Healthcare, and the world at large, is currently facing an antibiotic crisis caused by the increase in antibiotic resistant bacterial pathogens, combined with divestment in the drug discovery pipeline for new antibiotics. The Tiny Earth Project is a global, student-driven, effort aimed at discovering and isolating new sources of antibiotics from soil microbes that can be used to combat multi-drug resistant bacterial pathogens. This study characterizes the antimicrobial and biochemical properties of three unique bacterial soil isolates from the genera Janthinobacterium, Pseudomonas, and Pseudoclavibacter and their extracted secondary metabolites.
","acknowledgements":"These authors would like to acknowledge and thank Randolph-Macon College for supporting the Tiny Earth course-based undergraduate research experience (CURE) at the institution and the Tiny Earth Project for providing protocols and technical guidance. Authors declare no conflicts of interest.
","authors":[{"affiliations":["Randolph–Macon College, Ashland, Virginia, United States"],"departments":["Department of Biology"],"credit":["investigation","methodology","dataCuration","conceptualization","formalAnalysis","writing_originalDraft","writing_reviewEditing"],"email":"kelenasnipes@go.rmc.edu","firstName":"Kelena","lastName":"Snipes","submittingAuthor":true,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Randolph–Macon College, Ashland, Virginia, United States"],"departments":["Department of Biology"],"credit":["investigation","writing_reviewEditing"],"email":"loganangelillo@go.rmc.edu","firstName":"Logan","lastName":" Angelillo","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0004-6590-6433"},{"affiliations":["Randolph–Macon College, Ashland, Virginia, United States"],"departments":["Department of Biology"],"credit":["investigation","writing_reviewEditing"],"email":"juliac_f@icloud.com","firstName":"Julia","lastName":"Fugate","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0007-4242-9429"},{"affiliations":["Randolph–Macon College, Ashland, Virginia, United States"],"departments":["Department of Biology"],"credit":["investigation","writing_reviewEditing"],"email":"hannahmaywinton@go.rmc.edu","firstName":"Hannah-May ","lastName":"Winton","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0004-7822-9494"},{"affiliations":["Randolph–Macon College, Ashland, Virginia, United States"],"departments":["Department of Biology"],"credit":["investigation","conceptualization","formalAnalysis","dataCuration","methodology","validation","project","supervision","resources","writing_reviewEditing"],"email":"EliasTaylor-Cornejo@rmc.edu","firstName":"Elias","lastName":"Taylor-Cornejo","submittingAuthor":false,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0002-5040-8050"}],"awards":[],"conflictsOfInterest":null,"dataTable":null,"extendedData":[],"funding":"No award.
","image":{"url":"https://portal.micropublication.org/uploads/b68ffe18ea60b68c6c854044b1835ae6.jpg"},"imageCaption":"(A) Soil isolate ID TEPI010-014. TEPI010 is a known antibiotic-producing soil bacterium Lysobacter antibioticus that is used as a positive control for all experiments. (B) Soil isolate genus identified by 16S ribosome subunit gene sequencing. (C) Antibiotic screen for each soil isolate patched on top of the Gram-positive tester strain Bacillus subtilis. (D) Antibiotic screen for each soil isolate patched on top of the Gram-negative tester strain Escherichia coli. (E) Disc diffusion assay testing the antimicrobial susceptibility of Gram-positive tester strain Bacillus subtilis to antibiotic extracts from each soil isolate using a disc diffusion assay. (F) Mean ZOI in millimeters (mm) for the Gram-positive disc diffusion assay. Mean ZOI is the average of two diameter measurements across the ZOI shown. The mean ZOI was not determined (n.d.) for weak growth inhibition because the ZOI could not measured with reliability. Measured mean ZOI for negative control (methanol only) was 8 mm. (G) Disc diffusion assay testing the antimicrobial susceptibility of Gram-negative tester strain Escherichia coli to antibiotic extracts from each soil isolate using a disc diffusion assay. (H) Mean ZOI in millimeters (mm) for the Gram-negative antimicrobial susceptibility test. Mean ZOI is the average of two diameter measurements across the ZOI shown. Measured mean ZOI for negative control (methanol only) was 11.5 mm. (I) Gram stain of each soil isolate. All brightfield images were taken at 100X magnification. (J) Catalase activity indicated by the presence/absence of bubbles from each isolate spread on a glass slide and treated with hydrogen peroxide. (K) Hemolysis on blood agar indicating alpha, beta or gamma hemolysis activity. (L) Gram-negative selection on MacConkey agar indicated by patch growth, lactose fermentation indicated by either pink patches (lactose-positive) or pale patches surrounded by yellow color (lactose-negative).
","imageTitle":"Antibiotic activity and biochemical characterization of bacterial soil isolates.
","methods":"Soil Sample Collection
Each soil sample was collected from locations on the Randolph-Macon College campus in Ashland, VA, near the root systems of various plants, at a soil depth of approximately 6 inches. The GPS location for each soil sample is as follows, TEPI011 37º 45' 43.2\" N, 77º 28' 33.96 \" W; TEPI012 37º 45' 44.64\" N, 77º 28' 32.27\" W; TEPI014 37º 45' 44\" N, 77º 28' 33\" W. Two tablespoons of each soil sample were collected in a sealable plastic bag and plated immediately.
Cultivation of Soil Bacteria
Each soil sample was diluted 1/10 by mixing 1 gram of soil with 9 mL of sterile water, then vortexed to mix. Four 10-fold serial dilutions were made in sterile water and 100 µL of each dilution (10-1, 10-2, 10-3, 10-4, 10-5) was plated onto either 10% Tryptic Soy Agar (TSA) or MacConkey agar. Plates were incubated at 22 °C for one week to produce single colonies of soil bacteria. A soil isolate library for each soil sample was created by picking sixteen individual colonies from serial dilution plates with a sterile toothpick and patching them onto a new 10% TSA plate in a 4 x 4 grid pattern. Soil isolate library plates were incubated at 22 °C for five days then stored at 4 °C.
Antibiotic Screen
The soil isolate library was screened for antibiotic-producing soil bacteria using the spread and patch technique (Handelsman et al., 2023). Two different tester strains, a Gram-negative tester strain (Escherichia coli, Carolina Biological, #155065) or Gram-positive tester strain (Bacillus subtilis, Carolina Biological, # 154921) were first spread onto individual 10% TSA plates using a sterile swab. The soil isolate library for each sample was then patched in the same 4 x 4 grid pattern on top of the tester strain using a sterile toothpick. Plates were incubated at 22 °C for one week. Antibiotic-producing isolates were visually determined by selecting isolate patches with a clear of a ZOI where the growth of the tester strain had been inhibited. Three soil isolates (TEPI011, TEPI012, and TEP014) were selected for further study. The antibiotic screen was repeated by plating isolates individually in the center of a 60 mm 10% TSA plate spread with each tester strain (E.coli and B. subtilis) and incubating plates at 22 °C for one week to verify that each isolate could produce a ZOI when patched on top of each tester strain.
Ethyl Acetate Chemical Extraction of Secondary Metabolites
Each soil isolate was spread evenly across the entire surface of a 100 mm 10% TSA plate using a sterile swab and incubated at 22 °C for one week. Agar from each plate was then cut into approximately 1 cm2 pieces using a sterile microspatula and collected in 250 mL glass Erlenmeyer flasks. To freeze-thaw cells, flasks were incubated at –80 °C for one week, then 15 mL of ethyl acetate and 10 mL of sterile water were added to frozen agar in the flask. Flasks were then covered with parafilm and aluminum foil and shaken at 200 rpm at 22 °C for one week. All the liquid from the flask was then transferred to a new 100 mL Erlenmeyer flask and left to sit for 3 minutes to allow for the liquid to separate into two layers: an aqueous bottom layer and an organic top layer composed of ethyl acetate and extracted secondary metabolites. If two layers were not visible, 1000 µL of sterile water were added to the liquid to distinguish the organic layer. The organic layer was carefully transferred to a scintillation vial and left uncapped for one week in a chemical fume hood to evaporate the ethyl acetate and leave only the extracted secondary metabolites in the vial. Each of the extracted secondary metabolites were reconstituted with 160 µL of methanol solvent.
Disc Diffusion Assay
To perform a disc diffusion assay with the extracted secondary metabolites, 30 µL of each reconstituted secondary metabolite mixtures were pipetted onto sterile, ¼ inch diameter, blank paper discs (Carolina Biological Supply, 806491). The negative control was a solvent only disc with 30 µL of methanol. Discs were allowed to dry for 10-15 minutes in a sterile biosafety cabinet. Tester strains (E.coli or B. subtilis) were spread on 60 mm 10% TSA agar plate using a sterile swab. Each treated disc was then placed in the center of the plate on top of the tester strain. Plates were incubated at 22 °C for one week and observed for development of a ZOI around the secondary metabolite treated discs. Two measurements of the ZOI diameter were taken though the center of the paper disc to calculate the mean ZOI.
Gram Staining
A dry mount slide of each soil isolate was prepared by spreading a single colony of bacteria in 5 µL drop of sterile water across a glass microscope slide. Slides were air-dried for 5 minutes then heat fixed. Gram stain (Carolina Biological Supply, 821050) was performed as follows: crystal violet (1 minute), iodine (1 minute), 95% ethanol (10 seconds), safranin (45 seconds). Stained sample was mounted with a coverslip and imaged at 100X magnification using a Nikon Eclipse E600 microscope equipped with a Leica MC 190 HD camera. Images were acquired with LASX 3.7.6 software.
Biochemical tests (Catalase, Hemolysin, Lactose fermentation)
Catalase test was performed on each isolate by spreading a colony on a glass microscope slide with a sterile pipette tip, then dropping 5 µL of hydrogen peroxide on top of the colony, then immediately observing for the formation of bubbles. Hemolysin assay was performed by patching each isolate with a sterile toothpick in the center of a 100 mm blood agar plate (VWR, 89405-024) and incubating plate at 22 °C for one week. Lactose fermentation was determined by patching each isolate on a MacConkey agar plate (VWR, 89407-270) and incubating plate at 22 °C for one week.
16S Ribosomal Gene Sequencing
To identify the genus of each isolate, a 500 base pair region of the 16S bacterial ribosomal subunit gene was amplified using polymerase chain reaction (PCR) with the following primers: GTATTACCGCGGCTGCTG (519R) and AGAGTTTGATCCTGGCTCAG (27F) (Handelsman et al., 2023). The PCR reaction was performed with Apex High Fidelity DNA Polymerase (Genesee Scientific, 42-500) using the following thermocycler program: 95 °C for 2 minutes (1 cycle), 95 °C for 15 seconds (30 cycles), 55 °C for 15 seconds (30 cycles), 72 °C for 15 seconds (30 cycles), 12 °C hold (1 cycle). PCR reactions were validated on a 1% agarose TAE gel run for 20 minutes at 110V to confirm the presence of a 500 base pair DNA fragment. The PCR cleanup and Sanger sequencing of each PCR reaction was outsourced to the company Eurofins Genomics. The genus of each DNA sequences was determined using the open-source Basic Local Alignment Search Tool (BLAST) hosted by the National Center for Biotechnology Information (NCBI).
","reagents":"","patternDescription":"The rise of antimicrobial resistant (AMR) bacterial pathogens has placed a significant burden on the global healthcare system (Theuretzbacher et al., 2025). The growing number of multidrug resistant bacterial pathogens is outpacing the development of new antibiotics to treat infections by these pathogens (Martens & Demain, 2017; Ventola, 2015). Antibiotic discovery through the Tiny Earth Project represents a student-driven effort to combat this antibiotic crisis (Hurley et al., 2021). In this study, soil bacteria were isolated through the Tiny Earth Project at Randolph-Macon College in Ashland, VA by undergraduate microbiology students, who performed the initial sampling and culturing of bacterial soil isolates, as well as the preliminary antimicrobial screening and biochemical characterization of a soil isolate library. Three soil isolates (TEPI011, TEPI012, and TEPI014) were selected for further validation and chemical extraction of antibiotics (Figure 1A). For all tests performed, the bacterial soil isolates were compared to a positive control strain, Lysobacter antibioticus (L. antibioticus, TEPI010), a known antibiotic-producing bacterium (Kudryakova et al., 2023). The genus of each soil isolate was determined using Sanger sequencing of a 500 base pair region of the 16S bacterial ribosomal subunit gene; we determined that each isolate was from a distinct bacterial genus: Janthinobacterium (TEPI011: accession LC189077.1, 97.36% identity, 98% query coverage, 0.0 E value), Pseudomonas (TEPI012: accession MT967917.1, 97% identity, 55% query coverage, 0.0 E value) and Pseudoclavibacter (TEPI014: accession PP261636.1, 98.74% identity, 99% query coverage, 0.0 E value) (Figure 1B). The antimicrobial activity of each soil isolate towards a Gram-negative tester strain, Escherichia coli (E. coli), or a Gram-positive tester strain, Bacillus subtilis (B. subtilis), was validated by first spreading the tester strain on the surface of a 10% TSA agar plate, then patching each soil isolate on top of the tester strain (Figure 1C and 1D). The positive control, L. antibioticus, exhibited strong antimicrobial activity against Gram-positive bacteria and, to a lesser extent, Gram-negative bacteria, as previously described (Figure 1C and 1D) (Kudryakova et al., 2023). Likewise, all of the soil isolates showed clear antimicrobial activity against B. subtilis and, to a lesser extent, antimicrobial activity against E.coil (Figure 1C and 1D). Ethyl acetate chemical extractions of the organic secondary metabolites were performed for each isolate. The antimicrobial susceptibility of B. subtilis and E.coli to each extract was tested using a disc diffusion assay, which measures the mean zone of inhibition (ZOI) created around a paper disc containing each chemical extract (Figure 1E-1H). All extracts showed antimicrobial activity against E.coli that was substantially greater than the negative control (ZOI = 11.5 mm); TEPI010 (ZOI = 28 mm), TEPI011 (ZOI = 21.5 mm), TEPI012 (ZOI = 20.5 mm), and TEPI014 (ZOI= 19 mm) (Figure 1G and 1H). When the extracts were tested against the Gram-positive tester strain B. subtilis, TEPI011 (ZOI = 12.5 mm) showed the strongest antimicrobial activity, which was similar to that of the positive control extract from L. antibioticus (ZOI = 12 mm) and was substantially greater than the negative control (ZOI = 8 mm) (Figure 1E and 1F). Extracts from the other soil isolates (TEPI012 and TEPI014) also created a visible ZOI against B. subtilis, but the exact boundary of the zones were too faint to measure reliably (Figure 1E and 1F).
Biochemical characterization for each soil isolate was performed using both selective and differential media, Gram staining, and catalase testing. TEPI011 and TEPI012 stained Gram-negative and grew on MacConkey agar, which selects for Gram-negative bacteria; on the other hand, TEPI014 stained Gram-positive and failed to grow on MacConkey agar (Figure 1I and 1L). MacConkey agar also differentiates the ability to ferment lactose; TEPI011 and TEPI012 were shown to not be able to ferment lactose, as indicated by the yellow discoloration observed around the TEOI011 and TEPI012 isolates growing on MacConkey agar (Figure 1L). We tested for the presence of a catalase enzyme in each soil isolate, which is characterized by the ability to convert hydrogen peroxide to oxygen bubbles, and all of the soil isolates tested positive for the catalase enzyme (Figure 1J). We measured the degree of hemolytic activity by growing each isolate on blood agar (Figure 1K). We determined TEPI011 and TEPI014 to have alpha hemolytic activity characterized by a greenish discoloration, and TEPI012 to have beta hemolytic activity characterized by a clear zone around the patched isolate (Figure 1K).
Taken together, these results suggest that TEP011 is a Gram-negative, lactose-negative, catalase-positive, soil bacterium from the genus Janthinobacterium with alpha hemolytic activity. TEPI012 is a Gram-negative, lactose-negative, catalase-positive, soil bacteria from the genus Pseudomonas with beta hemolytic activity. TEP014 is a Gram-positive, catalase-positive, soil bacterium from the genus Pseudoclavibacter with alpha hemolytic activity. All three isolates exhibit antimicrobial activity against both Gram-positive and Gram-negative bacteria.
The secondary metabolites produced by soil bacteria have long been considered a treasure trove for antibiotic discovery (Clardy et al., 2009). Our findings that TEPI011 (Janthinobacterium) and TEPI012 (Pseudomonas) possess antimicrobial activity are consistent with previous studies identifying these soil bacteria to produce antibiotic compounds (Gionco et al., 2017; Inan Bektas et al., 2023; O’Sullivan et al., 1990). Janthinobacterium has a characteristic purple violet color due to the production of the secondary metabolite called violacein, which is also a potent antibiotic against both Gram-negative and Gram-positive bacteria (Choi et al., 2015; Inan Bektas et al., 2023). In addition, Janthinobacterium produces peptide lactone antibiotics called janthinocins, which have been shown to be effective bactericidal agents to treat pathogens such as methicillin-resistant Staphylococcus aureus (MRSA) (O’Sullivan et al., 1990). Likewise, Pseudomonas has been shown to produce several distinct antibiotic compounds including mupirocin, fluviols, and novel organometallic compounds (Gionco et al., 2017; Haas & Keel, 2003; Smirnov et al., 1997). To our knowledge, Pseudoclavibacter has not previously been characterized as an antibiotic producer. Our biochemical characterization of Pseudoclavibacter is consistent with previous findings that Pseudoclavibacter is a Gram-positive, catalase-positive organism; however, the antimicrobial activity of Pseudoclavibacter reported in this study could potentially reveal a novel antibiotic compound (Oyaert et al., 2013; Pailhoriès et al., 2014).
","references":[{"reference":"Choi SY, Yoon Kh, Lee JI, Mitchell RJ. 2015. Violacein: Properties and Production of a Versatile Bacterial Pigment. BioMed Research International 2015: 1-8.
","pubmedId":"","doi":"10.1155/2015/465056"},{"reference":"Clardy J, Fischbach MA, Currie CR. 2009. The natural history of antibiotics. Current Biology 19: R437-R441.
","pubmedId":"","doi":"10.1016/j.cub.2009.04.001"},{"reference":"Gionco Br, Tavares ER, de Oliveira AG, Yamada-Ogatta SF, do Carmo AO, Pereira UdPd, et al., Andrade. 2017. New Insights about Antibiotic Production by Pseudomonas aeruginosa: A Gene Expression Analysis. Frontiers in Chemistry. 5: 1-10
","pubmedId":"","doi":"10.3389/fchem.2017.00066"},{"reference":"Haas D, Keel C. 2003. Regulation of antibiotic production in root-colonizing Pseudomonas spp. And relevance for biological control of plant disease. Annual Review of Phytopathology 41: 117-153.
","pubmedId":"","doi":"10.1146/annurev.phyto.41.052002.095656"},{"reference":"Handelsman J, Hernandez S, Tsang T, & Bascom-Slack C. (2018). Tiny Earth—A Research guide to Studentsourcing Antibiotic Discovery (2023rd ed.). XanEdu Publishing Inc.
","pubmedId":"","doi":""},{"reference":"Hurley A, Chevrette MG, Acharya DD, Lozano GL, Garavito M, Heinritz J, et al., Handelsman. 2021. Tiny Earth: A Big Idea for STEM Education and Antibiotic Discovery. mBio 12: e03432-20
","pubmedId":"","doi":"10.1128/mBio.03432-20"},{"reference":"Inan Bektas K, Nalcaoglu A, Kati H, Ceylan E, Nalcacioglu R, Belduz AO, Canakci S. 2022. Janthinobacterium kumbetense sp. nov., a violacein-producing bacterium isolated from spring water in Turkey, and investigation of antimicrobial activity of violacein. FEMS Microbiology Letters 370: 1-8.
","pubmedId":"","doi":"10.1093/femsle/fnac119"},{"reference":"Kudryakova I, Afoshin A, Tarlachkov S, Leontyevskaya E, Suzina N, Leontyevskaya (Vasilyeva) NL. 2023. Lysobacter gummosus 10.1.1, a Producer of Antimicrobial Agents. Microorganisms 11: 2853.
","pubmedId":"","doi":"10.3390/microorganisms11122853"},{"reference":"Martens E, Demain AL. 2017. The antibiotic resistance crisis, with a focus on the United States. The Journal of Antibiotics 70: 520-526.
","pubmedId":"","doi":"10.1038/ja.2017.30"},{"reference":"O’Sullivan J, McCullough J, Johnson JH, Bonner DP, Clark JC, Dean L, Trejo WH. 1990. Janthinocins A, B and C, novel peptide lactone antibiotics produced by Janthinobacterium lividum. I. Taxonomy, fermentation, isolation, physico-chemical and biological characterization.. The Journal of Antibiotics 43: 913-919.
","pubmedId":"","doi":"10.7164/antibiotics.43.913"},{"reference":"Oyaert M, De Baere T, Breyne J, De Laere E, Mariën S, Waets P, Laffut W. 2013. First Case of Pseudoclavibacter bifida Bacteremia in an Immunocompromised Host with Chronic Obstructive Pulmonary Disease (COPD). Journal of Clinical Microbiology 51: 1973-1976.
","pubmedId":"","doi":"10.1128/JCM.00138-13"},{"reference":"Pailhoriès Hln, Lemarié C, Quinqueneau C, Eveillard M, Baufreton C, Rouleau Fdr, et al., Kempf. 2014. First Report of Endocarditis Caused by a Pseudoclavibacter Species. Journal of Clinical Microbiology 52: 3465-3467.
","pubmedId":"","doi":"10.1128/jcm.01388-14"},{"reference":"Smirnov VV, Kiprianova EA, Garagulya AD, Esipov SE, Dovjenko SA. 2006. Fluviols, bicyclic nitrogen-rich antibiotics produced by Pseudomonas fluorescens. FEMS Microbiology Letters 153: 357-361.
","pubmedId":"","doi":"10.1111/j.1574-6968.1997.tb12596.x"},{"reference":"Theuretzbacher U, Jumde RP, Hennessy A, Cohn J, Piddock LJV. 2025. Global health perspectives on antibacterial drug discovery and the preclinical pipeline. Nature Reviews Microbiology. 1-17
","pubmedId":"","doi":"10.1038/s41579-025-01167-w"},{"reference":"Ventola CL. 2015. The antibiotic resistance crisis: part 1: causes and threats. P T 40: 277-83.
","pubmedId":"25859123","doi":""}],"title":"Antimicrobial activity of Janthinobacterium, Pseudomonas, and Pseudoclavibacter bacterial soil isolates
","reviews":[{"reviewer":{"displayName":"Aeisha Thomas"},"openAcknowledgement":false,"status":{"submitted":true}}],"curatorReviews":[]},{"id":"17ccc4db-586f-4526-9783-288d07a364b7","decision":"revise","abstract":"Healthcare, and the world at large, are currently facing an antibiotic crisis caused by the increase in antibiotic resistant bacterial pathogens, combined with divestment in the drug discovery pipeline for new antibiotics. The Tiny Earth Project is a global, student-driven, effort aimed at discovering and isolating new sources of antibiotics from soil microbes that can be used to combat multi-drug resistant bacterial pathogens. This study characterizes the antimicrobial and biochemical properties of three unique bacterial soil isolates from the genera Janthinobacterium, Pseudomonas, and Pseudoclavibacter and their extracted secondary metabolites.
","acknowledgements":"These authors would like to acknowledge and thank Randolph-Macon College for supporting the Tiny Earth course-based undergraduate research experience (CURE) at the institution and the Tiny Earth Project for providing protocols and technical guidance. Authors declare no conflicts of interest.
","authors":[{"affiliations":["Randolph–Macon College, Ashland, Virginia, United States"],"departments":["Department of Biology"],"credit":["investigation","methodology","dataCuration","conceptualization","formalAnalysis","writing_originalDraft","writing_reviewEditing"],"email":"kelenasnipes@go.rmc.edu","firstName":"Kelena","lastName":"Snipes","submittingAuthor":true,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Randolph–Macon College, Ashland, Virginia, United States"],"departments":["Department of Biology"],"credit":["investigation","writing_reviewEditing"],"email":"loganangelillo@go.rmc.edu","firstName":"Logan","lastName":" Angelillo","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0004-6590-6433"},{"affiliations":["Randolph–Macon College, Ashland, Virginia, United States"],"departments":["Department of Biology"],"credit":["investigation","writing_reviewEditing"],"email":"juliac_f@icloud.com","firstName":"Julia","lastName":"Fugate","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0007-4242-9429"},{"affiliations":["Randolph–Macon College, Ashland, Virginia, United States"],"departments":["Department of Biology"],"credit":["investigation","writing_reviewEditing"],"email":"hannahmaywinton@go.rmc.edu","firstName":"Hannah-May ","lastName":"Winton","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0004-7822-9494"},{"affiliations":["Randolph–Macon College, Ashland, Virginia, United States"],"departments":["Department of Biology"],"credit":["investigation","conceptualization","formalAnalysis","dataCuration","methodology","validation","project","supervision","resources","writing_reviewEditing"],"email":"EliasTaylor-Cornejo@rmc.edu","firstName":"Elias","lastName":"Taylor-Cornejo","submittingAuthor":false,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0002-5040-8050"}],"awards":[],"conflictsOfInterest":null,"dataTable":null,"extendedData":[],"funding":"No award.
","image":{"url":"https://portal.micropublication.org/uploads/068094f5308debde0e83135b2c7dccbc.jpg"},"imageCaption":"(A) Soil isolate ID TEPI010-014. TEPI010 is a known antibiotic-producing soil bacterium Lysobacter antibioticus that is used as a positive control for all experiments. (B) Soil isolate genus identified by 16S ribosome subunit gene sequencing. (C) Antibiotic screen for each soil isolate patched on top of the Gram-positive tester strain Bacillus subtilis. (D) Antibiotic screen for each soil isolate patched on top of the Gram-negative tester strain Escherichia coli. (E) Disc diffusion assay testing the antimicrobial susceptibility of Gram-positive tester strain Bacillus subtilis to antibiotic extracts from each soil isolate using a disc diffusion assay. (F) Mean ZOI in millimeters (mm) for the Gram-positive disc diffusion assay. Mean ZOI is the average of two diameter measurements across the ZOI shown. The mean ZOI was not determined (n.d.) for weak growth inhibition because the ZOI could not be measured with reliability. (G) Disc diffusion assay testing the antimicrobial susceptibility of Gram-negative tester strain Escherichia coli to antibiotic extracts from each soil isolate using a disc diffusion assay. (H) Mean ZOI in millimeters (mm) for the Gram-negative antimicrobial susceptibility test. Mean ZOI is the average of two diameter measurements across the ZOI shown. (I) Gram stain of each soil isolate. All brightfield images were taken at 100X magnification. (J) Gram-negative selection on MacConkey agar indicated by patch growth, lactose fermentation indicated by either pink patches (lactose-fermenting positive) or pale patches surrounded by yellow color (lactose-fermenting negative). (K) Catalase activity indicated by the presence/absence of bubbles from each isolate spread on a glass slide and treated with hydrogen peroxide. (L) Hemolysis on blood agar indicating alpha, beta or gamma hemolysis activity.
","imageTitle":"Antibiotic activity and biochemical characterization of bacterial soil isolates.
","methods":"Soil Sample Collection
Each soil sample was collected from locations on the Randolph-Macon College campus in Ashland, VA, near the root systems of various plants, at a soil depth of approximately 6 inches. The GPS location for each soil sample is as follows, TEPI011 37º 45' 43.2\" N, 77º 28' 33.96 \" W; TEPI012 37º 45' 44.64\" N, 77º 28' 32.27\" W; TEPI014 37º 45' 44\" N, 77º 28' 33\" W. Two tablespoons of each soil sample were collected in a sealable plastic bag and plated immediately.
Cultivation of Soil Bacteria
Each soil sample was diluted 1/10 by mixing 1 gram of soil with 9 mL of sterile water, then vortexed to mix. Four 10-fold serial dilutions were made in sterile water and 100 µL of each dilution (10-1, 10-2, 10-3, 10-4, 10-5) was plated onto either 10% Tryptic Soy Agar (TSA) or MacConkey agar. Plates were incubated at 22 °C for one week to produce single colonies of soil bacteria. A soil isolate library for each soil sample was created by picking sixteen individual colonies from serial dilution plates with a sterile toothpick and patching them onto a new 10% TSA plate in a 4 x 4 grid pattern. Soil isolate library plates were incubated at 22 °C for five days then stored at 4 °C.
Antibiotic Screen
The soil isolate library was screened for antibiotic-producing soil bacteria using the spread and patch technique (Handelsman et al., 2018). Two different tester strains, a Gram-negative tester strain (Escherichia coli, Carolina Biological, #155065) or Gram-positive tester strain (Bacillus subtilis, Carolina Biological, # 154921) were first spread onto individual 10% TSA plates using a sterile swab. The soil isolate library for each sample was then patched in the same 4 x 4 grid pattern on top of the tester strain using a sterile toothpick. Plates were incubated at 22 °C for one week. Antibiotic-producing isolates were visually determined by selecting isolate patches with a clear ZOI where the growth of the tester strain had been inhibited. Three soil isolates (TEPI011, TEPI012, and TEP014) were selected for further study. The antibiotic screen was repeated by plating isolates individually in the center of a 60 mm 10% TSA plate spread with each tester strain (E.coli and B. subtilis) and incubating plates at 22 °C for one week to verify that each isolate could produce a ZOI when patched on top of each tester strain.
Ethyl Acetate Chemical Extraction of Secondary Metabolites
Each soil isolate was spread evenly across the entire surface of a 100 mm 10% TSA plate using a sterile swab and incubated at 22 °C for one week. Agar from each plate was then cut into approximately 1 cm2 pieces using a sterile microspatula and collected in 250 mL glass Erlenmeyer flasks. To freeze-thaw cells, flasks were incubated at –80 °C for one week, then 15 mL of ethyl acetate and 10 mL of sterile water were added to frozen agar in the flask. Flasks were then covered with parafilm and aluminum foil and shaken at 200 rpm at 22 °C for one week. All the liquid from the flask was then transferred to a new 100 mL Erlenmeyer flask and left to sit for 3 minutes to allow for the liquid to separate into two layers: an aqueous bottom layer and an organic top layer composed of ethyl acetate and extracted secondary metabolites. If two layers were not visible, 1000 µL of sterile water were added to the liquid to distinguish the organic layer. The organic layer was carefully transferred to a scintillation vial and left uncapped for one week in a chemical fume hood to evaporate the ethyl acetate and leave only the extracted secondary metabolites in the vial. Each of the extracted secondary metabolites were reconstituted with 160 µL of methanol solvent.
Disc Diffusion Assay
To perform a disc diffusion assay with the extracted secondary metabolites, 30 µL of each reconstituted secondary metabolite mixtures were pipetted onto sterile, ¼ inch diameter, blank paper discs (Carolina Biological Supply, 806491). Discs were allowed to dry for 10-15 minutes in a sterile biosafety cabinet. Tester strains (E.coli or B. subtilis) were spread on 60 mm 10% TSA agar plate using a sterile swab. Each treated disc was then placed in the center of the plate on top of the tester strain. Plates were incubated at 22 °C for one week and observed for development of a ZOI around the secondary metabolite treated discs. Two measurements of the ZOI diameter were taken though the center of the paper disc to calculate the mean ZOI.
Gram Staining
A dry mount slide of each soil isolate was prepared by spreading a single colony of bacteria in 5 µL drop of sterile water across a glass microscope slide. Slides were air-dried for 5 minutes then heat fixed. Gram stain (Carolina Biological Supply, 821050) was performed as follows: crystal violet (1 minute), iodine (1 minute), 95% ethanol (10 seconds), safranin (45 seconds). Stained sample was mounted with a coverslip and imaged at 100X magnification using a Nikon Eclipse E600 microscope equipped with a Leica MC 190 HD camera. Images were acquired with LASX 3.7.6 software.
Biochemical tests (Catalase, Hemolysin, Lactose fermentation)
Catalase test was performed on each isolate by spreading a colony on a glass microscope slide with a sterile pipette tip, then dropping 5 µL of hydrogen peroxide on top of the colony, then immediately observing for the formation of bubbles. Hemolysin assay was performed by patching each isolate with a sterile toothpick in the center of a 100 mm blood agar plate (VWR, 89405-024) and incubating the plate at 22 °C for one week. Lactose fermentation was determined by patching each isolate on a MacConkey agar plate (VWR, 89407-270) and incubating plate at 22 °C for one week.
16S Ribosomal Gene Sequencing
To identify the genus of each isolate, a 500 base pair region of the 16S bacterial ribosomal subunit gene was amplified using polymerase chain reaction (PCR) with the following primers: GTATTACCGCGGCTGCTG (519R) and AGAGTTTGATCCTGGCTCAG (27F) (Handelsman et al., 2018). The PCR reaction was performed with Apex High Fidelity DNA Polymerase (Genesee Scientific, 42-500) using the following thermocycler program: 95 °C for 2 minutes (1 cycle), 95 °C for 15 seconds (30 cycles), 55 °C for 15 seconds (30 cycles), 72 °C for 15 seconds (30 cycles), 12 °C hold (1 cycle). PCR reactions were validated on a 1% agarose TAE gel run for 20 minutes at 110V to confirm the presence of a 500 base pair DNA fragment. The PCR cleanup and Sanger sequencing of each PCR reaction was outsourced to the company Eurofins Genomics. The genus of each DNA sequences was determined using the open-source Basic Local Alignment Search Tool (BLAST) hosted by the National Center for Biotechnology Information (NCBI) (Altschul et al., 1990).
","reagents":"","patternDescription":"The rise of antimicrobial resistant (AMR) bacterial pathogens has placed a significant burden on the global healthcare system (Theuretzbacher et al., 2025). The growing number of multidrug resistant bacterial pathogens is outpacing the development of new antibiotics to treat infections by these pathogens (Martens & Demain, 2017; Ventola, 2015). Antibiotic discovery through the Tiny Earth Project represents a student-driven effort to combat this antibiotic crisis (Hurley et al., 2021). In this study, soil bacteria were isolated through the Tiny Earth Project at Randolph-Macon College in Ashland, VA by undergraduate microbiology students, who performed the initial sampling and culturing of bacterial soil isolates, as well as the preliminary antimicrobial screening and biochemical characterization of a soil isolate library.
Three soil isolates (TEPI011, TEPI012, and TEPI014) were selected for further validation and chemical extraction of antibiotics (Figure 1A). For all tests performed, the bacterial soil isolates were compared to a positive control strain, Lysobacter antibioticus (L. antibioticus, TEPI010), a known antibiotic-producing bacterium (Christensen & Cook, 1978). The genus of each soil isolate was determined using Sanger sequencing of a 500 base pair region of the 16S bacterial ribosomal subunit gene; we determined that each isolate was from a distinct bacterial genus: Janthinobacterium (TEPI011: accession LC189077.1, 97.36% identity, 98% query coverage, 0.0 E value), Pseudomonas (TEPI012: accession MT967917.1, 97% identity, 100% query coverage, 0.0 E value) and Pseudoclavibacter (TEPI014: accession PP261636.1, 98.74% identity, 99% query coverage, 0.0 E value) (Figure 1B). The antimicrobial activity of each soil isolate towards a Gram-negative tester strain, Escherichia coli (E. coli), or a Gram-positive tester strain, Bacillus subtilis (B. subtilis), was validated by first spreading the tester strain on the surface of a 10% TSA agar plate, then patching each soil isolate on top of the tester strain (Figure 1C and 1D). The positive control, L. antibioticus, exhibited strong antimicrobial activity against Gram-positive bacteria and, to a lesser extent, Gram-negative bacteria, as previously described (Figure 1C and 1D) (Christensen & Cook, 1978; Kudryakova et al., 2023). Likewise, all of the soil isolates showed clear antimicrobial activity against B. subtilis and, to a lesser extent, antimicrobial activity against E.coli (Figure 1C and 1D). Ethyl acetate chemical extractions of the organic secondary metabolites were performed for each isolate. The antimicrobial susceptibility of B. subtilis and E.coli to each extract was tested using a disc diffusion assay, which measures the mean zone of inhibition (ZOI) created around a paper disc containing each chemical extract (Figure 1E-1H). When the extracts were tested against the Gram-positive tester strain B. subtilis, TEPI011 (ZOI = 12.5 mm) showed the strongest antimicrobial activity, which was similar to that of the positive control extract from L. antibioticus (ZOI = 12 mm) (Figure 1E and 1F). Extracts from the other soil isolates (TEPI012 and TEPI014) also created a visible ZOI against B. subtilis, but the exact boundary of the zones were too faint to measure reliably (Figure 1E and 1F). All extracts showed antimicrobial activity against E.coli: TEPI010 (ZOI = 28 mm), TEPI011 (ZOI = 21.5 mm), TEPI012 (ZOI = 20.5 mm), and TEPI014 (ZOI= 19 mm) (Figure 1G and 1H).
Biochemical characterization for each soil isolate was performed using both selective and differential media, Gram staining, and catalase testing. TEPI011 and TEPI012 stained Gram-negative and grew on MacConkey agar, which selects for Gram-negative bacteria; on the other hand, TEPI014 stained Gram-positive and failed to grow on MacConkey agar (Figure 1I and 1J). MacConkey agar also differentiates the ability to ferment lactose; TEPI011 and TEPI012 were shown to not be able to ferment lactose, as indicated by the yellow discoloration observed around the TEOI011 and TEPI012 isolates growing on MacConkey agar (Figure 1J). We tested for the presence of a catalase enzyme in each soil isolate, which is characterized by the ability to convert hydrogen peroxide to oxygen bubbles, and all of the soil isolates tested positive for the catalase enzyme (Figure 1K). We measured the degree of hemolytic activity by growing each isolate on blood agar (Figure 1L). We determined TEPI011 and TEPI014 to have alpha hemolytic activity characterized by a greenish discoloration, and TEPI012 to have beta hemolytic activity characterized by a clear zone around the patched isolate (Figure 1L).
Taken together, these results suggest that TEP011 is a Gram-negative, lactose-fermenting negative, catalase-positive, soil bacterium from the genus Janthinobacterium with alpha hemolytic activity. TEPI012 is a Gram-negative, lactose-fermenting negative, catalase-positive, soil bacteria from the genus Pseudomonas with beta hemolytic activity. TEP014 is a Gram-positive, catalase-positive, soil bacterium from the genus Pseudoclavibacter with alpha hemolytic activity. All three isolates exhibit antimicrobial activity against both Gram-positive and Gram-negative bacteria.
The secondary metabolites produced by soil bacteria have long been considered a treasure trove for antibiotic discovery (Clardy et al., 2009). Our findings that TEPI011 (Janthinobacterium) and TEPI012 (Pseudomonas) possess antimicrobial activity are consistent with previous studies identifying these soil bacteria to produce antibiotic compounds (Gionco et al., 2017; Inan Bektas et al., 2023; O’Sullivan et al., 1990). Janthinobacterium has a characteristic purple violet color due to the production of the secondary metabolite called violacein, which is also a potent antibiotic against both Gram-negative and Gram-positive bacteria (Choi et al., 2015; Inan Bektas et al., 2023). In addition, Janthinobacterium produces peptide lactone antibiotics called janthinocins, which have been shown to be effective bactericidal agents to treat pathogens such as methicillin-resistant Staphylococcus aureus (MRSA) (O’Sullivan et al., 1990). Likewise, Pseudomonas has been shown to produce several distinct antibiotic compounds including mupirocin, fluviols, and novel organometallic compounds (Gionco et al., 2017; Haas & Keel, 2003; Smirnov et al., 1997). To our knowledge, Pseudoclavibacter has not previously been characterized as an antibiotic producer. Our biochemical characterization of Pseudoclavibacter is consistent with previous findings that Pseudoclavibacter is a Gram-positive, catalase-positive organism; however, the antimicrobial activity of Pseudoclavibacter reported in this study could potentially reveal a novel antibiotic compound (Oyaert et al., 2013; Pailhoriès et al., 2014).
","references":[{"reference":"Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local alignment search tool. Journal of Molecular Biology 215: 403-410.
","pubmedId":"","doi":"10.1016/S0022-2836(05)80360-2"},{"reference":"Choi SY, Yoon Kh, Lee JI, Mitchell RJ. 2015. Violacein: Properties and Production of a Versatile Bacterial Pigment. BioMed Research International 2015: 1-8.
","pubmedId":"","doi":"10.1155/2015/465056"},{"reference":"Christensen P, Cook FD. 1978. Lysobacter, a New Genus of Nonfruiting, Gliding Bacteria with a High Base Ratio. International Journal of Systematic Bacteriology 28: 367-393.
","pubmedId":"","doi":"10.1099/00207713-28-3-367"},{"reference":"Clardy J, Fischbach MA, Currie CR. 2009. The natural history of antibiotics. Current Biology 19: R437-R441.
","pubmedId":"","doi":"10.1016/j.cub.2009.04.001"},{"reference":"Gionco Br, Tavares ER, de Oliveira AG, Yamada-Ogatta SF, do Carmo AO, Pereira UdPd, et al., Andrade. 2017. New Insights about Antibiotic Production by Pseudomonas aeruginosa: A Gene Expression Analysis. Frontiers in Chemistry. 5: 1-10
","pubmedId":"","doi":"10.3389/fchem.2017.00066"},{"reference":"Haas D, Keel C. 2003. Regulation of antibiotic production in root-colonizing Pseudomonas spp. And relevance for biological control of plant disease. Annual Review of Phytopathology 41: 117-153.
","pubmedId":"","doi":"10.1146/annurev.phyto.41.052002.095656"},{"reference":"Handelsman J, Hernandez S, Tsang T, & Bascom-Slack C. (2018). Tiny Earth—A Research guide to Studentsourcing Antibiotic Discovery (2023rd ed.). XanEdu Publishing Inc.
","pubmedId":"","doi":""},{"reference":"Hurley A, Chevrette MG, Acharya DD, Lozano GL, Garavito M, Heinritz J, et al., Handelsman. 2021. Tiny Earth: A Big Idea for STEM Education and Antibiotic Discovery. mBio 12: e03432-20
","pubmedId":"","doi":"10.1128/mBio.03432-20"},{"reference":"Inan Bektas K, Nalcaoglu A, Kati H, Ceylan E, Nalcacioglu R, Belduz AO, Canakci S. 2022. Janthinobacterium kumbetense sp. nov., a violacein-producing bacterium isolated from spring water in Turkey, and investigation of antimicrobial activity of violacein. FEMS Microbiology Letters 370: 1-8.
","pubmedId":"","doi":"10.1093/femsle/fnac119"},{"reference":"Kudryakova I, Afoshin A, Tarlachkov S, Leontyevskaya E, Suzina N, Leontyevskaya (Vasilyeva) NL. 2023. Lysobacter gummosus 10.1.1, a Producer of Antimicrobial Agents. Microorganisms 11: 2853.
","pubmedId":"","doi":"10.3390/microorganisms11122853"},{"reference":"Martens E, Demain AL. 2017. The antibiotic resistance crisis, with a focus on the United States. The Journal of Antibiotics 70: 520-526.
","pubmedId":"","doi":"10.1038/ja.2017.30"},{"reference":"O’Sullivan J, McCullough J, Johnson JH, Bonner DP, Clark JC, Dean L, Trejo WH. 1990. Janthinocins A, B and C, novel peptide lactone antibiotics produced by Janthinobacterium lividum. I. Taxonomy, fermentation, isolation, physico-chemical and biological characterization.. The Journal of Antibiotics 43: 913-919.
","pubmedId":"","doi":"10.7164/antibiotics.43.913"},{"reference":"Oyaert M, De Baere T, Breyne J, De Laere E, Mariën S, Waets P, Laffut W. 2013. First Case of Pseudoclavibacter bifida Bacteremia in an Immunocompromised Host with Chronic Obstructive Pulmonary Disease (COPD). Journal of Clinical Microbiology 51: 1973-1976.
","pubmedId":"","doi":"10.1128/JCM.00138-13"},{"reference":"Pailhoriès Hln, Lemarié C, Quinqueneau C, Eveillard M, Baufreton C, Rouleau Fdr, et al., Kempf. 2014. First Report of Endocarditis Caused by a Pseudoclavibacter Species. Journal of Clinical Microbiology 52: 3465-3467.
","pubmedId":"","doi":"10.1128/jcm.01388-14"},{"reference":"Smirnov VV, Kiprianova EA, Garagulya AD, Esipov SE, Dovjenko SA. 2006. Fluviols, bicyclic nitrogen-rich antibiotics produced by Pseudomonas fluorescens. FEMS Microbiology Letters 153: 357-361.
","pubmedId":"","doi":"10.1111/j.1574-6968.1997.tb12596.x"},{"reference":"Theuretzbacher U, Jumde RP, Hennessy A, Cohn J, Piddock LJV. 2025. Global health perspectives on antibacterial drug discovery and the preclinical pipeline. Nature Reviews Microbiology. 1-17
","pubmedId":"","doi":"10.1038/s41579-025-01167-w"},{"reference":"Ventola CL. 2015. The antibiotic resistance crisis: part 1: causes and threats. P T 40: 277-83.
","pubmedId":"25859123","doi":""}],"title":"Antimicrobial activity of Janthinobacterium, Pseudomonas, and Pseudoclavibacter bacterial soil isolates
","reviews":[{"reviewer":{"displayName":"Aeisha Thomas"},"openAcknowledgement":false,"status":{"submitted":true}}],"curatorReviews":[]},{"id":"e61e3278-0785-4386-b3c5-527c8fc0eea7","decision":"accept","abstract":"Healthcare, and the world at large, are currently facing an antibiotic crisis caused by the increase in antibiotic resistant bacterial pathogens, combined with divestment in the drug discovery pipeline for new antibiotics. The Tiny Earth Project is a global, student-driven, effort aimed at discovering and isolating new sources of antibiotics from soil microbes that can be used to combat multi-drug resistant bacterial pathogens. This study characterizes the antimicrobial and biochemical properties of three unique bacterial soil isolates from the genera Janthinobacterium, Pseudomonas, and Pseudoclavibacter and their extracted secondary metabolites.
","acknowledgements":"These authors would like to acknowledge and thank Randolph-Macon College for supporting the Tiny Earth course-based undergraduate research experience (CURE) at the institution and the Tiny Earth Project for providing protocols and technical guidance. Authors declare no conflicts of interest.
","authors":[{"affiliations":["Randolph–Macon College, Ashland, Virginia, United States"],"departments":["Department of Biology"],"credit":["investigation","methodology","dataCuration","conceptualization","formalAnalysis","writing_originalDraft","writing_reviewEditing"],"email":"kelenasnipes@go.rmc.edu","firstName":"Kelena","lastName":"Snipes","submittingAuthor":true,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Randolph–Macon College, Ashland, Virginia, United States"],"departments":["Department of Biology"],"credit":["investigation","writing_reviewEditing"],"email":"loganangelillo@go.rmc.edu","firstName":"Logan","lastName":" Angelillo","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0004-6590-6433"},{"affiliations":["Randolph–Macon College, Ashland, Virginia, United States"],"departments":["Department of Biology"],"credit":["investigation","writing_reviewEditing"],"email":"juliac_f@icloud.com","firstName":"Julia","lastName":"Fugate","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0007-4242-9429"},{"affiliations":["Randolph–Macon College, Ashland, Virginia, United States"],"departments":["Department of Biology"],"credit":["investigation","writing_reviewEditing"],"email":"hannahmaywinton@go.rmc.edu","firstName":"Hannah-May ","lastName":"Winton","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0004-7822-9494"},{"affiliations":["Randolph–Macon College, Ashland, Virginia, United States"],"departments":["Department of Biology"],"credit":["investigation","conceptualization","formalAnalysis","dataCuration","methodology","validation","project","supervision","resources","writing_reviewEditing"],"email":"EliasTaylor-Cornejo@rmc.edu","firstName":"Elias","lastName":"Taylor-Cornejo","submittingAuthor":false,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0002-5040-8050"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"Disc diffusion assay negative controls. ","doi":"10.22002/nj0r4-32637","resourceType":"Image","name":"Extended Data.pdf","url":"https://portal.micropublication.org/uploads/8eeac176763b84b612210c4c7330d0b5.pdf"}],"funding":"No award.
","image":{"url":"https://portal.micropublication.org/uploads/068094f5308debde0e83135b2c7dccbc.jpg"},"imageCaption":"(A) Soil isolate ID TEPI010-014. TEPI010 is a known antibiotic-producing soil bacterium Lysobacter antibioticus that is used as a positive control for all experiments. (B) Soil isolate genus identified by 16S ribosome subunit gene sequencing. (C) Antibiotic screen for each soil isolate patched on top of the Gram-positive tester strain Bacillus subtilis. (D) Antibiotic screen for each soil isolate patched on top of the Gram-negative tester strain Escherichia coli. (E) Disc diffusion assay testing the antimicrobial susceptibility of Gram-positive tester strain Bacillus subtilis to antibiotic extracts from each soil isolate using a disc diffusion assay. (F) Mean ZOI in millimeters (mm) for the Gram-positive disc diffusion assay. Mean ZOI is the average of two diameter measurements across the ZOI shown. The mean ZOI was not determined (n.d.) for weak growth inhibition because the ZOI could not be measured with reliability. (G) Disc diffusion assay testing the antimicrobial susceptibility of Gram-negative tester strain Escherichia coli to antibiotic extracts from each soil isolate using a disc diffusion assay. (H) Mean ZOI in millimeters (mm) for the Gram-negative antimicrobial susceptibility test. Mean ZOI is the average of two diameter measurements across the ZOI shown. (I) Gram stain of each soil isolate. All brightfield images were taken at 100X magnification. (J) Gram-negative selection on MacConkey agar indicated by patch growth, lactose fermentation indicated by either pink patches (lactose-fermenting positive) or pale patches surrounded by yellow color (lactose-fermenting negative). (K) Catalase activity indicated by the presence/absence of bubbles from each isolate spread on a glass slide and treated with hydrogen peroxide. (L) Hemolysis on blood agar indicating alpha, beta or gamma hemolysis activity.
","imageTitle":"Antibiotic activity and biochemical characterization of bacterial soil isolates.
","methods":"Soil Sample Collection
Each soil sample was collected from locations on the Randolph-Macon College campus in Ashland, VA, near the root systems of various plants, at a soil depth of approximately 6 inches. The GPS location for each soil sample is as follows, TEPI011 37º 45' 43.2\" N, 77º 28' 33.96 \" W; TEPI012 37º 45' 44.64\" N, 77º 28' 32.27\" W; TEPI014 37º 45' 44\" N, 77º 28' 33\" W. Two tablespoons of each soil sample were collected in a sealable plastic bag and plated immediately.
Cultivation of Soil Bacteria
Each soil sample was diluted 1/10 by mixing 1 gram of soil with 9 mL of sterile water, then vortexed to mix. Four 10-fold serial dilutions were made in sterile water and 100 µL of each dilution (10-1, 10-2, 10-3, 10-4, 10-5) was plated onto either 10% Tryptic Soy Agar (TSA) or MacConkey agar. Plates were incubated at 22 °C for one week to produce single colonies of soil bacteria. A soil isolate library for each soil sample was created by picking sixteen individual colonies from serial dilution plates with a sterile toothpick and patching them onto a new 10% TSA plate in a 4 x 4 grid pattern. Soil isolate library plates were incubated at 22 °C for five days then stored at 4 °C.
Antibiotic Screen
The soil isolate library was screened for antibiotic-producing soil bacteria using the spread and patch technique (Handelsman et al., 2018). Two different tester strains, a Gram-negative tester strain (Escherichia coli, Carolina Biological, #155065) or Gram-positive tester strain (Bacillus subtilis, Carolina Biological, # 154921) were first spread onto individual 10% TSA plates using a sterile swab. The soil isolate library for each sample was then patched in the same 4 x 4 grid pattern on top of the tester strain using a sterile toothpick. Plates were incubated at 22 °C for one week. Antibiotic-producing isolates were visually determined by selecting isolate patches with a clear ZOI where the growth of the tester strain had been inhibited. Three soil isolates (TEPI011, TEPI012, and TEP014) were selected for further study. The antibiotic screen was repeated by plating isolates individually in the center of a 60 mm 10% TSA plate spread with each tester strain (E.coli and B. subtilis) and incubating plates at 22 °C for one week to verify that each isolate could produce a ZOI when patched on top of each tester strain.
Ethyl Acetate Chemical Extraction of Secondary Metabolites
Each soil isolate was spread evenly across the entire surface of a 100 mm 10% TSA plate using a sterile swab and incubated at 22 °C for one week. Agar from each plate was then cut into approximately 1 cm2 pieces using a sterile microspatula and collected in 250 mL glass Erlenmeyer flasks. To freeze-thaw cells, flasks were incubated at –80 °C for one week, then 15 mL of ethyl acetate and 10 mL of sterile water were added to frozen agar in the flask. Flasks were then covered with parafilm and aluminum foil and shaken at 200 rpm at 22 °C for one week. All the liquid from the flask was then transferred to a new 100 mL Erlenmeyer flask and left to sit for 3 minutes to allow for the liquid to separate into two layers: an aqueous bottom layer and an organic top layer composed of ethyl acetate and extracted secondary metabolites. If two layers were not visible, 1000 µL of sterile water were added to the liquid to distinguish the organic layer. The organic layer was carefully transferred to a scintillation vial and left uncapped for one week in a chemical fume hood to evaporate the ethyl acetate and leave only the extracted secondary metabolites in the vial. Each of the extracted secondary metabolites were reconstituted with 160 µL of methanol solvent.
Disc Diffusion Assay
To perform a disc diffusion assay with the extracted secondary metabolites, 30 µL of each reconstituted secondary metabolite mixture or methanol (negative control) was pipetted onto a sterile, ¼ inch diameter, blank paper disc (Carolina Biological Supply, 806491). Discs were allowed to dry for 10-15 minutes in a sterile biosafety cabinet. Tester strains (E.coli or B. subtilis) were spread on 60 mm 10% TSA agar plate using a sterile swab. Each treated disc was then placed in the center of the plate on top of the tester strain. Plates were incubated at 22 °C for one week and observed for development of a ZOI around the secondary metabolite treated discs. Two measurements of the ZOI diameter were taken though the center of the paper disc to calculate the mean ZOI.
Gram Staining
A dry mount slide of each soil isolate was prepared by spreading a single colony of bacteria in 5 µL drop of sterile water across a glass microscope slide. Slides were air-dried for 5 minutes then heat fixed. Gram stain (Carolina Biological Supply, 821050) was performed as follows: crystal violet (1 minute), iodine (1 minute), 95% ethanol (10 seconds), safranin (45 seconds). Stained sample was mounted with a coverslip and imaged at 100X magnification using a Nikon Eclipse E600 microscope equipped with a Leica MC 190 HD camera. Images were acquired with LASX 3.7.6 software.
Biochemical tests (Catalase, Hemolysin, Lactose fermentation)
Catalase test was performed on each isolate by spreading a colony on a glass microscope slide with a sterile pipette tip, then dropping 5 µL of hydrogen peroxide on top of the colony, then immediately observing for the formation of bubbles. Hemolysin assay was performed by patching each isolate with a sterile toothpick in the center of a 100 mm blood agar plate (VWR, 89405-024) and incubating the plate at 22 °C for one week. Lactose fermentation was determined by patching each isolate on a MacConkey agar plate (VWR, 89407-270) and incubating plate at 22 °C for one week.
16S Ribosomal Gene Sequencing
The genomic extraction and whole-genome sequencing using Oxford Nanopore Technology (ONT) Sequencing was outsourced to the company Eurofins Genomics. The genus of each isolate was determined using the open-source Basic Local Alignment Search Tool (BLAST) hosted by the National Center for Biotechnology Information (NCBI) (Altschul et al. 1990). Taxonomic identification was performed using BLASTn to compare the full-length 16S rRNA sequence to the NCBI 16S ribosomal RNA sequence (Bacteria and Archaea) database. Genus-level classification was assigned based on a established minimum sequence identity threshold of 95% (Janda and Abbott 2007). The 16S rRNA nucleotide sequences for all three soil isolates reported in this study are available in GeneBank under the following accession numbers: TEPI011 (PZ207879), TEPI012 (PZ207940), TEPI014 (PZ208169).
","reagents":"","patternDescription":"The rise of antimicrobial resistant (AMR) bacterial pathogens has placed a significant burden on the global healthcare system (Theuretzbacher et al. 2025). The growing number of multidrug resistant bacterial pathogens is outpacing the development of new antibiotics to treat infections by these pathogens (Martens and Demain 2017; Ventola 2015). Antibiotic discovery through the Tiny Earth Project represents a student-driven effort to combat this antibiotic crisis (Hurley et al. 2021). In this study, soil bacteria were isolated through the Tiny Earth Project at Randolph-Macon College in Ashland, VA by undergraduate microbiology students, who performed the initial sampling and culturing of bacterial soil isolates, as well as the preliminary antimicrobial screening and biochemical characterization of a soil isolate library.
Three soil isolates (TEPI011, TEPI012, and TEPI014) were selected for further validation and chemical extraction of antibiotics (Figure 1A). For all tests performed, the bacterial soil isolates were compared to a positive control strain, Lysobacter antibioticus (L. antibioticus, TEPI010), a known antibiotic-producing bacterium (Christensen and Cook 1978). The genus of each soil isolate was determined using Oxford Nanopore Technology (ONT) Sequencing to obtain a full-length 16S rRNA gene sequence for each soil isolate (approximately 1,500 base pairs). We found that TEPI011 shares a 99.87% identity with Janthinobacterium, TEPI012 shares a 99.54% identify with Pseudomonas, and TEPI014 shares a 99.66% identify with Pseudoclavibacter, which meet the established criteria for genus-level identification from a 16S rRNA gene sequence (Figure 1B) (Janda and Abbott 2007). The antimicrobial activity of each soil isolate towards a Gram-negative tester strain, Escherichia coli (E. coli), or a Gram-positive tester strain, Bacillus subtilis (B. subtilis), was validated by first spreading the tester strain on the surface of a 10% TSA agar plate, then patching each soil isolate on top of the tester strain (Figure 1C and 1D). The positive control, L. antibioticus, exhibited strong antimicrobial activity against Gram-positive bacteria and, to a lesser extent, Gram-negative bacteria, as previously described (Figure 1C and 1D) (Christensen and Cook 1978; Kudryakova et al. 2023). Likewise, all of the soil isolates showed clear antimicrobial activity against B. subtilis and, to a lesser extent, antimicrobial activity against E.coli (Figure 1C and 1D). Ethyl acetate chemical extractions of the organic secondary metabolites were performed for each isolate. The antimicrobial susceptibility of B. subtilis and E.coli to each extract was tested using a disc diffusion assay, which measures the mean zone of inhibition (ZOI) created around a paper disc containing each chemical extract (Figure 1E-1H). When the extracts were tested against the Gram-positive tester strain B. subtilis, TEPI011 (ZOI = 12.5 mm) showed the strongest antimicrobial activity, which was similar to that of the positive control extract from L. antibioticus (ZOI = 12 mm) and was substantially greater than the negative control (ZOI = 8 mm) (Figure 1E-1F and Extended Data). Extracts from the other soil isolates (TEPI012 and TEPI014) also created a visible ZOI against B. subtilis, but the exact boundary of the zones were too faint to measure reliably (Figure 1E and 1F). All extracts showed antimicrobial activity against E.coli that was substantially greater than the negative control (ZOI = 11.5 mm): TEPI010 (ZOI = 28 mm), TEPI011 (ZOI = 21.5 mm), TEPI012 (ZOI = 20.5 mm), and TEPI014 (ZOI= 19 mm) (Figure 1G-1H and Extended Data).
Biochemical characterization for each soil isolate was performed using both selective and differential media, Gram staining, and catalase testing. TEPI011 and TEPI012 stained Gram-negative and grew on MacConkey agar, which selects for Gram-negative bacteria; on the other hand, TEPI014 stained Gram-positive and failed to grow on MacConkey agar (Figure 1I and 1J). MacConkey agar also differentiates the ability to ferment lactose; TEPI011 and TEPI012 were shown to not be able to ferment lactose, as indicated by the yellow discoloration observed around the TEOI011 and TEPI012 isolates growing on MacConkey agar (Figure 1J). We tested for the presence of a catalase enzyme in each soil isolate, which is characterized by the ability to convert hydrogen peroxide to oxygen bubbles, and all of the soil isolates tested positive for the catalase enzyme (Figure 1K). We measured the degree of hemolytic activity by growing each isolate on blood agar (Figure 1L). We determined TEPI011 and TEPI014 to have alpha hemolytic activity characterized by a greenish discoloration, and TEPI012 to have beta hemolytic activity characterized by a clear zone around the patched isolate (Figure 1L).
Taken together, these results suggest that TEP011 is a Gram-negative, lactose-fermenting negative, catalase-positive, soil bacterium from the genus Janthinobacterium with alpha hemolytic activity. TEPI012 is a Gram-negative, lactose-fermenting negative, catalase-positive, soil bacteria from the genus Pseudomonas with beta hemolytic activity. TEP014 is a Gram-positive, catalase-positive, soil bacterium from the genus Pseudoclavibacter with alpha hemolytic activity. All three isolates exhibit antimicrobial activity against both Gram-positive and Gram-negative bacteria.
The secondary metabolites produced by soil bacteria have long been considered a treasure trove for antibiotic discovery (Clardy et al. 2009). Our findings that TEPI011 (Janthinobacterium) and TEPI012 (Pseudomonas) possess antimicrobial activity are consistent with previous studies identifying these soil bacteria to produce antibiotic compounds (Gionco et al. 2017; Inan Bektas et al. 2023; O’Sullivan et al. 1990). Janthinobacterium has a characteristic purple violet color due to the production of the secondary metabolite called violacein, which is also a potent antibiotic against both Gram-negative and Gram-positive bacteria (Choi et al. 2015; Inan Bektas et al. 2023). In addition, Janthinobacterium produces peptide lactone antibiotics called janthinocins, which have been shown to be effective bactericidal agents to treat pathogens such as methicillin-resistant Staphylococcus aureus (MRSA) (O’Sullivan et al. 1990). Likewise, Pseudomonas has been shown to produce several distinct antibiotic compounds including mupirocin, fluviols, and novel organometallic compounds (Gionco et al. 2017; Smirnov et al. 1997; Haas and Keel 2003). To our knowledge, Pseudoclavibacter has not previously been characterized as an antibiotic producer. Our biochemical characterization of Pseudoclavibacter is consistent with previous findings that Pseudoclavibacter is a Gram-positive, catalase-positive organism; however, the antimicrobial activity of Pseudoclavibacter reported in this study could potentially reveal a novel antibiotic compound (Oyaert et al. 2013; Pailhoriès et al. 2014).
","references":[{"reference":"
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local alignment search tool. Journal of Molecular Biology 215: 403-410.
","pubmedId":"","doi":"10.1016/S0022-2836(05)80360-2"},{"reference":"Choi SY, Yoon Kh, Lee JI, Mitchell RJ. 2015. Violacein: Properties and Production of a Versatile Bacterial Pigment. BioMed Research International 2015: 1-8.
","pubmedId":"","doi":"10.1155/2015/465056"},{"reference":"Christensen P, Cook FD. 1978. Lysobacter, a New Genus of Nonfruiting, Gliding Bacteria with a High Base Ratio. International Journal of Systematic Bacteriology 28: 367-393.
","pubmedId":"","doi":"10.1099/00207713-28-3-367"},{"reference":"Clardy J, Fischbach MA, Currie CR. 2009. The natural history of antibiotics. Current Biology 19: R437-R441.
","pubmedId":"","doi":"10.1016/j.cub.2009.04.001"},{"reference":"Gionco Br, Tavares ER, de Oliveira AG, Yamada-Ogatta SF, do Carmo AO, Pereira UdPd, et al., Andrade. 2017. New Insights about Antibiotic Production by Pseudomonas aeruginosa: A Gene Expression Analysis. Frontiers in Chemistry. 5: 1-10
","pubmedId":"","doi":"10.3389/fchem.2017.00066"},{"reference":"Haas D, Keel C. 2003. Regulation of antibiotic production in root-colonizing Pseudomonas spp. And relevance for biological control of plant disease. Annual Review of Phytopathology 41: 117-153.
","pubmedId":"","doi":"10.1146/annurev.phyto.41.052002.095656"},{"reference":"Handelsman J, Hernandez S, Tsang T, & Bascom-Slack C. (2018). Tiny Earth—A Research guide to Studentsourcing Antibiotic Discovery (2023rd ed.). XanEdu Publishing Inc.
","pubmedId":"","doi":""},{"reference":"Hurley A, Chevrette MG, Acharya DD, Lozano GL, Garavito M, Heinritz J, et al., Handelsman. 2021. Tiny Earth: A Big Idea for STEM Education and Antibiotic Discovery. mBio 12: e03432-20
","pubmedId":"","doi":"10.1128/mBio.03432-20"},{"reference":"Inan Bektas K, Nalcaoglu A, Kati H, Ceylan E, Nalcacioglu R, Belduz AO, Canakci S. 2022. Janthinobacterium kumbetense sp. nov., a violacein-producing bacterium isolated from spring water in Turkey, and investigation of antimicrobial activity of violacein. FEMS Microbiology Letters 370: 1-8.
","pubmedId":"","doi":"10.1093/femsle/fnac119"},{"reference":"Janda JM, Abbott SL. 2007. 16S rRNA Gene Sequencing for Bacterial Identification in the Diagnostic Laboratory: Pluses, Perils, and Pitfalls. Journal of Clinical Microbiology 45: 2761-2764.
","pubmedId":"","doi":"10.1128/JCM.01228-07"},{"reference":"Kudryakova I, Afoshin A, Tarlachkov S, Leontyevskaya E, Suzina N, Leontyevskaya (Vasilyeva) NL. 2023. Lysobacter gummosus 10.1.1, a Producer of Antimicrobial Agents. Microorganisms 11: 2853.
","pubmedId":"","doi":"10.3390/microorganisms11122853"},{"reference":"Martens E, Demain AL. 2017. The antibiotic resistance crisis, with a focus on the United States. The Journal of Antibiotics 70: 520-526.
","pubmedId":"","doi":"10.1038/ja.2017.30"},{"reference":"O’Sullivan J, McCullough J, Johnson JH, Bonner DP, Clark JC, Dean L, Trejo WH. 1990. Janthinocins A, B and C, novel peptide lactone antibiotics produced by Janthinobacterium lividum. I. Taxonomy, fermentation, isolation, physico-chemical and biological characterization.. The Journal of Antibiotics 43: 913-919.
","pubmedId":"","doi":"10.7164/antibiotics.43.913"},{"reference":"Oyaert M, De Baere T, Breyne J, De Laere E, Mariën S, Waets P, Laffut W. 2013. First Case of Pseudoclavibacter bifida Bacteremia in an Immunocompromised Host with Chronic Obstructive Pulmonary Disease (COPD). Journal of Clinical Microbiology 51: 1973-1976.
","pubmedId":"","doi":"10.1128/JCM.00138-13"},{"reference":"Pailhoriès Hln, Lemarié C, Quinqueneau C, Eveillard M, Baufreton C, Rouleau Fdr, et al., Kempf. 2014. First Report of Endocarditis Caused by a Pseudoclavibacter Species. Journal of Clinical Microbiology 52: 3465-3467.
","pubmedId":"","doi":"10.1128/jcm.01388-14"},{"reference":"Smirnov VV, Kiprianova EA, Garagulya AD, Esipov SE, Dovjenko SA. 2006. Fluviols, bicyclic nitrogen-rich antibiotics produced by Pseudomonas fluorescens. FEMS Microbiology Letters 153: 357-361.
","pubmedId":"","doi":"10.1111/j.1574-6968.1997.tb12596.x"},{"reference":"Theuretzbacher U, Jumde RP, Hennessy A, Cohn J, Piddock LJV. 2025. Global health perspectives on antibacterial drug discovery and the preclinical pipeline. Nature Reviews Microbiology. 1-17
","pubmedId":"","doi":"10.1038/s41579-025-01167-w"},{"reference":"Ventola CL. 2015. The antibiotic resistance crisis: part 1: causes and threats. P T 40: 277-83.
","pubmedId":"25859123","doi":""}],"title":"Antimicrobial activity of Janthinobacterium, Pseudomonas, and Pseudoclavibacter bacterial soil isolates
","reviews":[],"curatorReviews":[]},{"id":"f55a4c50-b856-4a0d-8004-ce6e58d23339","decision":"publish","abstract":"Healthcare, and the world at large, are currently facing an antibiotic crisis caused by the increase in antibiotic resistant bacterial pathogens, combined with divestment in the drug discovery pipeline for new antibiotics. The Tiny Earth Project is a global, student-driven, effort aimed at discovering and isolating new sources of antibiotics from soil microbes that can be used to combat multi-drug resistant bacterial pathogens. This study characterizes the antimicrobial and biochemical properties of three unique bacterial soil isolates from the genera Janthinobacterium, Pseudomonas, and Pseudoclavibacter and their extracted secondary metabolites.
","acknowledgements":"These authors would like to acknowledge and thank Randolph-Macon College for supporting the Tiny Earth course-based undergraduate research experience (CURE) at the institution and the Tiny Earth Project for providing protocols and technical guidance. Authors declare no conflicts of interest.
","authors":[{"affiliations":["Randolph–Macon College, Ashland, Virginia, United States"],"departments":["Department of Biology"],"credit":["investigation","methodology","dataCuration","conceptualization","formalAnalysis","writing_originalDraft","writing_reviewEditing"],"email":"kelenasnipes@go.rmc.edu","firstName":"Kelena","lastName":"Snipes","submittingAuthor":true,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Randolph–Macon College, Ashland, Virginia, United States"],"departments":["Department of Biology"],"credit":["investigation","writing_reviewEditing"],"email":"loganangelillo@go.rmc.edu","firstName":"Logan","lastName":" Angelillo","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0004-6590-6433"},{"affiliations":["Randolph–Macon College, Ashland, Virginia, United States"],"departments":["Department of Biology"],"credit":["investigation","writing_reviewEditing"],"email":"juliac_f@icloud.com","firstName":"Julia","lastName":"Fugate","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0007-4242-9429"},{"affiliations":["Randolph–Macon College, Ashland, Virginia, United States"],"departments":["Department of Biology"],"credit":["investigation","writing_reviewEditing"],"email":"hannahmaywinton@go.rmc.edu","firstName":"Hannah-May ","lastName":"Winton","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0004-7822-9494"},{"affiliations":["Randolph–Macon College, Ashland, Virginia, United States"],"departments":["Department of Biology"],"credit":["investigation","conceptualization","formalAnalysis","dataCuration","methodology","validation","project","supervision","resources","writing_reviewEditing"],"email":"EliasTaylor-Cornejo@rmc.edu","firstName":"Elias","lastName":"Taylor-Cornejo","submittingAuthor":false,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0002-5040-8050"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"Disc diffusion assay for negative controls
","doi":"10.22002/cgzwv-4zz19","resourceType":"Image","name":"Extended Data.pdf","url":"https://portal.micropublication.org/uploads/e89bfba163e6a543674ffe62483dd8b5.pdf"}],"funding":"No award.
","image":{"url":"https://portal.micropublication.org/uploads/068094f5308debde0e83135b2c7dccbc.jpg"},"imageCaption":"(A) Soil isolate ID TEPI010-014. TEPI010 is a known antibiotic-producing soil bacterium Lysobacter antibioticus that is used as a positive control for all experiments. (B) Soil isolate genus identified by 16S ribosome subunit gene sequencing. (C) Antibiotic screen for each soil isolate patched on top of the Gram-positive tester strain Bacillus subtilis. (D) Antibiotic screen for each soil isolate patched on top of the Gram-negative tester strain Escherichia coli. (E) Disc diffusion assay testing the antimicrobial susceptibility of Gram-positive tester strain Bacillus subtilis to antibiotic extracts from each soil isolate using a disc diffusion assay. (F) Mean ZOI in millimeters (mm) for the Gram-positive disc diffusion assay. Mean ZOI is the average of two diameter measurements across the ZOI shown. The mean ZOI was not determined (n.d.) for weak growth inhibition because the ZOI could not be measured with reliability. (G) Disc diffusion assay testing the antimicrobial susceptibility of Gram-negative tester strain Escherichia coli to antibiotic extracts from each soil isolate using a disc diffusion assay. (H) Mean ZOI in millimeters (mm) for the Gram-negative antimicrobial susceptibility test. Mean ZOI is the average of two diameter measurements across the ZOI shown. (I) Gram stain of each soil isolate. All brightfield images were taken at 100X magnification. (J) Gram-negative selection on MacConkey agar indicated by patch growth, lactose fermentation indicated by either pink patches (lactose-fermenting positive) or pale patches surrounded by yellow color (lactose-fermenting negative). (K) Catalase activity indicated by the presence/absence of bubbles from each isolate spread on a glass slide and treated with hydrogen peroxide. (L) Hemolysis on blood agar indicating alpha, beta or gamma hemolysis activity.
","imageTitle":"Antibiotic activity and biochemical characterization of bacterial soil isolates
","methods":"Soil Sample Collection
Each soil sample was collected from locations on the Randolph-Macon College campus in Ashland, VA, near the root systems of various plants, at a soil depth of approximately 6 inches. The GPS location for each soil sample is as follows, TEPI011 37º 45' 43.2\" N, 77º 28' 33.96 \" W; TEPI012 37º 45' 44.64\" N, 77º 28' 32.27\" W; TEPI014 37º 45' 44\" N, 77º 28' 33\" W. Two tablespoons of each soil sample were collected in a sealable plastic bag and plated immediately.
Cultivation of Soil Bacteria
Each soil sample was diluted 1/10 by mixing 1 gram of soil with 9 mL of sterile water, then vortexed to mix. Four 10-fold serial dilutions were made in sterile water and 100 µL of each dilution (10-1, 10-2, 10-3, 10-4, 10-5) was plated onto either 10% Tryptic Soy Agar (TSA) or MacConkey agar. Plates were incubated at 22 °C for one week to produce single colonies of soil bacteria. A soil isolate library for each soil sample was created by picking sixteen individual colonies from serial dilution plates with a sterile toothpick and patching them onto a new 10% TSA plate in a 4 x 4 grid pattern. Soil isolate library plates were incubated at 22 °C for five days then stored at 4 °C.
Antibiotic Screen
The soil isolate library was screened for antibiotic-producing soil bacteria using the spread and patch technique (Handelsman et al., 2018). Two different tester strains, a Gram-negative tester strain (Escherichia coli, Carolina Biological, #155065) or Gram-positive tester strain (Bacillus subtilis, Carolina Biological, # 154921) were first spread onto individual 10% TSA plates using a sterile swab. The soil isolate library for each sample was then patched in the same 4 x 4 grid pattern on top of the tester strain using a sterile toothpick. Plates were incubated at 22 °C for one week. Antibiotic-producing isolates were visually determined by selecting isolate patches with a clear ZOI where the growth of the tester strain had been inhibited. Three soil isolates (TEPI011, TEPI012, and TEP014) were selected for further study. The antibiotic screen was repeated by plating isolates individually in the center of a 60 mm 10% TSA plate spread with each tester strain (E.coli and B. subtilis) and incubating plates at 22 °C for one week to verify that each isolate could produce a ZOI when patched on top of each tester strain.
Ethyl Acetate Chemical Extraction of Secondary Metabolites
Each soil isolate was spread evenly across the entire surface of a 100 mm 10% TSA plate using a sterile swab and incubated at 22 °C for one week. Agar from each plate was then cut into approximately 1 cm2 pieces using a sterile microspatula and collected in 250 mL glass Erlenmeyer flasks. To freeze-thaw cells, flasks were incubated at –80 °C for one week, then 15 mL of ethyl acetate and 10 mL of sterile water were added to frozen agar in the flask. Flasks were then covered with parafilm and aluminum foil and shaken at 200 rpm at 22 °C for one week. All the liquid from the flask was then transferred to a new 100 mL Erlenmeyer flask and left to sit for 3 minutes to allow for the liquid to separate into two layers: an aqueous bottom layer and an organic top layer composed of ethyl acetate and extracted secondary metabolites. If two layers were not visible, 1000 µL of sterile water were added to the liquid to distinguish the organic layer. The organic layer was carefully transferred to a scintillation vial and left uncapped for one week in a chemical fume hood to evaporate the ethyl acetate and leave only the extracted secondary metabolites in the vial. Each of the extracted secondary metabolites were reconstituted with 160 µL of methanol solvent.
Disc Diffusion Assay
To perform a disc diffusion assay with the extracted secondary metabolites, 30 µL of each reconstituted secondary metabolite mixture or methanol (negative control) was pipetted onto a sterile, ¼ inch diameter, blank paper disc (Carolina Biological Supply, 806491). Discs were allowed to dry for 10-15 minutes in a sterile biosafety cabinet. Tester strains (E.coli or B. subtilis) were spread on 60 mm 10% TSA agar plate using a sterile swab. Each treated disc was then placed in the center of the plate on top of the tester strain. Plates were incubated at 22 °C for one week and observed for development of a ZOI around the secondary metabolite treated discs. Two measurements of the ZOI diameter were taken though the center of the paper disc to calculate the mean ZOI.
Gram Staining
A dry mount slide of each soil isolate was prepared by spreading a single colony of bacteria in 5 µL drop of sterile water across a glass microscope slide. Slides were air-dried for 5 minutes then heat fixed. Gram stain (Carolina Biological Supply, 821050) was performed as follows: crystal violet (1 minute), iodine (1 minute), 95% ethanol (10 seconds), safranin (45 seconds). Stained sample was mounted with a coverslip and imaged at 100X magnification using a Nikon Eclipse E600 microscope equipped with a Leica MC 190 HD camera. Images were acquired with LASX 3.7.6 software.
Biochemical tests (Catalase, Hemolysin, Lactose fermentation)
Catalase test was performed on each isolate by spreading a colony on a glass microscope slide with a sterile pipette tip, then dropping 5 µL of hydrogen peroxide on top of the colony, then immediately observing for the formation of bubbles. Hemolysin assay was performed by patching each isolate with a sterile toothpick in the center of a 100 mm blood agar plate (VWR, 89405-024) and incubating the plate at 22 °C for one week. Lactose fermentation was determined by patching each isolate on a MacConkey agar plate (VWR, 89407-270) and incubating plate at 22 °C for one week.
16S Ribosomal Gene Sequencing
The genomic extraction and whole-genome sequencing using Oxford Nanopore Technology (ONT) Sequencing was outsourced to the company Eurofins Genomics. The genus of each isolate was determined using the open-source Basic Local Alignment Search Tool (BLAST) hosted by the National Center for Biotechnology Information (NCBI) (Altschul et al. 1990). Taxonomic identification was performed using BLASTn to compare the full-length 16S rRNA sequence to the NCBI 16S ribosomal RNA sequence (Bacteria and Archaea) database. Genus-level classification was assigned based on a established minimum sequence identity threshold of 95% (Janda and Abbott 2007). The 16S rRNA nucleotide sequences for all three soil isolates reported in this study are available in GeneBank under the following accession numbers: TEPI011 (PZ207879), TEPI012 (PZ207940), TEPI014 (PZ208169).
","reagents":"","patternDescription":"The rise of antimicrobial resistant (AMR) bacterial pathogens has placed a significant burden on the global healthcare system (Theuretzbacher et al. 2025). The growing number of multidrug resistant bacterial pathogens is outpacing the development of new antibiotics to treat infections by these pathogens (Martens and Demain 2017; Ventola 2015). Antibiotic discovery through the Tiny Earth Project represents a student-driven effort to combat this antibiotic crisis (Hurley et al. 2021). In this study, soil bacteria were isolated through the Tiny Earth Project at Randolph-Macon College in Ashland, VA by undergraduate microbiology students, who performed the initial sampling and culturing of bacterial soil isolates, as well as the preliminary antimicrobial screening and biochemical characterization of a soil isolate library.
Three soil isolates (TEPI011, TEPI012, and TEPI014) were selected for further validation and chemical extraction of antibiotics (Figure 1A). For all tests performed, the bacterial soil isolates were compared to a positive control strain, Lysobacter antibioticus (L. antibioticus, TEPI010), a known antibiotic-producing bacterium (Christensen and Cook 1978). The genus of each soil isolate was determined using Oxford Nanopore Technology (ONT) Sequencing to obtain a full-length 16S rRNA gene sequence for each soil isolate (approximately 1,500 base pairs). We found that TEPI011 shares a 99.87% identity with Janthinobacterium, TEPI012 shares a 99.54% identify with Pseudomonas, and TEPI014 shares a 99.66% identify with Pseudoclavibacter, which meet the established criteria for genus-level identification from a 16S rRNA gene sequence (Figure 1B) (Janda and Abbott 2007). The antimicrobial activity of each soil isolate towards a Gram-negative tester strain, Escherichia coli (E. coli), or a Gram-positive tester strain, Bacillus subtilis (B. subtilis), was validated by first spreading the tester strain on the surface of a 10% TSA agar plate, then patching each soil isolate on top of the tester strain (Figure 1C and 1D). The positive control, L. antibioticus, exhibited strong antimicrobial activity against Gram-positive bacteria and, to a lesser extent, Gram-negative bacteria, as previously described (Figure 1C and 1D) (Christensen and Cook 1978; Kudryakova et al. 2023). Likewise, all of the soil isolates showed clear antimicrobial activity against B. subtilis and, to a lesser extent, antimicrobial activity against E.coli (Figure 1C and 1D). Ethyl acetate chemical extractions of the organic secondary metabolites were performed for each isolate. The antimicrobial susceptibility of B. subtilis and E.coli to each extract was tested using a disc diffusion assay, which measures the mean zone of inhibition (ZOI) created around a paper disc containing each chemical extract (Figure 1E-1H). When the extracts were tested against the Gram-positive tester strain B. subtilis, TEPI011 (ZOI = 12.5 mm) showed the strongest antimicrobial activity, which was similar to that of the positive control extract from L. antibioticus (ZOI = 12 mm) and was substantially greater than the negative control (ZOI = 8 mm) (Figure 1E-1F and Extended Data). Extracts from the other soil isolates (TEPI012 and TEPI014) also created a visible ZOI against B. subtilis, but the exact boundary of the zones were too faint to measure reliably (Figure 1E and 1F). All extracts showed antimicrobial activity against E.coli that was substantially greater than the negative control (ZOI = 11.5 mm): TEPI010 (ZOI = 28 mm), TEPI011 (ZOI = 21.5 mm), TEPI012 (ZOI = 20.5 mm), and TEPI014 (ZOI= 19 mm) (Figure 1G-1H and Extended Data).
Biochemical characterization for each soil isolate was performed using both selective and differential media, Gram staining, and catalase testing. TEPI011 and TEPI012 stained Gram-negative and grew on MacConkey agar, which selects for Gram-negative bacteria; on the other hand, TEPI014 stained Gram-positive and failed to grow on MacConkey agar (Figure 1I and 1J). MacConkey agar also differentiates the ability to ferment lactose; TEPI011 and TEPI012 were shown to not be able to ferment lactose, as indicated by the yellow discoloration observed around the TEOI011 and TEPI012 isolates growing on MacConkey agar (Figure 1J). We tested for the presence of a catalase enzyme in each soil isolate, which is characterized by the ability to convert hydrogen peroxide to oxygen bubbles, and all of the soil isolates tested positive for the catalase enzyme (Figure 1K). We measured the degree of hemolytic activity by growing each isolate on blood agar (Figure 1L). We determined TEPI011 and TEPI014 to have alpha hemolytic activity characterized by a greenish discoloration, and TEPI012 to have beta hemolytic activity characterized by a clear zone around the patched isolate (Figure 1L).
Taken together, these results suggest that TEP011 is a Gram-negative, lactose-fermenting negative, catalase-positive, soil bacterium from the genus Janthinobacterium with alpha hemolytic activity. TEPI012 is a Gram-negative, lactose-fermenting negative, catalase-positive, soil bacteria from the genus Pseudomonas with beta hemolytic activity. TEP014 is a Gram-positive, catalase-positive, soil bacterium from the genus Pseudoclavibacter with alpha hemolytic activity. All three isolates exhibit antimicrobial activity against both Gram-positive and Gram-negative bacteria.
The secondary metabolites produced by soil bacteria have long been considered a treasure trove for antibiotic discovery (Clardy et al. 2009). Our findings that TEPI011 (Janthinobacterium) and TEPI012 (Pseudomonas) possess antimicrobial activity are consistent with previous studies identifying these soil bacteria to produce antibiotic compounds (Gionco et al. 2017; Inan Bektas et al. 2023; O’Sullivan et al. 1990). Janthinobacterium has a characteristic purple violet color due to the production of the secondary metabolite called violacein, which is also a potent antibiotic against both Gram-negative and Gram-positive bacteria (Choi et al. 2015; Inan Bektas et al. 2023). In addition, Janthinobacterium produces peptide lactone antibiotics called janthinocins, which have been shown to be effective bactericidal agents to treat pathogens such as methicillin-resistant Staphylococcus aureus (MRSA) (O’Sullivan et al. 1990). Likewise, Pseudomonas has been shown to produce several distinct antibiotic compounds including mupirocin, fluviols, and novel organometallic compounds (Gionco et al. 2017; Smirnov et al. 1997; Haas and Keel 2003). To our knowledge, Pseudoclavibacter has not previously been characterized as an antibiotic producer. Our biochemical characterization of Pseudoclavibacter is consistent with previous findings that Pseudoclavibacter is a Gram-positive, catalase-positive organism; however, the antimicrobial activity of Pseudoclavibacter reported in this study could potentially reveal a novel antibiotic compound (Oyaert et al. 2013; Pailhoriès et al. 2014).
","references":[{"reference":"
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local alignment search tool. Journal of Molecular Biology 215: 403-410.
","pubmedId":"","doi":"10.1016/S0022-2836(05)80360-2"},{"reference":"Choi SY, Yoon Kh, Lee JI, Mitchell RJ. 2015. Violacein: Properties and Production of a Versatile Bacterial Pigment. BioMed Research International 2015: 1-8.
","pubmedId":"","doi":"10.1155/2015/465056"},{"reference":"Christensen P, Cook FD. 1978. Lysobacter, a New Genus of Nonfruiting, Gliding Bacteria with a High Base Ratio. International Journal of Systematic Bacteriology 28: 367-393.
","pubmedId":"","doi":"10.1099/00207713-28-3-367"},{"reference":"Clardy J, Fischbach MA, Currie CR. 2009. The natural history of antibiotics. Current Biology 19: R437-R441.
","pubmedId":"","doi":"10.1016/j.cub.2009.04.001"},{"reference":"Gionco Br, Tavares ER, de Oliveira AG, Yamada-Ogatta SF, do Carmo AO, Pereira UdPd, et al., Andrade. 2017. New Insights about Antibiotic Production by Pseudomonas aeruginosa: A Gene Expression Analysis. Frontiers in Chemistry. 5: 1-10
","pubmedId":"","doi":"10.3389/fchem.2017.00066"},{"reference":"Haas D, Keel C. 2003. Regulation of antibiotic production in root-colonizing Pseudomonas spp. And relevance for biological control of plant disease. Annual Review of Phytopathology 41: 117-153.
","pubmedId":"","doi":"10.1146/annurev.phyto.41.052002.095656"},{"reference":"Handelsman J, Hernandez S, Tsang T, & Bascom-Slack C. (2018). Tiny Earth—A Research guide to Studentsourcing Antibiotic Discovery (2023rd ed.). XanEdu Publishing Inc.
","pubmedId":"","doi":""},{"reference":"Hurley A, Chevrette MG, Acharya DD, Lozano GL, Garavito M, Heinritz J, et al., Handelsman. 2021. Tiny Earth: A Big Idea for STEM Education and Antibiotic Discovery. mBio 12: e03432-20
","pubmedId":"","doi":"10.1128/mBio.03432-20"},{"reference":"Inan Bektas K, Nalcaoglu A, Kati H, Ceylan E, Nalcacioglu R, Belduz AO, Canakci S. 2022. Janthinobacterium kumbetense sp. nov., a violacein-producing bacterium isolated from spring water in Turkey, and investigation of antimicrobial activity of violacein. FEMS Microbiology Letters 370: 1-8.
","pubmedId":"","doi":"10.1093/femsle/fnac119"},{"reference":"Janda JM, Abbott SL. 2007. 16S rRNA Gene Sequencing for Bacterial Identification in the Diagnostic Laboratory: Pluses, Perils, and Pitfalls. Journal of Clinical Microbiology 45: 2761-2764.
","pubmedId":"","doi":"10.1128/JCM.01228-07"},{"reference":"Kudryakova I, Afoshin A, Tarlachkov S, Leontyevskaya E, Suzina N, Leontyevskaya (Vasilyeva) NL. 2023. Lysobacter gummosus 10.1.1, a Producer of Antimicrobial Agents. Microorganisms 11: 2853.
","pubmedId":"","doi":"10.3390/microorganisms11122853"},{"reference":"Martens E, Demain AL. 2017. The antibiotic resistance crisis, with a focus on the United States. The Journal of Antibiotics 70: 520-526.
","pubmedId":"","doi":"10.1038/ja.2017.30"},{"reference":"O’Sullivan J, McCullough J, Johnson JH, Bonner DP, Clark JC, Dean L, Trejo WH. 1990. Janthinocins A, B and C, novel peptide lactone antibiotics produced by Janthinobacterium lividum. I. Taxonomy, fermentation, isolation, physico-chemical and biological characterization.. The Journal of Antibiotics 43: 913-919.
","pubmedId":"","doi":"10.7164/antibiotics.43.913"},{"reference":"Oyaert M, De Baere T, Breyne J, De Laere E, Mariën S, Waets P, Laffut W. 2013. First Case of Pseudoclavibacter bifida Bacteremia in an Immunocompromised Host with Chronic Obstructive Pulmonary Disease (COPD). Journal of Clinical Microbiology 51: 1973-1976.
","pubmedId":"","doi":"10.1128/JCM.00138-13"},{"reference":"Pailhoriès Hln, Lemarié C, Quinqueneau C, Eveillard M, Baufreton C, Rouleau Fdr, et al., Kempf. 2014. First Report of Endocarditis Caused by a Pseudoclavibacter Species. Journal of Clinical Microbiology 52: 3465-3467.
","pubmedId":"","doi":"10.1128/jcm.01388-14"},{"reference":"Smirnov VV, Kiprianova EA, Garagulya AD, Esipov SE, Dovjenko SA. 2006. Fluviols, bicyclic nitrogen-rich antibiotics produced by Pseudomonas fluorescens. FEMS Microbiology Letters 153: 357-361.
","pubmedId":"","doi":"10.1111/j.1574-6968.1997.tb12596.x"},{"reference":"Theuretzbacher U, Jumde RP, Hennessy A, Cohn J, Piddock LJV. 2025. Global health perspectives on antibacterial drug discovery and the preclinical pipeline. Nature Reviews Microbiology. 1-17
","pubmedId":"","doi":"10.1038/s41579-025-01167-w"},{"reference":"Ventola CL. 2015. The antibiotic resistance crisis: part 1: causes and threats. P T 40: 277-83.
","pubmedId":"25859123","doi":""}],"title":"Antimicrobial activity of Janthinobacterium, Pseudomonas, and Pseudoclavibacter bacterial soil isolates
","reviews":[],"curatorReviews":[]}]}},"species":{"species":[{"value":"acer saccharum","label":"Acer saccharum","imageSrc":"","imageAlt":"","mod":"TreeGenes","modLink":"https://treegenesdb.org","linkVariable":""},{"value":"achillea millefolium","label":"Achillea millefolium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"acinetobacter baylyi","label":"Acinetobacter baylyi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"actinobacteria bacterium","label":"Actinobacteria bacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adelges tsugae","label":"Adelges tsugae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adenocaulon chilense","label":"Adenocaulon chilense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aedes japonicus","label":"Aedes japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aegorhinus vitulus","label":"Aegorhinus vitulus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alaimidae","label":"Alaimidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"allobates femoralis","label":"Allobates femoralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alnus glutinosa","label":"Alnus glutinosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa aestivalis","label":"Alosa aestivalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa pseudoharengus","label":"Alosa pseudoharengus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alternaria alternata","label":"Alternaria alternata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"amynthas agrestis","label":"Amynthas Agrestis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma caninum","label":"Ancylostoma caninum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma ceylanicum","label":"Ancylostoma ceylanicum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anemone multifida","label":"Anemone multifida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anguilla rostrata","label":"Anguilla rostrata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anisakis simplex","label":"Anisakis simplex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anomala albopilosa","label":"Anomala albopilosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arabidopsis","label":"Arabidopsis","imageSrc":"arabidopsis.png","imageAlt":"Arabidopsis graphic by Zoe Zorn CC BY 4.0","mod":"TAIR","modLink":"https://arabidopsis.org","linkVariable":""},{"value":"architeuthis dux","label":"Architeuthis dux","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arion vulgaris","label":"Arion vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"armeria","label":"Armeria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"artemia","label":"Artemia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arthrobacter sp.","label":"Arthrobacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia","label":"Ascaridia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia galli","label":"Ascaridia galli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"asparagopsis taxiformis","label":"Asparagopsis taxiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"astatotilapia burtoni","label":"Astatotilapia burtoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"avena sativa","label":"Avena sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aves","label":"Aves","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus","label":"Bacillus (firmicutes)","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus cereus","label":"Bacillus cereus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus mycoides","label":"Bacillus mycoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus subtilis","label":"Bacillus subtilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus thuringiensis","label":"Bacillus thuringiensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus toyonensis","label":"Bacillus toyonensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus wiedmannii","label":"Bacillus wiedmannii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteria","label":"Bacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteriophage","label":"Bacteriophage","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bactrocera","label":"Bactrocera sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"batrachospermum gelatinosum","label":"Batrachospermum gelatinosum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula lenta","label":"Betula lenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula nigra","label":"Betula nigra","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus dahlbohmii","label":"Bombus dahlbohmii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus terrestris","label":"Bombus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombyx mori","label":"Bombyx mori","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bos taurus","label":"Bos Taurus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brachygobius doriae","label":"Brachygobius doriae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica oleracea","label":"Brassica oleracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica rapa","label":"Brassica rapa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brugia malayi","label":"Brugia malayi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"burkholderia thailandensis","label":"Burkholderia thailandensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"buttiauxella","label":"Buttiauxella","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis brenneri","label":"Caenorhabditis brenneri","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis briggsae","label":"Caenorhabditis briggsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"c. elegans","label":"Caenorhabditis elegans","imageSrc":"c-elegans.jpg","imageAlt":"C. elegans graphic by Zoe Zorn CC BY 4.0","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"caenorhabditis inopinata","label":"Caenorhabditis inopinata","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis japonica","label":"Caenorhabditis japonica","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis nigoni","label":"Caenorhabditis nigoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis remanei","label":"Caenorhabditis remanei","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis tropicalis","label":"Caenorhabditis tropicalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus","label":"Calidifontibacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus erzuremensis","label":"Calidifontibacillus erzuremensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calliphora sp","label":"Calliphora sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caltha sagittata","label":"Caltha sagittata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cambarus latimanus","label":"Cambarus latimanus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"candida albicans","label":"Candida albicans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"canis familiaris","label":"Canis familiaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cannabis sativa","label":"Cannabis sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caretta caretta","label":"Caretta caretta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cassiopea xamachana","label":"Cassiopea xamachana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caulobacter vibrioides","label":"Caulobacter vibrioides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cephalopods","label":"Cephalopoda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cerastium arvense","label":"Cerastium arvense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceriodaphnia","label":"Ceriodaphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceroglossus suturalis","label":"Ceroglossus suturalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chaetoceros","label":"Chaetoceros","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chamaecrista fasciculata","label":"Chamaecrista fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chilicola chalcidiformis","label":"Chilicola chalcidiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chitinimonas","label":"Chitinimonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chlamydomonas reinhardtii","label":"Chlamydomonas reinhardtii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chromobacterium","label":"Chromobacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysemys picta","label":"Chrysemys picta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysoperla rufilabris","label":"Chrysoperla rufilabris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"citrus","label":"Citrus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"clavibacter sp.","label":"Clavibacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"colinus virginianus","label":"Colinus virginianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crassostrea virginica","label":"Crassostrea virginica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crithidia fasciculata","label":"Crithidia fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cutibacterium acnes","label":"Cutibacterium acnes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cyanobacteria","label":"Cyanobacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia","label":"Daphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia pulex","label":"Daphnia pulex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera","label":"Diabrotica virgifera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera virgifera virus 1","label":"Diabrotica virgifera virgifera virus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"d. discoideum","label":"Dictyostelium discoideum","imageSrc":"dicty.png","imageAlt":"D. discoideum","mod":"dictyBase","modLink":"http://dictybase.org","linkVariable":""},{"value":"diptera","label":"Diptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dotocryptus bellicosus","label":"Dotocryptus bellicosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drechmeria coniospora","label":"Drechmeria coniospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drosophila","label":"Drosophila","imageSrc":"drosophila.png","imageAlt":"Drosophila graphic by Zoe Zorn CC BY 4.0","mod":"FlyBase","modLink":"https://flybase.org/doi/","linkVariable":"doi"},{"value":"dryopteris campyloptera","label":"Dryopteris campyloptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris expansa","label":"Dryopteris expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris intermedia","label":"Dryopteris intermedia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dugesia dorotocephala","label":"Dugesia dorotocephala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"elasmobranchii","label":"Elasmobranchii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"embryophyta","label":"Embryophyta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enoploteuthis chunii","label":"Enoploteuthis chunii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterobacter aerogenes","label":"Enterobacter aerogenes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterococcus raffinosus","label":"Enterococcus raffinosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"epichloë coenophiala","label":"Epichloë coenophiala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"equus caballus","label":"Equus caballus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erigeron sp","label":"Erigeron sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eristalis","label":"Eristalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eruca vesicaria","label":"Eruca vesicaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erwinia carotovora","label":"Erwinia carotovora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erythronium americanum","label":"Erythronium americanum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"escherichia coli","label":"Escherichia coli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eukaryota","label":"Eukaryotes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"felis catus","label":"Felis catus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella novicida","label":"Francisella novicida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella tularensis","label":"Francisella tularensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fraxinus americana","label":"Fraxinus americana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fucus distichus","label":"Fucus distichus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fungi","label":"Fungi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gasteropelecus sp.","label":"Gasteropelecus sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"geranium sp","label":"Geranium sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"girardia","label":"Girardia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glaucomys volans","label":"Glaucomys volans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glycine max","label":"Glycine max","imageSrc":"","imageAlt":"","mod":"Soybase","modLink":"https://soybase.org","linkVariable":""},{"value":"glyptemys insculpta","label":"Glyptemys insculpta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gossypium hirsutum","label":"Gossypium hirsutum","imageSrc":"","imageAlt":"","mod":"CottonGen","modLink":"https://www.cottongen.org/","linkVariable":""},{"value":"gromphadorhina portentosa","label":"Gromphadorhina portentosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gryllodes sigillatus","label":"Gryllodes sigillatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"haliotis rufescens","label":"Haliotis rufescens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hepacivirus hominis","label":"Hepatitis C Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"herpes simplex virus type 1","label":"Herpes simplex virus type 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human","label":"Human","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human coronavirus oc43","label":"Human coronavirus OC43","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydra vulgaris","label":"Hydra vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydropsyche sp","label":"Hydropsyche sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hymenoptera","label":"Hymenoptera","imageSrc":"","imageAlt":"","mod":"Hymenoptera Genome Database","modLink":"https://hymenoptera.elsiklab.missouri.edu/","linkVariable":""},{"value":"hypochaeris radicata","label":"Hypochaeris radicata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hypodynerus vespiformis","label":"Hypodynerus vespiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflaviridae","label":"Iflaviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflavuris","label":"Iflavirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ipomoea hederacea","label":"Ipomoea hederacea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera","label":"Ischnomera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera ruficollis","label":"Ischnomera ruficollis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"julidochromis marlieri","label":"Julidochromis marlieri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"juniperus virginiana","label":"Juniperus virginiana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"kluyveromyces marxianus","label":"Kluyveromyces marxianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"l. casei","label":"L. casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lacticaseibacillus casei","label":"Lacticaseibacillus casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"larentiinae sp","label":"Larentiinae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"laurus nobilis","label":"Laurus nobilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lepidoptera","label":"Lepidoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"leucanthemum vulgare","label":"Leucanthemum vulgare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"linepithema humile","label":"Linepithema humile","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"liometopum occidentale","label":"Liometopum occidentale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lolium arundinaceum","label":"Lolium arundinaceum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbriculus variegatus","label":"Lumbriculus variegatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbricus terrestris","label":"Lumbricus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lupinus polyphyllus","label":"Lupinus polyphyllus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lycorma delicatula","label":"Lycorma delicatula","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lynx rufus","label":"Lynx rufus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"magnaporthe oryzae","label":"Magnaporthe oryzae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mammalia","label":"Mammalia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"manihot esculenta","label":"Manihot esculenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"medicago lupulina","label":"Medicago lupulina","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"meloidogyne","label":"Meloidogyne","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mimus polyglottos","label":"Mimus polyglottos","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bryophyta","label":"Mosses","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mouse","label":"Mouse","imageSrc":"","imageAlt":"","mod":"MGI","modLink":"https://informatics.jax.org","linkVariable":""},{"value":"m. minutoides","label":"Mus minutoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mycobacterium smegmatis","label":"Mycobacterium smegmatis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nakaseomyces glabratus","label":"Nakaseomyces glabratus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nauphoeta cinerea","label":"Nauphoeta cinerea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"neurospora","label":"Neurospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"n. benthamiana","label":"Nicotiana benthamiana","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/Nicotiana_benthamiana/genome","linkVariable":""},{"value":"nicotiana tabacum","label":"Nicotiana tabacum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae","label":"Noctuidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae sp","label":"Noctuidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nothobranchius furzeri","label":"Nothobranchius furzeri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"onchocerca volvulus","label":"Onchocerca volvulus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"orconectes virilis","label":"Orconectes virilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ormia ochracea","label":"Ormia ochracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"o. sativa","label":"Oryza sativa","imageSrc":"","imageAlt":"","mod":"Gramene","modLink":"https://www.gramene.org/","linkVariable":""},{"value":"other","label":"Other","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"oxalis enneaphylla","label":"Oxalis enneaphylla","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea","label":"Pantoea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea agglomerans","label":"Pantoea agglomerans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"papaver sp","label":"Papaver sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paramecium bursaria","label":"Paramecium bursaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"partitiviridae","label":"Partitiviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pelodiscus sinensis","label":"Pelodiscus sinensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"perezia recurvata","label":"Perezia recurvata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"petromyzon marinus","label":"Petromyzon marinus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis","label":"Photinus pyralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis associated partiti-like virus","label":"Photinus pyralis associated partiti-like virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis iflavirus 1","label":"Photinus pyralis iflavirus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"physcomitrium patens","label":"Physcomitrium patens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus strobus","label":"Pinus strobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus taeda","label":"Pinus taeda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"platycheirus","label":"Platycheirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"plectus sambesii","label":"Plectus sambesii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pogonomyrmex occidentalis","label":"Pogonomyrmex occidentalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"poncirus trifoliata","label":"Poncirus trifoliata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"populus deltoides","label":"Populus deltoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"potato virus y","label":"Potato virus Y","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"primula magellanica","label":"Primula magellanica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pristionchus pacificus","label":"Pristionchus pacificus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"prunus persica","label":"Prunus persica","imageSrc":"","imageAlt":"","mod":"Genome Database for Rosaceae","modLink":"https://www.rosaceae.org/","linkVariable":""},{"value":"psalmopoeus iriminia","label":"Psalmopoeus iriminia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudanabaena sp.","label":"Pseudanabaena sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas","label":"Pseudomonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas aeruginosa","label":"Pseudomonas aeruginosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas glycinae","label":"Pseudomonas glycinae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas putida","label":"Pseudomonas putida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas syringae","label":"Pseudomonas syringae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pterophyllum scalare","label":"Pterophyllum scalare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"python regius","label":"Python regius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"quercus macrocarpa","label":"Quercus macrocarpa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ralstonia solanacearum","label":"Ralstonia solanacearum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranitomeya imitator","label":"Ranitomeya imitator","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranunculus peduncularis","label":"Ranunculus peduncularis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"rat","label":"Rat","imageSrc":"","imageAlt":"","mod":"RGD","modLink":"https://rgd.mcw.edu","linkVariable":""},{"value":"rheinheimera","label":"Rheinheimera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ribes rubrum","label":"Ribes rubrum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"sars-cov-2","label":"SARS-CoV-2","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. cerevisiae","label":"Saccharomyces cerevisiae","imageSrc":"yeast.png","imageAlt":"Yeast graphic by Zoe Zorn CC BY 4.0","mod":"SGD","modLink":"https://yeastgenome.org","linkVariable":""},{"value":"saccharomyces paradoxus","label":"Saccharomyces paradoxus ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. uvarum","label":"Saccharomyces uvarum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schistosoma","label":"Schistosoma","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schizosaccharomyces japonicus","label":"Schizosaccharomyces japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. pombe","label":"Schizosaccharomyces pombe","imageSrc":"pombe.png","imageAlt":"Pombe graphic by Zoe Zorn © Caltech","mod":"PomBase","modLink":"https://www.pombase.org/reference/PMID:","linkVariable":"pmId"},{"value":"schmidtea mediterranea","label":"Schmidtea mediterranea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"senecio sp","label":"Senecio sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"simocephalus","label":"Simocephalus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"siraitia grosvenorii","label":"Siraitia grosvenorii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"solanum lycopersicum","label":"Solanum lycopersicum","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/1/view/","linkVariable":""},{"value":"sorghum","label":"Sorghum","imageSrc":"","imageAlt":"","mod":"SorghumBase","modLink":"https://www.sorghumbase.org","linkVariable":""},{"value":"spiroplasma eriocheiris","label":"Spiroplasma eriocheiris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus aureus","label":"Staphylococcus aureus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus epidermidis","label":"Staphylococcus epidermidis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"steinernema carpocapsae","label":"Steinernema carpocapsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"steinernema hermaphroditum","label":"Steinernema hermaphroditum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stenotrophomonas geniculata","label":"Stenotrophomonas geniculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus gordonii ","label":"Streptococcus gordonii ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus mutans","label":"Streptococcus mutans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":" streptococcus pneumoniae","label":"Streptococcus pneumoniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. purpuratus","label":"Strongylocentrotus purpuratus","imageSrc":"","imageAlt":"","mod":"Echinobase","modLink":"https://www.echinobase.org","linkVariable":""},{"value":"strongyloides ratti","label":"Strongyloides ratti","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"sulfolobus","label":"Sulfolobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"symphoricarpos albus","label":"Symphoricarpos albus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syncirsodes","label":"Syncirsodes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"synechococcus elongatus","label":"Synechococcus elongatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syrphidae","label":"Syrphidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tarantobelus jeffdanielsi","label":"Tarantobelus jeffdanielsi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"taraxacum officinale","label":"Taraxacum officinale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tatochila theodice","label":"Tatochila theodice","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetrahymena","label":"Tetrahymena","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetramorium immigrans","label":"Tetramorium immigrans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tomato brown rugose fruit virus","label":"ToBRFV","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trachemys scripta","label":"Trachemys scripta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tribolium castaneum","label":"Tribolium castaneum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichoptera","label":"Trichoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichuris muris","label":"Trichuris muris","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"trifolium repens","label":"Trifolium repens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trypoxylus dichotomus","label":"Trypoxylus dichotomus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tsuga canadensis","label":"Tsuga canadensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ulva expansa","label":"Ulva expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"universal","label":"Universal","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"vargula hilgendorfii","label":"Vargula hilgendorfii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"vespula vulgaris","label":"Vespula vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"virus","label":"Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"watasenia scintillans","label":"Watasenia scintillans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"wolbachia pipientis","label":"Wolbachia pipientis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"xenopus","label":"Xenopus","imageSrc":"xenopus.png","imageAlt":"Xenopus graphic by Zoe Zorn CC BY 4.0","mod":"XenBase","modLink":"https://xenbase.org","linkVariable":""},{"value":"xenorhabdus griffiniae","label":"Xenorhabdus griffiniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"yramea cytheris","label":"Yramea cytheris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zaprionus indianus","label":"Zaprionus indianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zea mays","label":"Zea mays","imageSrc":"","imageAlt":"","mod":"MaizeGDB","modLink":"https://www.maizegdb.org","linkVariable":""},{"value":"zebrafish","label":"Zebrafish","imageSrc":"zebrafish.png","imageAlt":"Zebrafish graphic by Zoe Zorn CC BY 4.0","mod":"ZFIN","modLink":"https://zfin.org","linkVariable":""}]}},"pageContext":{"id":"648c95b2-4a18-4324-80ec-76ec61c964cc","citedBy":[],"parsedCsv":{"csvHeader":[],"csvData":[]}}}, "staticQueryHashes": ["2114697108"]}