCAACAACAAGC | CRISPR sequencing |
S-mbl-1-3'UTR-R | attcacatgactagcctcccag | CRISPR sequencing |
m17p-mbl-1-F | tgtgagacgattcgatcATGTTCGACGAAAACAGTAATGCCG | TRN-specific fluorescent reporter constructs cloning |
mbl-1-GFP-R | TTCTCCTTTACTGAATGGTGGTGGCTGCATGT | TRN-specific fluorescent reporter constructs cloning |
mbl-1_ATG_F | ATGTTCGACGAAAACAGTAATGCCG | mbl-1 RT-PCR |
mbl-1_TAG_R | CTAGAATGGTGGTGGCTGCATG | mbl-1 RT-PCR |
ama-1-cDNA-F | CGGAGGAGATTAAACGCATGTC | ama-1 RT-PCR |
ama-1-cDNA-R | CGAGCTCCGTTTTCTCTAATAATATACTTG | ama-1 RT-PCR |
kin-4-cDNA-f | AACTTGTTACGTGATGTACCCTTCTG | kin-4h RT-PCR |
kin-4h-cDNA-r | TGGCGATGGACTTCTCTATCTCATTT | kin-4h RT-PCR |
pqn-52-cDNA-f | CTCCATCGGACATCCGAATTCC | pqn-52c RT-PCR |
pqn-52-cDNA-r | GTGGTTTTTCTTGGGACTGTCC | pqn-52c RT-PCR |
pqn-72-cDNA-f | TCGGAACTTTATACGTCAGCAGTT | pqn-72b RT-PCR |
S-pqn-72-r | TTTCGATGGAACTCGATGAGTC | pqn-72b RT-PCR |
lgc-22-cDNA-f | CGTTGAAGTTGTGTCAATTACCCACT | lgc-22a RT-PCR |
S-lgc-22-r | ACAGTGGATAAAGCGAAGATGACG | lgc-22a RT-PCR |
The Muscleblind family comprises a group of evolutionarily conserved RNA-binding proteins that play key roles in various aspects of RNA metabolism, most notably in the regulation of alternative splicing. A defining feature of these proteins is the presence of tandem zinc finger domains, each composed of three cysteine residues and one histidine residue (Fernandez-Costa et al., 2011). Caenorhabditis elegans has a single ortholog of Muscleblind protein, MBL-1, which shows prominent expression in the nervous system. Loss-of-function studies have shown that mbl-1 is essential for the synaptic formation at the neuromuscular junctions (Spilker et al., 2012), dendritic morphogenesis in PVD sensory neurons (Xie et al., 2023), microtubule stability and axonal growth in touch receptor neurons (TRNs), and alternative splicing of terminal selectors like mec-3 (Lee et al., 2024). In addition to its classic role as a regulator of RNA splicing, recent studies have shown that MBL-1 also modulates mRNA stability through direct binding to target transcripts (Puri et al., 2023; Verbeeren et al., 2023). Since certain MBL-1 isoforms possess a pair of nuclear localization signals (NLS) while other isoforms do not, the protein may function both as a splicing regulator in the nucleus and an mRNA stabilizer in the cytoplasm. To disentangle the two functions, we engineered three alleles that produced MBL-1 proteins exclusively with or without the NLS and found that its presence in the cytoplasm is likely necessary to promote axonal growth in the TRNs.
Previous studies identified a bipartite nuclear localization signal (NLS) in mammalian Muscleblind MBNL proteins, consisting of two repeats of lysine-arginine residues (KR motifs) that regulate their subcellular localization (Kino et al., 2015). This bipartite KR motif is evolutionarily conserved in C. elegans MBL-1, with one located near the end of exon 8 and the second at the beginning of exon 9 (Verbeeren et al., 2023). Since exon 8 can be selectively included in some but not all isoforms, the gene can code for MBL-1 isoforms with one or two KR motifs (Fig. 1A). To perturb the NLS in MBL-1, Verbeeren et al. previously generated the mbl-1(syb4318) and mbl-1(syb4345) alleles. The syb4318 allele featured a deletion of exon 7 and 8 and part of the flanking introns, resulting in the expression of isoforms with only one KR motif, whereas the syb4345 allele involves a deletion of exon 7 and its flanking introns, leading to the expression of MBL-1 isoform with two KR motifs if the connected exons 6 and 8 are included in the mRNA. However, if the exon 6&8 is skipped, which would happen in the alternative splicing of mbl-1 mRNA, the syb4345 would still produces proteins with only one KR motif. Moreover, whether the single KR motif could still contribute to nuclear localization is unclear.
To address the above issues, we created three additional mbl-1 alleles through CRISPR/Cas9-mediated gene editing. First, the unk249 allele deleted exons 7 and 8 along with their flanking intronic sequences (thereby directly joining exons 6 and 9) and produced MBL-1 proteins with only one KR motif. Second, the unk344 allele was built on top of unk249 by further deleting the remaining KR motif, thus generating MBL-1 proteins with no KR motifs. Third, the unk276 allele, in which exon 7, the introns flanking exon 7, and the intron between exons 8 and 9 were deleted, resulting in the fusion of exon 6, 8, and 9 and the production of MBL-1 proteins with two KR motifs only (Fig. 1A). We conducted RT-PCR to examine and sequence the transcripts of mbl-1 in animals carrying the three alleles and confirmed that the gene editing indeed changed the sequence of the mbl-1 transcripts as expected (Fig. 1A).
To understand the functional significance of these MBL-1 isoforms in promoting axonal growth, we crossed the above mbl-1 alleles into the mec-7(u278) mutants, which served as a sensitized background to test the effects on neurite growth. mec-7 codes for a TRN-specific β-tubulin, and the u278(C303Y) is a gain-of-function mutation that led to the growth of a very long, ectopic posteriorly directed neurite in the ALM neurons (termed as ALM-PN) (Zheng et al., 2017). This ALM-PN does not exist or is very short in the wild-type animals. We previously found that the loss of mbl-1 completely suppressed the growth of ALM-PN in the mec-7(u278) mutants, suggesting that MBL-1 promotes neurite growth (Lee et al., 2024). Similar to the mbl-1 null allele, the unk276 allele (which only produces MBL-1 proteins with two KR motifs) also suppressed the ALM-PN growth (Fig. 1B), suggesting that the cytoplasmic presence of MBL-1 is likely required for its activity in promoting neurite growth. Both unk249 and unk344 alleles (which produces MBL-1 proteins with one or no KR motif) failed to suppress ALM-PN growth, suggesting that the KR motifs and nuclear localization may not be required for MBL-1's function in inducing neurite growth in the mec-7(u278) background.
To confirm the subcellular localization of the MBL-1 proteins produced by the above three alleles, we cloned the mbl-1 gene from the mutants, fused them with GFP-coding sequences, and expressed the fusion proteins under the TRN-specific mec-17 promoter. These reporters were introduced into the wild-type, mec-7(u278), and mec-7(u278) mbl-1(-) animals. As expected, the proteins with two KR motifs were restricted to the nucleus, whereas the proteins with one KR motif showed diffusive expression throughout the TRN cell body (Fig. 1C). To our surprise, MBL-1 proteins with no KR motifs still showed a diffusive localization pattern in the cells and was not excluded from the nucleus. This result hinted that MBL-1 may be able to enter the nucleus in a mechanism that is independent of the two KR motifs. The shorter isoforms (which skipped exon 7 and 8) likely have both cytoplasmic and nuclear localizations.
To confirm that the nucleus-localized MBL-1 produced by the unk276 allele is capable of splicing target genes, we analyzed four known MBL-1-regulated splicing events (Lee et al., 2024). The unk276 animals could promote the normal splicing of pqn-52c, pqn-72b, lgc-22a, and kin-4h isoforms, suggesting that the long MBL-1 isoform is functional in controlling mRNA splicing. The mbl-1(tm1563) deletion mutants served as a negative control (Fig. 1D). The MBL-1 proteins with one or no KR motifs produced by unk249 and unk344 alleles, respectively, could not promote the normal splicing of pqn-52c and pqn-72b but was able to promote the splicing of lgc-22a and kin-4h to the same extent as MBL-1 produced by unk276. Thus, the short MBL-1 isoform may still possess some ability to regular nuclear splicing, which is consistent with their nuclear localization.
MBL-1 is known to interact and stabilize the mRNAs of microtubule-related genes (such as mec-17/tubulin acetyltransferase, mec-7/β-tubulin, and mec-12/α-tubulin) (Puri et al., 2023), and we suspect that this mRNA-stabilizing role in the cytoplasm is essential for MBL-1's function in promoting microtubule stability and neurite growth. However, since we were not able to generate a version of MBL-1 that is exclusively cytoplasmic, it remains unclear whether its nuclear localization is also required for its function in neurite extension. Our previous work found that MBL-1 promotes the splicing of mec-3, which activates the expression of mec-17, mec-7, and mec-12. It is possible that MBL-1's canonical function as a splicing regulator in the nucleus also contribute to microtubule stabilization and neuronal morphogenesis.
","references":[{"reference":"Dokshin GA, Ghanta KS, Piscopo KM, Mello CC. 2018. Robust Genome Editing with Short Single-Stranded and Long, Partially Single-Stranded DNA Donors in\n Caenorhabditis elegans. Genetics 210: 781-787.
","pubmedId":"","doi":"10.1534/genetics.118.301532 "},{"reference":"Fernandez-Costa JM, Llamusi MB, Garcia-Lopez A, Artero R. 2011. Alternative splicing regulation by Muscleblind proteins: from development to disease. Biological Reviews 86: 947-958.
","pubmedId":"","doi":"10.1111/j.1469-185X.2011.00180.x"},{"reference":"Kino Y, Washizu C, Kurosawa M, Oma Y, Hattori N, Ishiura S, Nukina N. 2014. Nuclear localization of MBNL1: splicing-mediated autoregulation and repression of repeat-derived aberrant proteins. Human Molecular Genetics 24: 740-756.
","pubmedId":"","doi":"10.1093/hmg/ddu492"},{"reference":"Lee HMT, Lim HY, He H, Lau CY, Zheng C. 2024. MBL-1/Muscleblind regulates neuronal differentiation and controls the splicing of a terminal selector in Caenorhabditis elegans. PLOS Genetics 20: e1011276.
","pubmedId":"","doi":"10.1371/journal.pgen.1011276"},{"reference":"Puri D, Sharma S, Samaddar S, Ravivarma S, Banerjee S, Ghosh-Roy A. 2023. Muscleblind-1 interacts with tubulin mRNAs to regulate the microtubule cytoskeleton in C. elegans mechanosensory neurons. PLOS Genetics 19: e1010885.
","pubmedId":"","doi":"10.1371/journal.pgen.1010885"},{"reference":"Spilker KA, Wang GJ, Tugizova MS, Shen K. 2012. Caenorhabditis elegans Muscleblind homolog mbl-1 functions in neurons to regulate synapse formation. Neural Development 7: 10.1186/1749-8104-7-7.
","pubmedId":"","doi":"10.1186/1749-8104-7-7"},{"reference":"Verbeeren J, Teixeira J, Garcia SMDA. 2023. The Muscleblind-like protein MBL-1 regulates microRNA expression in Caenorhabditis elegans through an evolutionarily conserved autoregulatory mechanism. PLOS Genetics 19: e1011109.
","pubmedId":"","doi":"10.1371/journal.pgen.1011109"},{"reference":"Xie J, Zou W, Tugizova M, Shen K, Wang X. 2023. MBL-1 and EEL-1 affect the splicing and protein levels of MEC-3 to control dendrite complexity. PLOS Genetics 19: e1010941.
","pubmedId":"","doi":"10.1371/journal.pgen.1010941"},{"reference":"Zheng C, Diaz-Cuadros M, Nguyen KCQ, Hall DH, Chalfie M. 2017. Distinct effects of tubulin isotype mutations on neurite growth in\n Caenorhabditis elegans. Molecular Biology of the Cell 28: 2786-2801.
","pubmedId":"","doi":"10.1091/mbc.E17-06-0424"}],"title":"Cytosolic localization of MBL-1/Muscleblind may be required for ectopic neurite outgrowth in a sensitized background in C. elegans
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null}]},{"id":"1fa54251-c0f7-4c40-996f-d8e007a791a1","decision":"publish","abstract":"The evolutionarily conserved RNA-binding protein Muscleblind can function as both a splicing regulator in the nucleus and a mRNA stabilizer in the cytosol. C. elegans mbl-1/Muscleblind undergoes alternative splicing to generate long and short isoforms that contain one or two KR motifs needed for nuclear localization. We generate three alleles that express MBL-1 proteins with two, one, or no KR motifs and find that the proteins with two KR motifs are restricted in the nucleus and could not promote neurite growth in a sensitized background. Surprisingly, proteins with one or no KR motifs are located in both cytoplasm and nucleus.
","acknowledgements":"We thank the National BioResource Project (NBRP), which is funded by the Japanese government, for providing strains.
","authors":[{"affiliations":["The University of Hong Kong, Pokfulam, Hong Kong SAR, China"],"departments":["School of Biological Sciences"],"credit":["investigation","formalAnalysis","dataCuration","validation","visualization","writing_originalDraft"],"email":"tlhm20@connect.hku.hk","firstName":"Ho Ming Terence","lastName":"Lee","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["The University of Hong Kong, Pokfulam, Hong Kong SAR, China"],"departments":["School of Biological Sciences"],"credit":["fundingAcquisition","conceptualization","project","supervision","writing_reviewEditing"],"email":"cgzheng@hku.hk","firstName":"Chaogu","lastName":"Zheng","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0002-5048-4520"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work is supported by the Research Grants Council of Hong Kong (GRF 17106322).
","image":{"url":"https://portal.micropublication.org/uploads/3da67948294f1305bfa04075cedb8070.jpg"},"imageCaption":"(A) Gene structure of mbl-1 and the molecular change of various alleles. Transcription of mbl-1 can start from exon 1 or exon 3. Exon 7 and 8 can be included or skipped to generate the long or short isoforms of mbl-1 through alternative splicing. Expected splicing pattern of mbl-1 gene from the three newly generated alleles. A forward primer binding to exon 3 and a reverse primer binding to exon 9 were used to amplify the mbl-1 cDNA. The expected sizes of the PCR fragments were listed. The results of the RT-PCR using the mbl-1 primers (F and R) and cDNA libraries prepared from different mutants are shown on the right. (B) Fluorescent images of TRNs (labelled by uIs115[mec-17p::TagRFP]) in mec-7(u278) and mec-7(u278); mbl-1(unk276) mutants. Scale bars, 100 μm. The quantification below showed the ALM-PN length in various strains. Three asterisks indicate p < 0.001 in a Dunnett’s test comparing the strains with mec-7(u278). Wild-type animals do not have a prominent ALM-PN. (C) Genomic DNA of mbl-1 from unk249, unk344, and unk276 were cloned, fused with GFP, and expressed under the mec-17 promoter. The fluorescent signals of GFP fusion with various MBL-1 mutants. The diffusive TagRFP signal labels the entire cell body. Scale bars, 5 μm. (D) RT-PCR results using primers specific for pqn-52c, pqn-72b, lgc-22a, and kin-4h isoforms and cDNA libraries from different mbl-1 mutants. The images on the right show the isoform-specific primer spanning particular exons. The primer and another primer that binds to an exon common to all isoforms were used to conduct the PCR experiment. ama-1 served as an internal control.
","imageTitle":"Cytoplasmic localization of MBL-1 may be required for its function in promoting neurite growth.
","methods":"To generate the three mbl-1 mutant alleles, we used CRISPR/Cas9-mediated genome editing to introduce double-strained breaks at two targeted sites (exons 6 and 9) in the endogenous mbl-1 locus. Specifically, pairs of single guide RNAs (sgRNAs) were synthesized using the EnGen sgRNA Synthesis Kit (NEB, E3322V). A total of 1 μg of each sgRNA pair, combined with 20 pmol of recombinant Cas9 protein (EnGen S. pyogenes Cas9 NLS, NEB, M0646T), was microinjected into the gonads of young adult C. elegans. For precise editing of selected exons, we followed an established protocol that uses single-stranded DNA oligonucleotides (0.1 μg/μl) as homologous repair templates (Dokshin et al., 2018). To prevent re-cleavage by Cas9, synonymous mutations were incorporated into the repair templates at the protospacer-adjacent motif (PAM) sites.
To create TRN-specific fluorescent reporter constructs for the three mbl-1 mutant alleles, we amplified the corresponding mutant genomic sequences and inserted them into a vector downstream of a 1.9 kb mec-17 promoter and in-frame with GFP using Gibson Assembly (ClonExpress II One Step Cloning Kit, Vazyme Biotech, Nanjing, China). These plasmid constructs were then microinjected into the gonads of young adult C. elegans to generate transgenic lines carrying extrachromosomal arrays.
To conduct RT-PCR, total RNA was extracted from L4 animals using TRIzol reagent (Thermo Fisher). cDNA libraries were prepared through reverse transcription of the total RNA using SuperScript II Reverse Transcriptase with oligo(dT)s (Thermo Fisher). Four candidates were selected for semi-quantitative RT-PCR using isoform-specific primers based on previous studies (Lee et al., 2024). ama-1 was used as an internal control for RT-PCR.
Fluorescence imaging was performed on a Leica DMi8 inverted microscope equipped with a Leica K5 monochrome camera. Images were acquired and analyzed using Leica Application Suite X software (version 3.7.2.22383). Measurements of ALM-PN length were obtained from day-1 adult animals cultivated at 20 °C, with at least 20 individuals scored per genotype.
","reagents":"Strain | Allele | Full Genotype |
unkEx898[mec-17p-mbl-1(del_ex7-8)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV | ||
mec-7(u278) X; unkEx898[mec-17p-mbl-1(del_ex7-8)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV | ||
mec-7(u278) X; mbl-1(tm1563) X; unkEx898[mec-17p-mbl-1(del_ex7-8)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV | ||
unkEx899[mec-17p-mbl-1(join_ex6-9)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV | ||
mec-7(u278) X; unkEx899[mec-17p-mbl-1(join_ex6-9)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV | ||
mec-7(u278) X; mbl-1(tm1563) X; unkEx899[mec-17p-mbl-1(join_ex6-9)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV | ||
unkEx1041(mec-17p-mbl-1(del_ex7-8_KR-motifs)-GFP-unc-54-3'utr; ceh-22p::GFP); uIs115[mec-17p::TagRFP] IV | ||
mec-7(u278) X; unkEx1041(mec-17p-mbl-1(del_ex7-8_KR-motifs)-GFP-unc-54-3'utr; ceh-22p::GFP); uIs115[mec-17p::TagRFP] IV | ||
mec-7(u278) X; mbl-1(tm1563) X; unkEx1041(mec-17p-mbl-1(del_ex7-8_KR-motifs)-GFP-unc-54-3'utr; ceh-22p::GFP); uIs115[mec-17p::TagRFP] IV |
CRISPR Reagents | Sequence | Purpose |
mbl-1-crispr-ex6 | TCAAGACCCTTATACAGCAG | Exon 6 target site - wild type background |
mbl-1-crispr-ex9 | GCTCCGTTCTTGTCGAGAGT | Exon 9 target site - wild type background |
mbl-1-repair-del8 | TACTACAACGGCATGATGTATCCACAAGTA CTACAGGATCCATACACTGCTGCGGCAGTGA ATCAG GGAGCTGTACCAATGAAGCGACCAA CACTGGATAAAAATGGTGCAATGTTATACTC ACCGGTAGCTCAGCAGGC | Repair templates - joining of exon 6 and 9 together (removal of exon 8 and adjacent introns) |
mbl-1-crispr-ex6_2 | TATGGATCCTGTAGTACTTG | Exon 6 target site - unk249 background |
mbl-1-crispr-ex9_2 | ACCAATGAAGCGACCAACAC | Exon 9 target site - unk249 background |
mbl-1-repair-ex8 | TACCCACCCTACTACAACGGCATGATGTATC CACAAGTACTTCAAGACCCTTATACAGCAGC GGCAGTGAATCAGCAGCTACAAACTGCCGC CTTGCTTGGCAACGTCGGAGGACTGCTTTC GGCTC AATCGGCGGCCGCCTTCATGGCCAA CTCGTCGGCAGCGGCTGCAGCAGCCCAACA AACGCCCT CACCGTTGCTTCGTCTGCAAAG GAAACGAGCGCTGGAAGAGGAGAACACGA ATGGCAACGATATGACGTCAGCAGCAGCGG CTCACACACAATTGCTCTCATTGGCCGCGG GAGCTGTACCAATGAAGCGACCAACTCTCG ACAAGA ACGGAGCAATGTTATACTCACCGG T | Repair templates - insert exon 8 between exon 6 and 9 |
mbl-1-repair-ex9 | TACCCACCCTACTACAACGGCATGATGTATC CACAAGTACTTCAAGACCCTTATACAGCAG CGGCAGTGAATCAGGGAGCTGTACCAATGC CAACTCTCGACAAGAACGGAGCAATGTTAT ACTCACCGGTAGCTCAGCAGGCACAACAATT | Repair templates - removal of KR motifs on exon 9 |
Primers | Sequence | Purpose |
S-mbl-1-ex6-F | ccgttccagCAACAACAAGC | CRISPR sequencing |
S-mbl-1-3'UTR-R | attcacatgactagcctcccag | CRISPR sequencing |
m17p-mbl-1-F | tgtgagacgattcgatcATGTTCGACGAAAACAGTAATGCCG | TRN-specific fluorescent reporter constructs cloning |
mbl-1-GFP-R | TTCTCCTTTACTGAATGGTGGTGGCTGCATGT | TRN-specific fluorescent reporter constructs cloning |
mbl-1_ATG_F | ATGTTCGACGAAAACAGTAATGCCG | mbl-1 RT-PCR |
mbl-1_TAG_R | CTAGAATGGTGGTGGCTGCATG | mbl-1 RT-PCR |
ama-1-cDNA-F | CGGAGGAGATTAAACGCATGTC | ama-1 RT-PCR |
ama-1-cDNA-R | CGAGCTCCGTTTTCTCTAATAATATACTTG | ama-1 RT-PCR |
kin-4-cDNA-f | AACTTGTTACGTGATGTACCCTTCTG | kin-4h RT-PCR |
kin-4h-cDNA-r | TGGCGATGGACTTCTCTATCTCATTT | kin-4h RT-PCR |
pqn-52-cDNA-f | CTCCATCGGACATCCGAATTCC | pqn-52c RT-PCR |
pqn-52-cDNA-r | GTGGTTTTTCTTGGGACTGTCC | pqn-52c RT-PCR |
pqn-72-cDNA-f | TCGGAACTTTATACGTCAGCAGTT | pqn-72b RT-PCR |
S-pqn-72-r | TTTCGATGGAACTCGATGAGTC | pqn-72b RT-PCR |
lgc-22-cDNA-f | CGTTGAAGTTGTGTCAATTACCCACT | lgc-22a RT-PCR |
S-lgc-22-r | ACAGTGGATAAAGCGAAGATGACG | lgc-22a RT-PCR |
The Muscleblind family comprises a group of evolutionarily conserved RNA-binding proteins that play key roles in various aspects of RNA metabolism, most notably in the regulation of alternative splicing. A defining feature of these proteins is the presence of tandem zinc finger domains, each composed of three cysteine residues and one histidine residue (Fernandez-Costa et al., 2011). Caenorhabditis elegans has a single ortholog of Muscleblind protein, MBL-1, which shows prominent expression in the nervous system. Loss-of-function studies have shown that mbl-1 is essential for the synaptic formation at the neuromuscular junctions (Spilker et al., 2012), dendritic morphogenesis in PVD sensory neurons (Xie et al., 2023), microtubule stability and axonal growth in touch receptor neurons (TRNs), and alternative splicing of terminal selectors like mec-3 (Lee et al., 2024). In addition to its classic role as a regulator of RNA splicing, recent studies have shown that MBL-1 also modulates mRNA stability through direct binding to target transcripts (Puri et al., 2023; Verbeeren et al., 2023). Since certain MBL-1 isoforms possess a pair of nuclear localization signals (NLS) while other isoforms do not, the protein may function both as a splicing regulator in the nucleus and an mRNA stabilizer in the cytoplasm. To disentangle the two functions, we engineered three alleles that produced MBL-1 proteins exclusively with or without the NLS and found that its presence in the cytoplasm is likely necessary to promote axonal growth in the TRNs.
Previous studies identified a bipartite nuclear localization signal (NLS) in mammalian Muscleblind MBNL proteins, consisting of two repeats of lysine-arginine residues (KR motifs) that regulate their subcellular localization (Kino et al., 2015). This bipartite KR motif is evolutionarily conserved in C. elegans MBL-1, with one located near the end of exon 8 and the second at the beginning of exon 9 (Verbeeren et al., 2023). Since exon 8 can be selectively included in some but not all isoforms, the gene can code for MBL-1 isoforms with one or two KR motifs (Fig. 1A). To perturb the NLS in MBL-1, Verbeeren et al. previously generated the mbl-1(syb4318) and mbl-1(syb4345) alleles. The syb4318 allele featured a deletion of exon 7 and 8 and part of the flanking introns, resulting in the expression of isoforms with only one KR motif, whereas the syb4345 allele involves a deletion of exon 7 and its flanking introns, leading to the expression of MBL-1 isoform with two KR motifs if the connected exons 6 and 8 are included in the mRNA. However, if the exon 6&8 is skipped, which would happen in the alternative splicing of mbl-1 mRNA, the syb4345 would still produces proteins with only one KR motif. Moreover, whether the single KR motif could still contribute to nuclear localization is unclear.
To address the above issues, we created three additional mbl-1 alleles through CRISPR/Cas9-mediated gene editing. First, the unk249 allele deleted exons 7 and 8 along with their flanking intronic sequences (thereby directly joining exons 6 and 9) and produced MBL-1 proteins with only one KR motif. Second, the unk344 allele was built on top of unk249 by further deleting the remaining KR motif, thus generating MBL-1 proteins with no KR motifs. Third, the unk276 allele, in which exon 7, the introns flanking exon 7, and the intron between exons 8 and 9 were deleted, resulting in the fusion of exon 6, 8, and 9 and the production of MBL-1 proteins with two KR motifs only (Fig. 1A). We conducted RT-PCR to examine and sequence the transcripts of mbl-1 in animals carrying the three alleles and confirmed that the gene editing indeed changed the sequence of the mbl-1 transcripts as expected (Fig. 1A).
To understand the functional significance of these MBL-1 isoforms in promoting axonal growth, we crossed the above mbl-1 alleles into the mec-7(u278) mutants, which served as a sensitized background to test the effects on neurite growth. mec-7 codes for a TRN-specific β-tubulin, and the u278(C303Y) is a gain-of-function mutation that led to the growth of a very long, ectopic posteriorly directed neurite in the ALM neurons (termed as ALM-PN) (Zheng et al., 2017). This ALM-PN does not exist or is very short in the wild-type animals. We previously found that the loss of mbl-1 completely suppressed the growth of ALM-PN in the mec-7(u278) mutants, suggesting that MBL-1 promotes neurite growth (Lee et al., 2024). Similar to the mbl-1 null allele, the unk276 allele (which only produces MBL-1 proteins with two KR motifs) also suppressed the ALM-PN growth (Fig. 1B), suggesting that the cytoplasmic presence of MBL-1 is likely required for its activity in promoting neurite growth. Both unk249 and unk344 alleles (which produces MBL-1 proteins with one or no KR motif) failed to suppress ALM-PN growth, suggesting that the KR motifs and nuclear localization may not be required for MBL-1's function in inducing neurite growth in the mec-7(u278) background.
To confirm the subcellular localization of the MBL-1 proteins produced by the above three alleles, we cloned the mbl-1 gene from the mutants, fused them with GFP-coding sequences, and expressed the fusion proteins under the TRN-specific mec-17 promoter. These reporters were introduced into the wild-type, mec-7(u278), and mec-7(u278) mbl-1(-) animals. As expected, the proteins with two KR motifs were restricted to the nucleus, whereas the proteins with one KR motif showed diffusive expression throughout the TRN cell body (Fig. 1C). To our surprise, MBL-1 proteins with no KR motifs still showed a diffusive localization pattern in the cells and was not excluded from the nucleus. This result hinted that MBL-1 may be able to enter the nucleus in a mechanism that is independent of the two KR motifs. The shorter isoforms (which skipped exon 7 and 8) likely have both cytoplasmic and nuclear localizations.
To confirm that the nucleus-localized MBL-1 produced by the unk276 allele is capable of splicing target genes, we analyzed four known MBL-1-regulated splicing events (Lee et al., 2024). The unk276 animals could promote the normal splicing of pqn-52c, pqn-72b, lgc-22a, and kin-4h isoforms, suggesting that the long MBL-1 isoform is functional in controlling mRNA splicing. The mbl-1(tm1563) deletion mutants served as a negative control (Fig. 1D). The MBL-1 proteins with one or no KR motifs produced by unk249 and unk344 alleles, respectively, could not promote the normal splicing of pqn-52c and pqn-72b but was able to promote the splicing of lgc-22a and kin-4h to the same extent as MBL-1 produced by unk276. Thus, the short MBL-1 isoform may still possess some ability to regular nuclear splicing, which is consistent with their nuclear localization.
MBL-1 is known to interact and stabilize the mRNAs of microtubule-related genes (such as mec-17/tubulin acetyltransferase, mec-7/β-tubulin, and mec-12/α-tubulin) (Puri et al., 2023), and we suspect that this mRNA-stabilizing role in the cytoplasm is essential for MBL-1's function in promoting microtubule stability and neurite growth. However, since we were not able to generate a version of MBL-1 that is exclusively cytoplasmic, it remains unclear whether its nuclear localization is also required for its function in neurite extension. Our previous work found that MBL-1 promotes the splicing of mec-3, which activates the expression of mec-17, mec-7, and mec-12. It is possible that MBL-1's canonical function as a splicing regulator in the nucleus also contribute to microtubule stabilization and neuronal morphogenesis.
","references":[{"reference":"Dokshin GA, Ghanta KS, Piscopo KM, Mello CC. 2018. Robust Genome Editing with Short Single-Stranded and Long, Partially Single-Stranded DNA Donors in\n Caenorhabditis elegans. Genetics 210: 781-787.
","pubmedId":"","doi":"10.1534/genetics.118.301532 "},{"reference":"Fernandez-Costa JM, Llamusi MB, Garcia-Lopez A, Artero R. 2011. Alternative splicing regulation by Muscleblind proteins: from development to disease. Biological Reviews 86: 947-958.
","pubmedId":"","doi":"10.1111/j.1469-185X.2011.00180.x"},{"reference":"Kino Y, Washizu C, Kurosawa M, Oma Y, Hattori N, Ishiura S, Nukina N. 2014. Nuclear localization of MBNL1: splicing-mediated autoregulation and repression of repeat-derived aberrant proteins. Human Molecular Genetics 24: 740-756.
","pubmedId":"","doi":"10.1093/hmg/ddu492"},{"reference":"Lee HMT, Lim HY, He H, Lau CY, Zheng C. 2024. MBL-1/Muscleblind regulates neuronal differentiation and controls the splicing of a terminal selector in Caenorhabditis elegans. PLOS Genetics 20: e1011276.
","pubmedId":"","doi":"10.1371/journal.pgen.1011276"},{"reference":"Puri D, Sharma S, Samaddar S, Ravivarma S, Banerjee S, Ghosh-Roy A. 2023. Muscleblind-1 interacts with tubulin mRNAs to regulate the microtubule cytoskeleton in C. elegans mechanosensory neurons. PLOS Genetics 19: e1010885.
","pubmedId":"","doi":"10.1371/journal.pgen.1010885"},{"reference":"Spilker KA, Wang GJ, Tugizova MS, Shen K. 2012. Caenorhabditis elegans Muscleblind homolog mbl-1 functions in neurons to regulate synapse formation. Neural Development 7: 10.1186/1749-8104-7-7.
","pubmedId":"","doi":"10.1186/1749-8104-7-7"},{"reference":"Verbeeren J, Teixeira J, Garcia SMDA. 2023. The Muscleblind-like protein MBL-1 regulates microRNA expression in Caenorhabditis elegans through an evolutionarily conserved autoregulatory mechanism. PLOS Genetics 19: e1011109.
","pubmedId":"","doi":"10.1371/journal.pgen.1011109"},{"reference":"Xie J, Zou W, Tugizova M, Shen K, Wang X. 2023. MBL-1 and EEL-1 affect the splicing and protein levels of MEC-3 to control dendrite complexity. PLOS Genetics 19: e1010941.
","pubmedId":"","doi":"10.1371/journal.pgen.1010941"},{"reference":"Zheng C, Diaz-Cuadros M, Nguyen KCQ, Hall DH, Chalfie M. 2017. Distinct effects of tubulin isotype mutations on neurite growth in\n Caenorhabditis elegans. Molecular Biology of the Cell 28: 2786-2801.
","pubmedId":"","doi":"10.1091/mbc.E17-06-0424"}],"title":"Cytosolic localization of MBL-1/Muscleblind may be required for ectopic neurite outgrowth in a sensitized background in C. elegans
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null}]},{"id":"bbed18f0-d6d8-46c1-b36b-ea4a1cbfca01","decision":"publish","abstract":"The evolutionarily conserved RNA-binding protein Muscleblind can function as both a splicing regulator in the nucleus and a mRNA stabilizer in the cytosol. C. elegans mbl-1/Muscleblind undergoes alternative splicing to generate long and short isoforms that contain one or two KR motifs needed for nuclear localization. We generate three alleles that express MBL-1 proteins with two, one, or no KR motifs and find that the proteins with two KR motifs are restricted in the nucleus and could not promote neurite growth in a sensitized background. Surprisingly, proteins with one or no KR motifs are located in both cytoplasm and nucleus.
","acknowledgements":"We thank the National BioResource Project (NBRP), which is funded by the Japanese government, for providing strains.
","authors":[{"affiliations":["The University of Hong Kong, Pokfulam, Hong Kong SAR, China"],"departments":["School of Biological Sciences"],"credit":["investigation","formalAnalysis","dataCuration","validation","visualization","writing_originalDraft"],"email":"tlhm20@connect.hku.hk","firstName":"Ho Ming Terence","lastName":"Lee","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["The University of Hong Kong, Pokfulam, Hong Kong SAR, China"],"departments":["School of Biological Sciences"],"credit":["fundingAcquisition","conceptualization","project","supervision","writing_reviewEditing"],"email":"cgzheng@hku.hk","firstName":"Chaogu","lastName":"Zheng","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0002-5048-4520"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work is supported by the Research Grants Council of Hong Kong (GRF 17106322).
","image":{"url":"https://portal.micropublication.org/uploads/3da67948294f1305bfa04075cedb8070.jpg"},"imageCaption":"(A) Gene structure of mbl-1 and the molecular change of various alleles. Transcription of mbl-1 can start from exon 1 or exon 3. Exon 7 and 8 can be included or skipped to generate the long or short isoforms of mbl-1 through alternative splicing. Expected splicing pattern of mbl-1 gene from the three newly generated alleles. A forward primer binding to exon 3 and a reverse primer binding to exon 9 were used to amplify the mbl-1 cDNA. The expected sizes of the PCR fragments were listed. The results of the RT-PCR using the mbl-1 primers (F and R) and cDNA libraries prepared from different mutants are shown on the right. (B) Fluorescent images of TRNs (labelled by uIs115[mec-17p::TagRFP]) in mec-7(u278) and mec-7(u278); mbl-1(unk276) mutants. Scale bars, 100 μm. The quantification below showed the ALM-PN length in various strains. Three asterisks indicate p < 0.001 in a Dunnett’s test comparing the strains with mec-7(u278). Wild-type animals do not have a prominent ALM-PN. (C) Genomic DNA of mbl-1 from unk249, unk344, and unk276 were cloned, fused with GFP, and expressed under the mec-17 promoter. The fluorescent signals of GFP fusion with various MBL-1 mutants. The diffusive TagRFP signal labels the entire cell body. Scale bars, 5 μm. (D) RT-PCR results using primers specific for pqn-52c, pqn-72b, lgc-22a, and kin-4h isoforms and cDNA libraries from different mbl-1 mutants. The images on the right show the isoform-specific primer spanning particular exons. The primer and another primer that binds to an exon common to all isoforms were used to conduct the PCR experiment. ama-1 served as an internal control.
","imageTitle":"Cytoplasmic localization of MBL-1 may be required for its function in promoting neurite growth
","methods":"To generate the three mbl-1 mutant alleles, we used CRISPR/Cas9-mediated genome editing to introduce double-strained breaks at two targeted sites (exons 6 and 9) in the endogenous mbl-1 locus. Specifically, pairs of single guide RNAs (sgRNAs) were synthesized using the EnGen sgRNA Synthesis Kit (NEB, E3322V). A total of 1 μg of each sgRNA pair, combined with 20 pmol of recombinant Cas9 protein (EnGen S. pyogenes Cas9 NLS, NEB, M0646T), was microinjected into the gonads of young adult C. elegans. For precise editing of selected exons, we followed an established protocol that uses single-stranded DNA oligonucleotides (0.1 μg/μl) as homologous repair templates (Dokshin et al., 2018). To prevent re-cleavage by Cas9, synonymous mutations were incorporated into the repair templates at the protospacer-adjacent motif (PAM) sites.
To create TRN-specific fluorescent reporter constructs for the three mbl-1 mutant alleles, we amplified the corresponding mutant genomic sequences and inserted them into a vector downstream of a 1.9 kb mec-17 promoter and in-frame with GFP using Gibson Assembly (ClonExpress II One Step Cloning Kit, Vazyme Biotech, Nanjing, China). These plasmid constructs were then microinjected into the gonads of young adult C. elegans to generate transgenic lines carrying extrachromosomal arrays.
To conduct RT-PCR, total RNA was extracted from L4 animals using TRIzol reagent (Thermo Fisher). cDNA libraries were prepared through reverse transcription of the total RNA using SuperScript II Reverse Transcriptase with oligo(dT)s (Thermo Fisher). Four candidates were selected for semi-quantitative RT-PCR using isoform-specific primers based on previous studies (Lee et al., 2024). ama-1 was used as an internal control for RT-PCR.
Fluorescence imaging was performed on a Leica DMi8 inverted microscope equipped with a Leica K5 monochrome camera. Images were acquired and analyzed using Leica Application Suite X software (version 3.7.2.22383). Measurements of ALM-PN length were obtained from day-1 adult animals cultivated at 20 °C, with at least 20 individuals scored per genotype.
","reagents":"Strain | Allele | Full Genotype |
unkEx898[mec-17p-mbl-1(del_ex7-8)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV | ||
mec-7(u278) X; unkEx898[mec-17p-mbl-1(del_ex7-8)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV | ||
mec-7(u278) X; mbl-1(tm1563) X; unkEx898[mec-17p-mbl-1(del_ex7-8)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV | ||
unkEx899[mec-17p-mbl-1(join_ex6-9)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV | ||
mec-7(u278) X; unkEx899[mec-17p-mbl-1(join_ex6-9)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV | ||
mec-7(u278) X; mbl-1(tm1563) X; unkEx899[mec-17p-mbl-1(join_ex6-9)-GFP-unc-54-3'utr; ceh-22p::GFP]; uIs115[mec-17p::TagRFP] IV | ||
unkEx1041(mec-17p-mbl-1(del_ex7-8_KR-motifs)-GFP-unc-54-3'utr; ceh-22p::GFP); uIs115[mec-17p::TagRFP] IV | ||
mec-7(u278) X; unkEx1041(mec-17p-mbl-1(del_ex7-8_KR-motifs)-GFP-unc-54-3'utr; ceh-22p::GFP); uIs115[mec-17p::TagRFP] IV | ||
mec-7(u278) X; mbl-1(tm1563) X; unkEx1041(mec-17p-mbl-1(del_ex7-8_KR-motifs)-GFP-unc-54-3'utr; ceh-22p::GFP); uIs115[mec-17p::TagRFP] IV |
CRISPR Reagents | Sequence | Purpose |
mbl-1-crispr-ex6 | TCAAGACCCTTATACAGCAG | Exon 6 target site - wild type background |
mbl-1-crispr-ex9 | GCTCCGTTCTTGTCGAGAGT | Exon 9 target site - wild type background |
mbl-1-repair-del8 | TACTACAACGGCATGATGTATCCACAAGTA CTACAGGATCCATACACTGCTGCGGCAGTGA ATCAG GGAGCTGTACCAATGAAGCGACCAA CACTGGATAAAAATGGTGCAATGTTATACTC ACCGGTAGCTCAGCAGGC | Repair templates - joining of exon 6 and 9 together (removal of exon 8 and adjacent introns) |
mbl-1-crispr-ex6_2 | TATGGATCCTGTAGTACTTG | Exon 6 target site - unk249 background |
mbl-1-crispr-ex9_2 | ACCAATGAAGCGACCAACAC | Exon 9 target site - unk249 background |
mbl-1-repair-ex8 | TACCCACCCTACTACAACGGCATGATGTATC CACAAGTACTTCAAGACCCTTATACAGCAGC GGCAGTGAATCAGCAGCTACAAACTGCCGC CTTGCTTGGCAACGTCGGAGGACTGCTTTC GGCTC AATCGGCGGCCGCCTTCATGGCCAA CTCGTCGGCAGCGGCTGCAGCAGCCCAACA AACGCCCT CACCGTTGCTTCGTCTGCAAAG GAAACGAGCGCTGGAAGAGGAGAACACGA ATGGCAACGATATGACGTCAGCAGCAGCGG CTCACACACAATTGCTCTCATTGGCCGCGG GAGCTGTACCAATGAAGCGACCAACTCTCG ACAAGA ACGGAGCAATGTTATACTCACCGG T | Repair templates - insert exon 8 between exon 6 and 9 |
mbl-1-repair-ex9 | TACCCACCCTACTACAACGGCATGATGTATC CACAAGTACTTCAAGACCCTTATACAGCAG CGGCAGTGAATCAGGGAGCTGTACCAATGC CAACTCTCGACAAGAACGGAGCAATGTTAT ACTCACCGGTAGCTCAGCAGGCACAACAATT | Repair templates - removal of KR motifs on exon 9 |
Primers | Sequence | Purpose |
S-mbl-1-ex6-F | ccgttccagCAACAACAAGC | CRISPR sequencing |
S-mbl-1-3'UTR-R | attcacatgactagcctcccag | CRISPR sequencing |
m17p-mbl-1-F | tgtgagacgattcgatcATGTTCGACGAAAACAGTAATGCCG | TRN-specific fluorescent reporter constructs cloning |
mbl-1-GFP-R | TTCTCCTTTACTGAATGGTGGTGGCTGCATGT | TRN-specific fluorescent reporter constructs cloning |
mbl-1_ATG_F | ATGTTCGACGAAAACAGTAATGCCG | mbl-1 RT-PCR |
mbl-1_TAG_R | CTAGAATGGTGGTGGCTGCATG | mbl-1 RT-PCR |
ama-1-cDNA-F | CGGAGGAGATTAAACGCATGTC | ama-1 RT-PCR |
ama-1-cDNA-R | CGAGCTCCGTTTTCTCTAATAATATACTTG | ama-1 RT-PCR |
kin-4-cDNA-f | AACTTGTTACGTGATGTACCCTTCTG | kin-4h RT-PCR |
kin-4h-cDNA-r | TGGCGATGGACTTCTCTATCTCATTT | kin-4h RT-PCR |
pqn-52-cDNA-f | CTCCATCGGACATCCGAATTCC | pqn-52c RT-PCR |
pqn-52-cDNA-r | GTGGTTTTTCTTGGGACTGTCC | pqn-52c RT-PCR |
pqn-72-cDNA-f | TCGGAACTTTATACGTCAGCAGTT | pqn-72b RT-PCR |
S-pqn-72-r | TTTCGATGGAACTCGATGAGTC | pqn-72b RT-PCR |
lgc-22-cDNA-f | CGTTGAAGTTGTGTCAATTACCCACT | lgc-22a RT-PCR |
S-lgc-22-r | ACAGTGGATAAAGCGAAGATGACG | lgc-22a RT-PCR |
The Muscleblind family comprises a group of evolutionarily conserved RNA-binding proteins that play key roles in various aspects of RNA metabolism, most notably in the regulation of alternative splicing. A defining feature of these proteins is the presence of tandem zinc finger domains, each composed of three cysteine residues and one histidine residue (Fernandez-Costa et al., 2011). Caenorhabditis elegans has a single ortholog of Muscleblind protein, MBL-1, which shows prominent expression in the nervous system. Loss-of-function studies have shown that mbl-1 is essential for the synaptic formation at the neuromuscular junctions (Spilker et al., 2012), dendritic morphogenesis in PVD sensory neurons (Xie et al., 2023), microtubule stability and axonal growth in touch receptor neurons (TRNs), and alternative splicing of terminal selectors like mec-3 (Lee et al., 2024). In addition to its classic role as a regulator of RNA splicing, recent studies have shown that MBL-1 also modulates mRNA stability through direct binding to target transcripts (Puri et al., 2023; Verbeeren et al., 2023). Since certain MBL-1 isoforms possess a pair of nuclear localization signals (NLS) while other isoforms do not, the protein may function both as a splicing regulator in the nucleus and an mRNA stabilizer in the cytoplasm. To disentangle the two functions, we engineered three alleles that produced MBL-1 proteins exclusively with or without the NLS and found that its presence in the cytoplasm is likely necessary to promote axonal growth in the TRNs.
Previous studies identified a bipartite nuclear localization signal (NLS) in mammalian Muscleblind MBNL proteins, consisting of two repeats of lysine-arginine residues (KR motifs) that regulate their subcellular localization (Kino et al., 2015). This bipartite KR motif is evolutionarily conserved in C. elegans MBL-1, with one located near the end of exon 8 and the second at the beginning of exon 9 (Verbeeren et al., 2023). Since exon 8 can be selectively included in some but not all isoforms, the gene can code for MBL-1 isoforms with one or two KR motifs (Fig. 1A). To perturb the NLS in MBL-1, Verbeeren et al. previously generated the mbl-1(syb4318) and mbl-1(syb4345) alleles. The syb4318 allele featured a deletion of exon 7 and 8 and part of the flanking introns, resulting in the expression of isoforms with only one KR motif, whereas the syb4345 allele involves a deletion of exon 7 and its flanking introns, leading to the expression of MBL-1 isoform with two KR motifs if the connected exons 6 and 8 are included in the mRNA. However, if the exon 6&8 is skipped, which would happen in the alternative splicing of mbl-1 mRNA, the syb4345 would still produces proteins with only one KR motif. Moreover, whether the single KR motif could still contribute to nuclear localization is unclear.
To address the above issues, we created three additional mbl-1 alleles through CRISPR/Cas9-mediated gene editing. First, the unk249 allele deleted exons 7 and 8 along with their flanking intronic sequences (thereby directly joining exons 6 and 9) and produced MBL-1 proteins with only one KR motif. Second, the unk344 allele was built on top of unk249 by further deleting the remaining KR motif, thus generating MBL-1 proteins with no KR motifs. Third, the unk276 allele, in which exon 7, the introns flanking exon 7, and the intron between exons 8 and 9 were deleted, resulting in the fusion of exon 6, 8, and 9 and the production of MBL-1 proteins with two KR motifs only (Fig. 1A). We conducted RT-PCR to examine and sequence the transcripts of mbl-1 in animals carrying the three alleles and confirmed that the gene editing indeed changed the sequence of the mbl-1 transcripts as expected (Fig. 1A).
To understand the functional significance of these MBL-1 isoforms in promoting axonal growth, we crossed the above mbl-1 alleles into the mec-7(u278) mutants, which served as a sensitized background to test the effects on neurite growth. mec-7 codes for a TRN-specific β-tubulin, and the u278(C303Y) is a gain-of-function mutation that led to the growth of a very long, ectopic posteriorly directed neurite in the ALM neurons (termed as ALM-PN) (Zheng et al., 2017). This ALM-PN does not exist or is very short in the wild-type animals. We previously found that the loss of mbl-1 completely suppressed the growth of ALM-PN in the mec-7(u278) mutants, suggesting that MBL-1 promotes neurite growth (Lee et al., 2024). Similar to the mbl-1 null allele, the unk276 allele (which only produces MBL-1 proteins with two KR motifs) also suppressed the ALM-PN growth (Fig. 1B), suggesting that the cytoplasmic presence of MBL-1 is likely required for its activity in promoting neurite growth. Both unk249 and unk344 alleles (which produces MBL-1 proteins with one or no KR motif) failed to suppress ALM-PN growth, suggesting that the KR motifs and nuclear localization may not be required for MBL-1's function in inducing neurite growth in the mec-7(u278) background.
To confirm the subcellular localization of the MBL-1 proteins produced by the above three alleles, we cloned the mbl-1 gene from the mutants, fused them with GFP-coding sequences, and expressed the fusion proteins under the TRN-specific mec-17 promoter. These reporters were introduced into the wild-type, mec-7(u278), and mec-7(u278) mbl-1(-) animals. As expected, the proteins with two KR motifs were restricted to the nucleus, whereas the proteins with one KR motif showed diffusive expression throughout the TRN cell body (Fig. 1C). To our surprise, MBL-1 proteins with no KR motifs still showed a diffusive localization pattern in the cells and was not excluded from the nucleus. This result hinted that MBL-1 may be able to enter the nucleus in a mechanism that is independent of the two KR motifs. The shorter isoforms (which skipped exon 7 and 8) likely have both cytoplasmic and nuclear localizations.
To confirm that the nucleus-localized MBL-1 produced by the unk276 allele is capable of splicing target genes, we analyzed four known MBL-1-regulated splicing events (Lee et al., 2024). The unk276 animals could promote the normal splicing of pqn-52c, pqn-72b, lgc-22a, and kin-4h isoforms, suggesting that the long MBL-1 isoform is functional in controlling mRNA splicing. The mbl-1(tm1563) deletion mutants served as a negative control (Fig. 1D). The MBL-1 proteins with one or no KR motifs produced by unk249 and unk344 alleles, respectively, could not promote the normal splicing of pqn-52c and pqn-72b but was able to promote the splicing of lgc-22a and kin-4h to the same extent as MBL-1 produced by unk276. Thus, the short MBL-1 isoform may still possess some ability to regular nuclear splicing, which is consistent with their nuclear localization.
MBL-1 is known to interact and stabilize the mRNAs of microtubule-related genes (such as mec-17/tubulin acetyltransferase, mec-7/β-tubulin, and mec-12/α-tubulin) (Puri et al., 2023), and we suspect that this mRNA-stabilizing role in the cytoplasm is essential for MBL-1's function in promoting microtubule stability and neurite growth. However, since we were not able to generate a version of MBL-1 that is exclusively cytoplasmic, it remains unclear whether its nuclear localization is also required for its function in neurite extension. Our previous work found that MBL-1 promotes the splicing of mec-3, which activates the expression of mec-17, mec-7, and mec-12. It is possible that MBL-1's canonical function as a splicing regulator in the nucleus also contribute to microtubule stabilization and neuronal morphogenesis.
","references":[{"reference":"Dokshin GA, Ghanta KS, Piscopo KM, Mello CC. 2018. Robust Genome Editing with Short Single-Stranded and Long, Partially Single-Stranded DNA Donors in\n Caenorhabditis elegans. Genetics 210: 781-787.
","pubmedId":"","doi":"10.1534/genetics.118.301532 "},{"reference":"Fernandez-Costa JM, Llamusi MB, Garcia-Lopez A, Artero R. 2011. Alternative splicing regulation by Muscleblind proteins: from development to disease. Biological Reviews 86: 947-958.
","pubmedId":"","doi":"10.1111/j.1469-185X.2011.00180.x"},{"reference":"Kino Y, Washizu C, Kurosawa M, Oma Y, Hattori N, Ishiura S, Nukina N. 2014. Nuclear localization of MBNL1: splicing-mediated autoregulation and repression of repeat-derived aberrant proteins. Human Molecular Genetics 24: 740-756.
","pubmedId":"","doi":"10.1093/hmg/ddu492"},{"reference":"Lee HMT, Lim HY, He H, Lau CY, Zheng C. 2024. MBL-1/Muscleblind regulates neuronal differentiation and controls the splicing of a terminal selector in Caenorhabditis elegans. PLOS Genetics 20: e1011276.
","pubmedId":"","doi":"10.1371/journal.pgen.1011276"},{"reference":"Puri D, Sharma S, Samaddar S, Ravivarma S, Banerjee S, Ghosh-Roy A. 2023. Muscleblind-1 interacts with tubulin mRNAs to regulate the microtubule cytoskeleton in C. elegans mechanosensory neurons. PLOS Genetics 19: e1010885.
","pubmedId":"","doi":"10.1371/journal.pgen.1010885"},{"reference":"Spilker KA, Wang GJ, Tugizova MS, Shen K. 2012. Caenorhabditis elegans Muscleblind homolog mbl-1 functions in neurons to regulate synapse formation. Neural Development 7: 10.1186/1749-8104-7-7.
","pubmedId":"","doi":"10.1186/1749-8104-7-7"},{"reference":"Verbeeren J, Teixeira J, Garcia SMDA. 2023. The Muscleblind-like protein MBL-1 regulates microRNA expression in Caenorhabditis elegans through an evolutionarily conserved autoregulatory mechanism. PLOS Genetics 19: e1011109.
","pubmedId":"","doi":"10.1371/journal.pgen.1011109"},{"reference":"Xie J, Zou W, Tugizova M, Shen K, Wang X. 2023. MBL-1 and EEL-1 affect the splicing and protein levels of MEC-3 to control dendrite complexity. PLOS Genetics 19: e1010941.
","pubmedId":"","doi":"10.1371/journal.pgen.1010941"},{"reference":"Zheng C, Diaz-Cuadros M, Nguyen KCQ, Hall DH, Chalfie M. 2017. Distinct effects of tubulin isotype mutations on neurite growth in\n Caenorhabditis elegans. Molecular Biology of the Cell 28: 2786-2801.
","pubmedId":"","doi":"10.1091/mbc.E17-06-0424"}],"title":"Cytosolic localization of MBL-1/Muscleblind may be required for ectopic neurite outgrowth in a sensitized background in C. elegans
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null}]}]}},"species":{"species":[{"value":"acer saccharum","label":"Acer saccharum","imageSrc":"","imageAlt":"","mod":"TreeGenes","modLink":"https://treegenesdb.org","linkVariable":""},{"value":"achillea millefolium","label":"Achillea millefolium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"acinetobacter baylyi","label":"Acinetobacter baylyi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"actinobacteria bacterium","label":"Actinobacteria bacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adelges tsugae","label":"Adelges tsugae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adenocaulon chilense","label":"Adenocaulon chilense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aedes japonicus","label":"Aedes japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aegorhinus vitulus","label":"Aegorhinus vitulus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alaimidae","label":"Alaimidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"allobates femoralis","label":"Allobates femoralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alnus glutinosa","label":"Alnus glutinosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa aestivalis","label":"Alosa aestivalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa pseudoharengus","label":"Alosa pseudoharengus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alternaria alternata","label":"Alternaria alternata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"amynthas agrestis","label":"Amynthas Agrestis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma caninum","label":"Ancylostoma caninum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma ceylanicum","label":"Ancylostoma ceylanicum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anemone multifida","label":"Anemone multifida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anguilla rostrata","label":"Anguilla rostrata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anisakis simplex","label":"Anisakis simplex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anomala albopilosa","label":"Anomala albopilosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arabidopsis","label":"Arabidopsis","imageSrc":"arabidopsis.png","imageAlt":"Arabidopsis graphic by Zoe Zorn CC BY 4.0","mod":"TAIR","modLink":"https://arabidopsis.org","linkVariable":""},{"value":"architeuthis dux","label":"Architeuthis dux","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arion vulgaris","label":"Arion vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"armeria","label":"Armeria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"artemia","label":"Artemia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arthrobacter sp.","label":"Arthrobacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia","label":"Ascaridia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia galli","label":"Ascaridia galli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"asparagopsis taxiformis","label":"Asparagopsis taxiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"astatotilapia burtoni","label":"Astatotilapia burtoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"avena sativa","label":"Avena sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aves","label":"Aves","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus","label":"Bacillus (firmicutes)","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus cereus","label":"Bacillus cereus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus mycoides","label":"Bacillus mycoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus subtilis","label":"Bacillus subtilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus thuringiensis","label":"Bacillus thuringiensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus toyonensis","label":"Bacillus toyonensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus wiedmannii","label":"Bacillus wiedmannii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteria","label":"Bacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteriophage","label":"Bacteriophage","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bactrocera","label":"Bactrocera sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"batrachospermum gelatinosum","label":"Batrachospermum gelatinosum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula lenta","label":"Betula lenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula nigra","label":"Betula nigra","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus dahlbohmii","label":"Bombus dahlbohmii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus terrestris","label":"Bombus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombyx mori","label":"Bombyx mori","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bos taurus","label":"Bos Taurus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brachygobius doriae","label":"Brachygobius doriae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica oleracea","label":"Brassica oleracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica rapa","label":"Brassica rapa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brugia malayi","label":"Brugia malayi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"burkholderia thailandensis","label":"Burkholderia thailandensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"buttiauxella","label":"Buttiauxella","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis brenneri","label":"Caenorhabditis brenneri","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis briggsae","label":"Caenorhabditis briggsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"c. elegans","label":"Caenorhabditis elegans","imageSrc":"c-elegans.jpg","imageAlt":"C. elegans graphic by Zoe Zorn CC BY 4.0","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"caenorhabditis inopinata","label":"Caenorhabditis inopinata","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis japonica","label":"Caenorhabditis japonica","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis nigoni","label":"Caenorhabditis nigoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis remanei","label":"Caenorhabditis remanei","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis tropicalis","label":"Caenorhabditis tropicalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus","label":"Calidifontibacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus erzuremensis","label":"Calidifontibacillus erzuremensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calliphora sp","label":"Calliphora sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caltha sagittata","label":"Caltha sagittata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cambarus latimanus","label":"Cambarus latimanus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"candida albicans","label":"Candida albicans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"canis familiaris","label":"Canis familiaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cannabis sativa","label":"Cannabis sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caretta caretta","label":"Caretta caretta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cassiopea xamachana","label":"Cassiopea xamachana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caulobacter vibrioides","label":"Caulobacter vibrioides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cephalopods","label":"Cephalopoda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cerastium arvense","label":"Cerastium arvense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceriodaphnia","label":"Ceriodaphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceroglossus suturalis","label":"Ceroglossus suturalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chaetoceros","label":"Chaetoceros","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chamaecrista fasciculata","label":"Chamaecrista fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chilicola chalcidiformis","label":"Chilicola chalcidiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chitinimonas","label":"Chitinimonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chlamydomonas reinhardtii","label":"Chlamydomonas reinhardtii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chromobacterium","label":"Chromobacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysemys picta","label":"Chrysemys picta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysoperla rufilabris","label":"Chrysoperla rufilabris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"citrus","label":"Citrus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"clavibacter sp.","label":"Clavibacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"colinus virginianus","label":"Colinus virginianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crassostrea virginica","label":"Crassostrea virginica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crithidia fasciculata","label":"Crithidia fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cutibacterium acnes","label":"Cutibacterium acnes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cyanobacteria","label":"Cyanobacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia","label":"Daphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia pulex","label":"Daphnia pulex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera","label":"Diabrotica virgifera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera virgifera virus 1","label":"Diabrotica virgifera virgifera virus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"d. discoideum","label":"Dictyostelium discoideum","imageSrc":"dicty.png","imageAlt":"D. discoideum","mod":"dictyBase","modLink":"http://dictybase.org","linkVariable":""},{"value":"diptera","label":"Diptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dotocryptus bellicosus","label":"Dotocryptus bellicosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drechmeria coniospora","label":"Drechmeria coniospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drosophila","label":"Drosophila","imageSrc":"drosophila.png","imageAlt":"Drosophila graphic by Zoe Zorn CC BY 4.0","mod":"FlyBase","modLink":"https://flybase.org/doi/","linkVariable":"doi"},{"value":"dryopteris campyloptera","label":"Dryopteris campyloptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris expansa","label":"Dryopteris expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris intermedia","label":"Dryopteris intermedia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dugesia dorotocephala","label":"Dugesia dorotocephala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"elasmobranchii","label":"Elasmobranchii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"embryophyta","label":"Embryophyta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enoploteuthis chunii","label":"Enoploteuthis chunii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterobacter aerogenes","label":"Enterobacter aerogenes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterococcus raffinosus","label":"Enterococcus raffinosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"epichloë coenophiala","label":"Epichloë coenophiala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"equus caballus","label":"Equus caballus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erigeron sp","label":"Erigeron sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eristalis","label":"Eristalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eruca vesicaria","label":"Eruca vesicaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erwinia carotovora","label":"Erwinia carotovora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erythronium americanum","label":"Erythronium americanum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"escherichia coli","label":"Escherichia coli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eukaryota","label":"Eukaryotes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"felis catus","label":"Felis catus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella novicida","label":"Francisella novicida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella tularensis","label":"Francisella tularensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fraxinus americana","label":"Fraxinus americana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fucus distichus","label":"Fucus distichus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fungi","label":"Fungi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gasteropelecus sp.","label":"Gasteropelecus sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"geranium sp","label":"Geranium sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"girardia","label":"Girardia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glaucomys volans","label":"Glaucomys volans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glycine max","label":"Glycine max","imageSrc":"","imageAlt":"","mod":"Soybase","modLink":"https://soybase.org","linkVariable":""},{"value":"glyptemys insculpta","label":"Glyptemys insculpta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gossypium hirsutum","label":"Gossypium hirsutum","imageSrc":"","imageAlt":"","mod":"CottonGen","modLink":"https://www.cottongen.org/","linkVariable":""},{"value":"gromphadorhina portentosa","label":"Gromphadorhina portentosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gryllodes sigillatus","label":"Gryllodes sigillatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"haliotis rufescens","label":"Haliotis rufescens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hepacivirus hominis","label":"Hepatitis C Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"herpes simplex virus type 1","label":"Herpes simplex virus type 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human","label":"Human","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human coronavirus oc43","label":"Human coronavirus OC43","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydra vulgaris","label":"Hydra vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydropsyche sp","label":"Hydropsyche sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hymenoptera","label":"Hymenoptera","imageSrc":"","imageAlt":"","mod":"Hymenoptera Genome Database","modLink":"https://hymenoptera.elsiklab.missouri.edu/","linkVariable":""},{"value":"hypochaeris radicata","label":"Hypochaeris radicata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hypodynerus vespiformis","label":"Hypodynerus vespiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflaviridae","label":"Iflaviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflavuris","label":"Iflavirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ipomoea hederacea","label":"Ipomoea hederacea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera","label":"Ischnomera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera ruficollis","label":"Ischnomera ruficollis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"julidochromis marlieri","label":"Julidochromis marlieri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"juniperus virginiana","label":"Juniperus virginiana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"kluyveromyces marxianus","label":"Kluyveromyces marxianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"l. casei","label":"L. casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lacticaseibacillus casei","label":"Lacticaseibacillus casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"larentiinae sp","label":"Larentiinae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"laurus nobilis","label":"Laurus nobilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lepidoptera","label":"Lepidoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"leucanthemum vulgare","label":"Leucanthemum vulgare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"linepithema humile","label":"Linepithema humile","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"liometopum occidentale","label":"Liometopum occidentale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lolium arundinaceum","label":"Lolium arundinaceum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbriculus variegatus","label":"Lumbriculus variegatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbricus terrestris","label":"Lumbricus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lupinus polyphyllus","label":"Lupinus polyphyllus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lycorma delicatula","label":"Lycorma delicatula","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lynx rufus","label":"Lynx rufus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"magnaporthe oryzae","label":"Magnaporthe oryzae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mammalia","label":"Mammalia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"manihot esculenta","label":"Manihot esculenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"medicago lupulina","label":"Medicago lupulina","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"meloidogyne","label":"Meloidogyne","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mimus polyglottos","label":"Mimus polyglottos","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bryophyta","label":"Mosses","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mouse","label":"Mouse","imageSrc":"","imageAlt":"","mod":"MGI","modLink":"https://informatics.jax.org","linkVariable":""},{"value":"m. minutoides","label":"Mus minutoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mycobacterium smegmatis","label":"Mycobacterium smegmatis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nakaseomyces glabratus","label":"Nakaseomyces glabratus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nauphoeta cinerea","label":"Nauphoeta cinerea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"neurospora","label":"Neurospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"n. benthamiana","label":"Nicotiana benthamiana","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/Nicotiana_benthamiana/genome","linkVariable":""},{"value":"nicotiana tabacum","label":"Nicotiana tabacum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae","label":"Noctuidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae sp","label":"Noctuidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nothobranchius furzeri","label":"Nothobranchius furzeri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"onchocerca volvulus","label":"Onchocerca volvulus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"orconectes virilis","label":"Orconectes virilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ormia ochracea","label":"Ormia ochracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"o. sativa","label":"Oryza sativa","imageSrc":"","imageAlt":"","mod":"Gramene","modLink":"https://www.gramene.org/","linkVariable":""},{"value":"other","label":"Other","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"oxalis enneaphylla","label":"Oxalis enneaphylla","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea","label":"Pantoea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea agglomerans","label":"Pantoea agglomerans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"papaver sp","label":"Papaver sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paramecium bursaria","label":"Paramecium bursaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"partitiviridae","label":"Partitiviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pelodiscus sinensis","label":"Pelodiscus sinensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"perezia recurvata","label":"Perezia recurvata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"petromyzon marinus","label":"Petromyzon marinus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis","label":"Photinus pyralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis associated partiti-like virus","label":"Photinus pyralis associated partiti-like virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis iflavirus 1","label":"Photinus pyralis iflavirus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"physcomitrium patens","label":"Physcomitrium patens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus strobus","label":"Pinus strobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus taeda","label":"Pinus taeda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"platycheirus","label":"Platycheirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"plectus sambesii","label":"Plectus sambesii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pogonomyrmex occidentalis","label":"Pogonomyrmex occidentalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"poncirus trifoliata","label":"Poncirus trifoliata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"populus deltoides","label":"Populus deltoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"potato virus y","label":"Potato virus Y","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"primula magellanica","label":"Primula magellanica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pristionchus pacificus","label":"Pristionchus pacificus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"prunus persica","label":"Prunus persica","imageSrc":"","imageAlt":"","mod":"Genome Database for Rosaceae","modLink":"https://www.rosaceae.org/","linkVariable":""},{"value":"psalmopoeus iriminia","label":"Psalmopoeus iriminia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudanabaena sp.","label":"Pseudanabaena sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas","label":"Pseudomonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas aeruginosa","label":"Pseudomonas aeruginosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas glycinae","label":"Pseudomonas glycinae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas putida","label":"Pseudomonas putida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas syringae","label":"Pseudomonas syringae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pterophyllum scalare","label":"Pterophyllum scalare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"python regius","label":"Python regius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"quercus macrocarpa","label":"Quercus macrocarpa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ralstonia solanacearum","label":"Ralstonia solanacearum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranitomeya imitator","label":"Ranitomeya imitator","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranunculus peduncularis","label":"Ranunculus peduncularis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"rat","label":"Rat","imageSrc":"","imageAlt":"","mod":"RGD","modLink":"https://rgd.mcw.edu","linkVariable":""},{"value":"rheinheimera","label":"Rheinheimera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ribes rubrum","label":"Ribes rubrum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"sars-cov-2","label":"SARS-CoV-2","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. cerevisiae","label":"Saccharomyces cerevisiae","imageSrc":"yeast.png","imageAlt":"Yeast graphic by Zoe Zorn CC BY 4.0","mod":"SGD","modLink":"https://yeastgenome.org","linkVariable":""},{"value":"saccharomyces paradoxus","label":"Saccharomyces paradoxus ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. uvarum","label":"Saccharomyces uvarum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schistosoma","label":"Schistosoma","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schizosaccharomyces japonicus","label":"Schizosaccharomyces japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. pombe","label":"Schizosaccharomyces pombe","imageSrc":"pombe.png","imageAlt":"Pombe graphic by Zoe Zorn © Caltech","mod":"PomBase","modLink":"https://www.pombase.org/reference/PMID:","linkVariable":"pmId"},{"value":"schmidtea mediterranea","label":"Schmidtea mediterranea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"senecio sp","label":"Senecio sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"simocephalus","label":"Simocephalus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"siraitia grosvenorii","label":"Siraitia grosvenorii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"solanum lycopersicum","label":"Solanum lycopersicum","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/1/view/","linkVariable":""},{"value":"sorghum","label":"Sorghum","imageSrc":"","imageAlt":"","mod":"SorghumBase","modLink":"https://www.sorghumbase.org","linkVariable":""},{"value":"spiroplasma eriocheiris","label":"Spiroplasma eriocheiris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus aureus","label":"Staphylococcus aureus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus epidermidis","label":"Staphylococcus epidermidis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"steinernema carpocapsae","label":"Steinernema carpocapsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"steinernema hermaphroditum","label":"Steinernema hermaphroditum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stenotrophomonas geniculata","label":"Stenotrophomonas geniculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus gordonii ","label":"Streptococcus gordonii ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus mutans","label":"Streptococcus mutans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":" streptococcus pneumoniae","label":"Streptococcus pneumoniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. purpuratus","label":"Strongylocentrotus purpuratus","imageSrc":"","imageAlt":"","mod":"Echinobase","modLink":"https://www.echinobase.org","linkVariable":""},{"value":"strongyloides ratti","label":"Strongyloides ratti","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"sulfolobus","label":"Sulfolobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"symphoricarpos albus","label":"Symphoricarpos albus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syncirsodes","label":"Syncirsodes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"synechococcus elongatus","label":"Synechococcus elongatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syrphidae","label":"Syrphidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tarantobelus jeffdanielsi","label":"Tarantobelus jeffdanielsi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"taraxacum officinale","label":"Taraxacum officinale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tatochila theodice","label":"Tatochila theodice","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetrahymena","label":"Tetrahymena","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetramorium immigrans","label":"Tetramorium immigrans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tomato brown rugose fruit virus","label":"ToBRFV","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trachemys scripta","label":"Trachemys scripta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tribolium castaneum","label":"Tribolium castaneum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichoptera","label":"Trichoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichuris muris","label":"Trichuris muris","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"trifolium repens","label":"Trifolium repens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trypoxylus dichotomus","label":"Trypoxylus dichotomus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tsuga canadensis","label":"Tsuga canadensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ulva expansa","label":"Ulva expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"universal","label":"Universal","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"vargula hilgendorfii","label":"Vargula hilgendorfii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"vespula vulgaris","label":"Vespula vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"virus","label":"Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"watasenia scintillans","label":"Watasenia scintillans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"wolbachia pipientis","label":"Wolbachia pipientis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"xenopus","label":"Xenopus","imageSrc":"xenopus.png","imageAlt":"Xenopus graphic by Zoe Zorn CC BY 4.0","mod":"XenBase","modLink":"https://xenbase.org","linkVariable":""},{"value":"xenorhabdus griffiniae","label":"Xenorhabdus griffiniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"yramea cytheris","label":"Yramea cytheris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zaprionus indianus","label":"Zaprionus indianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zea mays","label":"Zea mays","imageSrc":"","imageAlt":"","mod":"MaizeGDB","modLink":"https://www.maizegdb.org","linkVariable":""},{"value":"zebrafish","label":"Zebrafish","imageSrc":"zebrafish.png","imageAlt":"Zebrafish graphic by Zoe Zorn CC BY 4.0","mod":"ZFIN","modLink":"https://zfin.org","linkVariable":""}]}},"pageContext":{"id":"c905fad8-8b08-49a5-97a2-b2f63e1f3f81","citedBy":[],"parsedCsv":{"csvHeader":[],"csvData":[]}}}, "staticQueryHashes": ["2114697108"]}